ID: 922581835

View in Genome Browser
Species Human (GRCh38)
Location 1:226703803-226703825
Sequence AGAAAGGATGTGTTTCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581832_922581835 -6 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581835 1:226703803-226703825 AGAAAGGATGTGTTTCAGTCTGG 0: 1
1: 0
2: 2
3: 26
4: 242
922581831_922581835 -3 Left 922581831 1:226703783-226703805 CCGCCAGCTTCCGGCTTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 922581835 1:226703803-226703825 AGAAAGGATGTGTTTCAGTCTGG 0: 1
1: 0
2: 2
3: 26
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581835 Original CRISPR AGAAAGGATGTGTTTCAGTC TGG Intronic
900636168 1:3666837-3666859 AGAAAAGATGTTTTTCAATGAGG + Intronic
902052800 1:13577403-13577425 TGAATGAATGTGTTTCAGTGTGG - Intergenic
903892736 1:26580805-26580827 AGCAAGGAAGTGGTTCAGCCAGG + Intergenic
906324671 1:44837781-44837803 AGAAAGGATGGGTTTGTGCCGGG + Intronic
908137598 1:61149190-61149212 AGAAAGGAAATGGTTCAGGCTGG - Intronic
909074088 1:71032117-71032139 ATAAAGGATGAGTTGTAGTCTGG - Intronic
909554177 1:76934332-76934354 AGAAAGGCTGTGTTTCAGAGGGG + Intronic
910492453 1:87787482-87787504 GGAAAGGAAGTATTTCAATCTGG - Intergenic
914745751 1:150499903-150499925 AGTAAAGATGTGTTTCAGGAGGG + Intronic
916807305 1:168270903-168270925 AAAATGGCTGTGCTTCAGTCAGG - Intergenic
917298531 1:173548153-173548175 AGAATGGATGTTTTACAATCTGG - Intronic
917730399 1:177869666-177869688 AGGAAGAATCTGTTTCAGACTGG - Intergenic
922581835 1:226703803-226703825 AGAAAGGATGTGTTTCAGTCTGG + Intronic
924306861 1:242698495-242698517 AGAAAGGAGGTGTATTAGTCCGG + Intergenic
924622881 1:245677807-245677829 TGGAGGTATGTGTTTCAGTCTGG + Intronic
1063448778 10:6137167-6137189 AGATAACATGTGTGTCAGTCAGG - Intergenic
1063744106 10:8860136-8860158 AGAAACAAAGTGTTTCAGTAAGG + Intergenic
1065468460 10:26050988-26051010 AGAAAAGATATGTTACACTCTGG - Intronic
1066551284 10:36560488-36560510 AGAATGGAAGGGTTTCACTCTGG + Intergenic
1068589472 10:58838910-58838932 AGAAAGGATTCTTTTGAGTCTGG - Intergenic
1069951878 10:72024677-72024699 AGAAAGGAGATTTTTCAGTAAGG + Intergenic
1070637506 10:78140992-78141014 AGAAAGCAGTTGTTGCAGTCAGG - Intergenic
1070692453 10:78537233-78537255 AGAACGGATGCATTTCACTCTGG - Intergenic
1072434148 10:95400354-95400376 AGACAGGATGTGGTTCAGAGAGG - Intronic
1074784904 10:116830333-116830355 AGAAAGAATCAGTTGCAGTCTGG - Intergenic
1076449485 10:130546903-130546925 AGAAAGGAGGTATTTCAGTGGGG + Intergenic
1076916735 10:133426118-133426140 TGAAAGGCAGTGTTTCACTCCGG - Intergenic
1076936839 10:133570913-133570935 TGAAAGGCAGTGTTTCACTCCGG - Intergenic
1078781675 11:14444639-14444661 AGAAATGATGTGTGTAGGTCGGG + Intronic
1079678972 11:23268520-23268542 AGAAATTATGTGATTGAGTCAGG - Intergenic
1080684358 11:34503150-34503172 AAAAAGGATTAGTTTCAGTTTGG - Intronic
