ID: 922579704

View in Genome Browser
Species Human (GRCh38)
Location 1:226687813-226687835
Sequence GCTCTCTACTCAAGACCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922579699_922579704 6 Left 922579699 1:226687784-226687806 CCTCATTGTCCAGGGGCCTTTTG 0: 1
1: 0
2: 1
3: 10
4: 305
Right 922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG 0: 1
1: 0
2: 0
3: 3
4: 79
922579701_922579704 -3 Left 922579701 1:226687793-226687815 CCAGGGGCCTTTTGTGTGTGGCT 0: 1
1: 0
2: 5
3: 37
4: 203
Right 922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG 0: 1
1: 0
2: 0
3: 3
4: 79
922579696_922579704 14 Left 922579696 1:226687776-226687798 CCATTGCTCCTCATTGTCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 250
Right 922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG 0: 1
1: 0
2: 0
3: 3
4: 79
922579702_922579704 -10 Left 922579702 1:226687800-226687822 CCTTTTGTGTGTGGCTCTCTACT 0: 1
1: 0
2: 2
3: 16
4: 303
Right 922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922579704 Original CRISPR GCTCTCTACTCAAGACCATA GGG Intronic
907613060 1:55892409-55892431 GCACTCTTCTCAACACCACATGG - Intergenic
907847307 1:58220625-58220647 CCTCTCTACTGAAGAACTTAGGG + Intronic
918815770 1:189179857-189179879 GTTCTCTACTAAAGACCTTAAGG - Intergenic
920928710 1:210366984-210367006 TCTCTGTGCTCAAGTCCATATGG + Intronic
921056818 1:211548789-211548811 GCTCACTTCTCAAGAGCATCAGG + Intergenic
922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG + Intronic
1070591161 10:77802096-77802118 GCTCTCTCCTCAAGCCCGGAGGG + Intronic
1078448084 11:11420021-11420043 CCTCTCTGCTCAAGCCCACAGGG - Intronic
1078509634 11:11975807-11975829 GGTCACAAGTCAAGACCATATGG + Intronic
1088994509 11:114985035-114985057 CTTCTCAACTCACGACCATAGGG + Intergenic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1095484810 12:42673952-42673974 GCTCTCTTATCTGGACCATAGGG + Intergenic
1104144633 12:126020755-126020777 CCTTTCAACTTAAGACCATAGGG + Intergenic
1112825499 13:103387930-103387952 TCTCTCTAATCAAGCACATAGGG + Intergenic
1114513347 14:23280420-23280442 GCTTTCTCCTCAAGACCAGGTGG + Intronic
1126651537 15:50927300-50927322 GCTCTTTACTCCAGAGCATGGGG - Intronic
1127082063 15:55390527-55390549 GAACTCTACTGAAGACAATATGG + Intronic
1130581050 15:85137010-85137032 TCACTCTACACAAGACCAGAAGG + Intronic
1133223664 16:4329751-4329773 GGTCTTTACTCAATACCAAAGGG - Intronic
1137709965 16:50559794-50559816 GCTCTATGCTCAAGGCCAGAAGG - Intronic
1138901329 16:61274481-61274503 GCTCCCTACTCCATACCATGGGG - Intergenic
1148780982 17:50121713-50121735 GCTCTCTATTCAAGGCCTGAGGG + Intronic
1150821779 17:68440718-68440740 GCTCTCAACTCAAGAACCAATGG + Intronic
1152036648 17:77877505-77877527 GCTCTCTCCTCCATGCCATAAGG - Intergenic
1161211533 19:3068451-3068473 GCTCACTGCTCAAGACCTTAGGG + Intergenic
1165144100 19:33720681-33720703 GTTCTCCCCTCAAGACCATGGGG + Intronic
926265968 2:11320941-11320963 GTTCTCTACTGAAGACTCTAGGG - Intronic
935087871 2:99866245-99866267 GCTTTCTACTGAACACCATGTGG - Intronic
935440210 2:103084794-103084816 ACACTCTACTCAAGCTCATAGGG + Intergenic
940271954 2:151900621-151900643 GCCATCTACTCACAACCATATGG - Intronic
943876621 2:193074239-193074261 GCTCTCTCCCCAGGACCAGAGGG - Intergenic
944217305 2:197269338-197269360 GCACTCTACTCATAACCAGAAGG + Intronic
945763173 2:213940543-213940565 TCTCTCTACTCTAGAGAATAAGG - Intronic
948938987 2:241186935-241186957 GCTGTCTACTCAAGAGCTTCAGG - Intergenic
