ID: 922581804

View in Genome Browser
Species Human (GRCh38)
Location 1:226703646-226703668
Sequence TGCTGCGGGCCCGCTAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581804_922581811 18 Left 922581804 1:226703646-226703668 CCAGCGCTAGCGGGCCCGCAGCA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 922581811 1:226703687-226703709 GAAATGCTGACCTGCACCCCTGG 0: 1
1: 0
2: 2
3: 11
4: 167
922581804_922581806 -10 Left 922581804 1:226703646-226703668 CCAGCGCTAGCGGGCCCGCAGCA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 922581806 1:226703659-226703681 GCCCGCAGCAGAGGCAGTAGCGG No data
922581804_922581810 -8 Left 922581804 1:226703646-226703668 CCAGCGCTAGCGGGCCCGCAGCA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 922581810 1:226703661-226703683 CCGCAGCAGAGGCAGTAGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 212
922581804_922581808 -9 Left 922581804 1:226703646-226703668 CCAGCGCTAGCGGGCCCGCAGCA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 922581808 1:226703660-226703682 CCCGCAGCAGAGGCAGTAGCGGG 0: 1
1: 0
2: 1
3: 33
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581804 Original CRISPR TGCTGCGGGCCCGCTAGCGC TGG (reversed) Intronic
905108287 1:35576937-35576959 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905108293 1:35576954-35576976 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905108299 1:35576971-35576993 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905108305 1:35576988-35577010 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905108311 1:35577005-35577027 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905108317 1:35577022-35577044 CGCTGGGGTCCCGCTGGCGCTGG - Intronic
905775635 1:40665627-40665649 TGCTGCGGAGCCGGCAGCGCAGG - Exonic
908132146 1:61083676-61083698 GGCCGCGGGCCGGGTAGCGCCGG + Intronic
909873807 1:80778666-80778688 TGCTGCCGGCCAGATAGCCCAGG - Intergenic
919657744 1:200214093-200214115 TGCTGCGGGACAGCTACCACGGG + Intergenic
920171502 1:204074794-204074816 TGCCGCGGGCCCTCCAGGGCGGG - Intronic
922581804 1:226703646-226703668 TGCTGCGGGCCCGCTAGCGCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1076534255 10:131166818-131166840 TGCTGCGGGCCCAGAAGAGCCGG - Exonic
1082028617 11:47589585-47589607 TACTGCGGGCCCGCAGGCCCGGG - Intergenic
1096791334 12:54047068-54047090 TGCTTCTCGCCCGCCAGCGCAGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1105038786 12:132945922-132945944 TGCTTCCCGCCCGCTAGCCCTGG - Intronic
1105327419 13:19382887-19382909 TGCTGCGGGACAGCTACCACGGG + Intergenic
1107851746 13:44577728-44577750 TGCCGCGTGCCCGCGCGCGCCGG - Intergenic
1115851624 14:37594563-37594585 TGCAGCGGGCGGGCGAGCGCCGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1120765956 14:88326604-88326626 TGCTGGGGGCCGGCGAGTGCAGG - Intronic
1127103345 15:55588570-55588592 AGCCGCGGGCCCGCGAGCCCCGG - Intronic
1129323856 15:74789357-74789379 TGCTGAGGGACCACCAGCGCAGG + Intronic
1129451220 15:75652315-75652337 TGCTGGGGGCCCACTGGGGCAGG + Intronic
1130997786 15:88913319-88913341 TGCTGCGGGGACGCGGGCGCTGG + Exonic
1133978386 16:10616734-10616756 TGCTGCGGGCTCCCTGGAGCAGG - Intergenic