1083088129 11:60171097-60171119 AGAAATGGTGTGTGTCAGTGGGG + Intergenic
1083104147 11:60341853-60341875 AGAAATGGTGTGTGTCAGTGGGG - Intronic
1083460880 11:62810954-62810976 GGTAAGGATGTGTTTGAGTCAGG - Intronic
1083907839 11:65685576-65685598 AGAAAAGAAGTATTACAGTCAGG - Intergenic
1084266126 11:68006127-68006149 AGAGAGGAGGTGTATCAGTCAGG - Intergenic
1084562262 11:69911613-69911635 AGGAAGGGTGGGTTTCACTCGGG + Intergenic
1087347932 11:96994699-96994721 GGAAAGTATCTGTATCAGTCAGG - Intergenic
1087553448 11:99682603-99682625 AGAACGGATGTGTTTGGGTTTGG - Intronic
1087813051 11:102629374-102629396 AGAAAAGATTTGGTTCAGTGGGG + Intergenic
1087928223 11:103945328-103945350 AGAAATGATGTGTGTCAGTCAGG - Intronic
1088817624 11:113432557-113432579 AAAAATGATGTGTTTAAGACAGG - Intronic
1090044919 11:123322731-123322753 AGGGAGGAGGTGTTTAAGTCAGG + Intergenic
1090057510 11:123436234-123436256 AAAAAGTATGAGTTTCAGTCAGG - Intergenic
1091324089 11:134671166-134671188 CGAATGGATGTGTCTCAGGCTGG - Intergenic
1095118805 12:38388262-38388284 AGAAAGTTTGTGTTTCATTTAGG - Intergenic
1095443048 12:42256916-42256938 AAAAAAAATGTGTTTTAGTCAGG + Intronic
1099172484 12:79381251-79381273 AGAAAGAATGTGTTACTTTCAGG - Intronic
1099178833 12:79454610-79454632 AATAAAGATGTGTTGCAGTCGGG - Intergenic
1102173458 12:110859599-110859621 AGAAGTGACGTGTTTCAGCCAGG - Intronic
1103215475 12:119198439-119198461 AGAAAAGAGGTGTTTCAGATTGG + Intronic
1103279032 12:119739275-119739297 AAAAAGGATTTGATTCAATCTGG - Intronic
1103513308 12:121490082-121490104 GGAAAGGCTGTGTGTCACTCCGG + Intronic
1103699078 12:122838922-122838944 AGAAAGGCTGTGTTTCCTCCTGG - Intronic
1103961831 12:124613777-124613799 AGCAAGGATGTGGGTGAGTCAGG - Intergenic
1107190935 13:37584986-37585008 TGAAAAGATGTGTTTCACTGTGG + Intronic
1108955363 13:56149282-56149304 AGAAAACATGTGTATCAGTTTGG + Intergenic
1109474279 13:62857848-62857870 GGAAAGAATGTTTTTAAGTCCGG - Intergenic
1109556734 13:63986156-63986178 AGAAAGATTCTGTGTCAGTCGGG - Intergenic
1109559765 13:64031268-64031290 AGGAAGGCTGTGTTTGTGTCTGG - Intergenic
1110307453 13:74006345-74006367 AGAAAGCATGTGTTAAAGTTAGG - Intronic
1111003770 13:82221476-82221498 AGTATGGAAGTGTGTCAGTCTGG + Intergenic
1111430957 13:88147564-88147586 AGAAAGGAAGTATTACACTCAGG + Intergenic
1114722593 14:24898347-24898369 AAAAAGCATGTGGTTCAGTGAGG - Intronic
1115488421 14:33935741-33935763 GGATAGGATGTGTTTGAGTCTGG - Intronic
1115721506 14:36166506-36166528 AGTATGTATATGTTTCAGTCTGG - Intergenic
1116560868 14:46377131-46377153 GGAGAGGGTGTGTTTCACTCAGG + Intergenic
1117098785 14:52324221-52324243 AAAAAGCATCGGTTTCAGTCAGG + Intronic
1118516444 14:66533566-66533588 AGGAAGGTAGTGTTTCAGTAAGG + Intronic
1121362162 14:93271704-93271726 GGACAGGATGTGTTTTAATCTGG - Intronic
1123678575 15:22738561-22738583 AGAAAGCTTCTGTATCAGTCTGG + Intergenic