1169056508 20:2626278-2626300 CCTCTCTACTCAACATCATCTGG + Intronic
1176235412 20:64051389-64051411 TCTCTCTACTCACAACCTTAGGG + Intronic
1178003855 21:28194495-28194517 ACACTGTACTCTAGACCATATGG + Intergenic
1178021482 21:28413602-28413624 TCTTTCTACTAAAGACCATTTGG + Intergenic
1178137371 21:29642535-29642557 GCTCTCCACACATGTCCATAAGG - Intronic
1178594679 21:33942526-33942548 GCCCTCTACTCAAGAGGGTAGGG + Intergenic
1181801165 22:25348758-25348780 TGTCACTACTCAAGACCTTAGGG - Intergenic
951590425 3:24258502-24258524 GCTCTGTACTTAGTACCATACGG + Intronic
951930487 3:27961279-27961301 GCACTCTAATAAAGACCACAGGG + Intergenic
951950201 3:28191848-28191870 GCTCTCTTTTCAAGGCAATATGG + Intergenic
955020315 3:55114567-55114589 GGTCTCTACTAAAGAACATCAGG - Intergenic
962215787 3:133520322-133520344 CTTCTCTACTCAGGACCAAATGG + Intergenic
965150007 3:164960847-164960869 GCTCTCACCACAAGACCATTAGG + Intergenic
969280343 4:6166523-6166545 GCTCTCTACCTGAGGCCATAGGG + Intronic
969390304 4:6887843-6887865 GCTATCTGCTTAAGAACATAAGG + Intergenic
970264499 4:14266186-14266208 GCTCTCTTCTGAAGACACTATGG - Intergenic
970290320 4:14564379-14564401 GCTCTCTCCTGTGGACCATAAGG + Intergenic
979668744 4:123340434-123340456 GCTATTTACTCAAAACCATTGGG + Intergenic
981574630 4:146192029-146192051 GCTTTCTGCTCAAGGCAATATGG + Intronic
983459001 4:168003780-168003802 GCACTCTGCTCAAAACCCTATGG + Intergenic
988722802 5:33894891-33894913 GCTCTGTGCTAAAGACTATATGG + Intergenic
990902285 5:60765419-60765441 GGTCTCTGTTCCAGACCATATGG + Intronic
994283107 5:97929982-97930004 GCTCTCTACTCAACTCCACTAGG + Intergenic
994351287 5:98749189-98749211 GCTCTCTCCTCATGACCAGCAGG - Intergenic
1000184399 5:158844964-158844986 GCACGGTACTCAAGACCAAAAGG + Intronic
1001558171 5:172650368-172650390 GCTCTGTTCTCAGGACCAGAGGG + Intronic
1004587018 6:17012523-17012545 CCTCCCTGCTCAAGACCATTAGG + Intergenic
1005053316 6:21705955-21705977 GCTCTCTACTCTAAGCAATATGG - Intergenic
1007033029 6:38646294-38646316 TCTCTCTATTCACTACCATATGG + Intergenic
1007140216 6:39565032-39565054 GCTCTCTTCTCAGTACAATATGG - Intronic
1013402489 6:109812412-109812434 GCTCTCTACTTAAAACCTTCTGG - Intronic
1023369025 7:39494099-39494121 TCTCTCTGCTAAAGGCCATATGG + Intergenic
1024519613 7:50293404-50293426 GCTTTCTACTCAAGCACACAAGG + Intergenic
1024542299 7:50486814-50486836 GCTCTCTACTTAGGAACAAAAGG - Intronic
1041320761 8:56610289-56610311 GCTCTCTGCTTAAGAACAGAAGG - Intergenic
1043558682 8:81465352-81465374 GCTCACTATTTAAGAGCATATGG + Intergenic
1056078932 9:83070502-83070524 GCAATGTAATCAAGACCATATGG - Intergenic
1057226025 9:93293621-93293643 ACTGTCTACTCAAAACCACAGGG - Intronic
1058641588 9:107091711-107091733 GCTCCCATCTCAAGAACATAAGG + Intergenic
1187127196 X:16465135-16465157 GCTCTCTACTCAAGAAGAGAAGG + Intergenic
1187556770 X:20359100-20359122 ACTCTCTCCTCAAGACTAAAAGG - Intergenic
1187995752 X:24924742-24924764 GATCTTTAATCAAGACCAGAAGG + Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189401628 X:40674799-40674821 GTTCTGTCCTCAAGACCATTTGG - Intronic
1191974856 X:66860997-66861019 CCTCTCTACTCAAACCCTTAGGG + Intergenic
1194898092 X:99469743-99469765 GCTCTCTGCTCAGCTCCATAGGG - Intergenic
1195268576 X:103209042-103209064 GCATTCTACTCAAGCTCATATGG - Intergenic
1198976997 X:142347317-142347339 GCTCTCTTCTCAAGTTTATAGGG + Intergenic
1200740563 Y:6849518-6849540 CCTCTCTAGTCAGGACCCTATGG + Intergenic