ID: 922580733

View in Genome Browser
Species Human (GRCh38)
Location 1:226695881-226695903
Sequence ATGAGGGAAGAGAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2246
Summary {0: 1, 1: 1, 2: 7, 3: 194, 4: 2043}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922580721_922580733 7 Left 922580721 1:226695851-226695873 CCCCCCAAACCCAGGGGGCAAGA 0: 1
1: 0
2: 1
3: 11
4: 182
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580724_922580733 4 Left 922580724 1:226695854-226695876 CCCAAACCCAGGGGGCAAGACAG 0: 1
1: 0
2: 4
3: 79
4: 291
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580716_922580733 25 Left 922580716 1:226695833-226695855 CCACAATGTCACTGTGAGCCCCC 0: 1
1: 0
2: 1
3: 24
4: 229
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580726_922580733 -2 Left 922580726 1:226695860-226695882 CCCAGGGGGCAAGACAGTAAGAT 0: 1
1: 0
2: 1
3: 10
4: 108
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580727_922580733 -3 Left 922580727 1:226695861-226695883 CCAGGGGGCAAGACAGTAAGATG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580723_922580733 5 Left 922580723 1:226695853-226695875 CCCCAAACCCAGGGGGCAAGACA 0: 1
1: 0
2: 0
3: 26
4: 283
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580725_922580733 3 Left 922580725 1:226695855-226695877 CCAAACCCAGGGGGCAAGACAGT 0: 1
1: 0
2: 1
3: 11
4: 129
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580722_922580733 6 Left 922580722 1:226695852-226695874 CCCCCAAACCCAGGGGGCAAGAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043
922580715_922580733 26 Left 922580715 1:226695832-226695854 CCCACAATGTCACTGTGAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 171
Right 922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG 0: 1
1: 1
2: 7
3: 194
4: 2043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922580733 Original CRISPR ATGAGGGAAGAGAGGGAAGC GGG Intronic
Too many off-targets to display for this crispr