1137731447 16:50693517-50693539 TGCTGCGGTCCCGGCAGAGCAGG + Intergenic
1142768082 17:2076838-2076860 TGCTGCGGGCCAGCTGGAGTTGG - Intronic
1142849268 17:2696406-2696428 TGGTGGGGGCCGGCCAGCGCAGG - Intronic
1150413414 17:64966104-64966126 AGCTGCGGGACCGCTATAGCCGG - Intergenic
1150798402 17:68259113-68259135 AGCTGCGGGACCGCTATAGCCGG + Intergenic
1152783659 17:82237276-82237298 TGCTGCAGGACCGCTACGGCTGG + Exonic
1155170118 18:23260779-23260801 TGCTGAGGGCCAGCAAGAGCAGG + Intronic
1161693613 19:5752693-5752715 TGCTGCGGGCCCAACAGCGTGGG + Intronic
1162026930 19:7899764-7899786 TGCCGCGGGCCGGCTGGAGCTGG + Exonic
1163632153 19:18423028-18423050 TGCTGCGAGCCCCCGAGGGCAGG - Intronic
1165595699 19:37009907-37009929 GGCTGCGGGCGCCCTAGGGCCGG - Intronic
1168311797 19:55464444-55464466 TGCTGCGGGCCCTGCAGCCCCGG - Intergenic
927811883 2:26185024-26185046 CGCCCCCGGCCCGCTAGCGCCGG + Exonic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
930661013 2:54053265-54053287 TGCTGGGGGCCCCATAGGGCTGG + Intronic
932599241 2:73112682-73112704 TGCTGCGGGCCCGCGGGCTGCGG - Exonic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
946847282 2:223870432-223870454 TGCTGCAGGCCCGAGAGCCCTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1175582808 20:60113493-60113515 TGCTGGGGGCCAGGTAGCCCAGG + Intergenic
1181668664 22:24415244-24415266 TGGTGCGGGCACGCCAGGGCTGG + Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
968114801 3:196081598-196081620 GGCTGCGGGTCCGGGAGCGCGGG - Intronic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
974055136 4:56976861-56976883 TGCTTGGGGCCCACCAGCGCGGG + Exonic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998333744 5:141352071-141352093 TGCTGCAGGCCAGCGAGCCCGGG + Exonic
998334817 5:141361958-141361980 TGCTGCAGGCCAGCGAGCCCGGG + Exonic
998343733 5:141441941-141441963 TGCTGCAGGCCAGCAAGCCCAGG + Intronic
1001191622 5:169637436-169637458 TGCTGCGGGGCCGGCGGCGCGGG + Intronic
1001524427 5:172418581-172418603 TGTTGCAGGCCCGCAAGGGCTGG + Intronic
1002714370 5:181217349-181217371 TGATGCGGCCCCGGCAGCGCAGG - Intergenic
1004203923 6:13574421-13574443 TGCCGCGGGCTCGCGAGCGGAGG + Intergenic
1006578564 6:35063369-35063391 AGCTCCGGGCGTGCTAGCGCAGG + Intronic
1015894519 6:138003852-138003874 TGCTCCTGGCCAGCTAGGGCAGG + Intergenic
1015935599 6:138404058-138404080 TGCCGCGGCCCCGCCCGCGCTGG - Intronic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1019147300 6:169983552-169983574 TGCTGCGGTCCCGTCAGCTCAGG - Intergenic
1019529414 7:1496037-1496059 TGCTGCGGGACCGCTCCTGCCGG + Intronic
1029287017 7:99472770-99472792 TGGTTCGGGCCCACTCGCGCGGG + Intergenic
1033366136 7:140673544-140673566 TGCAGCGGGGCGGCTGGCGCGGG + Exonic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1049102358 8:140588777-140588799 TGCAGAGGGCCCGCCAGCCCTGG - Intronic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1185504775 X:624145-624167 TGCTGCGGGACCCCCAGCCCCGG + Intergenic
1189304866 X:39979369-39979391 TGGTGCTGACCCGCTAGCCCTGG - Intergenic
1195894647 X:109733206-109733228 AACCGCGTGCCCGCTAGCGCTGG + Exonic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic