ID: 922581832

View in Genome Browser
Species Human (GRCh38)
Location 1:226703786-226703808
Sequence CTTTCTCCCAAGCCGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581832_922581835 -6 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581835 1:226703803-226703825 AGAAAGGATGTGTTTCAGTCTGG 0: 1
1: 0
2: 2
3: 26
4: 242
922581832_922581836 -5 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581836 1:226703804-226703826 GAAAGGATGTGTTTCAGTCTGGG 0: 1
1: 0
2: 0
3: 23
4: 236
922581832_922581837 15 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581837 1:226703824-226703846 GGGTTTCCTCATTTGCAAAATGG 0: 1
1: 6
2: 122
3: 1013
4: 4766
922581832_922581838 16 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581838 1:226703825-226703847 GGTTTCCTCATTTGCAAAATGGG 0: 3
1: 62
2: 602
3: 3090
4: 8917

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581832 Original CRISPR CTTTCTCCCAAGCCGGAAGC TGG (reversed) Intronic
No off target data available for this crispr