1124022613 15:25938393-25938415 AAAATGGAAGTGTTTCAGCCAGG + Intergenic
1124330780 15:28812842-28812864 AGAAAGCTTCTGTATCAGTCTGG + Intergenic
1124511596 15:30331929-30331951 AGAAATGGTGTGTTGCAGTCCGG - Intergenic
1124725505 15:32152719-32152741 ATAAAGGATGTGTTTGGGTGGGG + Intronic
1124731318 15:32198828-32198850 AGAAATGGTGTGTTGCAGTCCGG + Intergenic
1124928757 15:34098432-34098454 AGAAAGAAATTGGTTCAGTCAGG - Intronic
1128430958 15:67592840-67592862 AGCAAAGGTGTATTTCAGTCTGG + Intronic
1128701239 15:69806028-69806050 TGAAAGGAGGTGTTTAAGGCAGG - Intergenic
1129374888 15:75123475-75123497 AGAAAATAAGTGTTTCAGGCCGG - Intergenic
1129518909 15:76173393-76173415 AGAAAGGCTGTGTTAAAGTCAGG + Intronic
1129660581 15:77550769-77550791 AGAAGGGAGGTGTTTCAGAGTGG + Intergenic
1131005559 15:88974710-88974732 ATAAAGGATATTTTTCAGCCAGG + Intergenic
1131306395 15:91247678-91247700 AGAAAGGAATTGCTGCAGTCAGG + Intronic
1133096222 16:3448110-3448132 AGAAAGGATGGGTTGGAGGCTGG + Intronic
1133183092 16:4073792-4073814 TTAAAGGAAGTTTTTCAGTCGGG + Intronic
1133803053 16:9099871-9099893 AGAAAGGTTTGTTTTCAGTCAGG + Intronic
1134678380 16:16106518-16106540 AGAAAGGCAGTGTCTCAGGCAGG - Intronic
1136266118 16:29119823-29119845 AAAAAGGATGTTATTAAGTCTGG + Intergenic
1137838951 16:51622046-51622068 GGGAAGGATGTGTTTCATTGGGG + Intergenic
1137866991 16:51908396-51908418 AGAAAGGATGAGTTGCAGGTAGG - Intergenic
1137950150 16:52775941-52775963 AGATAGGAGGTGTATTAGTCAGG - Intergenic
1138704814 16:58904355-58904377 AGACAGGATGTGTTTTAATGGGG - Intergenic
1140085195 16:71789375-71789397 AGAAAGAATGTGCTGCAATCCGG - Exonic
1141238247 16:82240807-82240829 ACAAATGATGTGTTTCATTTGGG + Intergenic
1141559391 16:84856978-84857000 AGTAAGCATGTGTTCCAGTGAGG + Intronic
1143599797 17:7937171-7937193 AGAAAGGCTTTGTTCCAGGCGGG - Exonic
1144229600 17:13188358-13188380 AGAAAGGATATGTCTCAGTGGGG + Intergenic
1146737305 17:35249650-35249672 GGAAGGAATGTTTTTCAGTCAGG - Intronic
1147904144 17:43812080-43812102 AGATCGGATGTGTTTCAGCAAGG + Intronic
1150069940 17:62141764-62141786 TGAAAGGATGTGTTCCATTTTGG - Intergenic
1150433912 17:65139522-65139544 AGGAAGGAAGTGTTTGAGGCAGG - Intronic
1151188662 17:72382011-72382033 AGACAGGATGTGTTTCCAGCGGG - Intergenic
1151725280 17:75880135-75880157 AGAAATGCTGTGTTTCAGTAAGG + Intergenic
1153104864 18:1514622-1514644 AGAAAGCAAGTGGTTCAGTGTGG - Intergenic
1153445581 18:5168932-5168954 CTAAAGGAGGTGTTTTAGTCAGG + Intronic
1154018600 18:10643106-10643128 ATAAAGGATGTGGCTCAGCCAGG + Intergenic
1154041391 18:10859609-10859631 TGAAAGGATGTGTTTCTTTAAGG - Intronic
1154185628 18:12180316-12180338 ATAAAGGATGTGGCTCAGCCAGG - Intergenic
1154226983 18:12514228-12514250 AGATATGAGGTGATTCAGTCTGG - Intronic
1154328843 18:13413008-13413030 AGCAAGGCTGTGCATCAGTCAGG + Intronic
1155372081 18:25112353-25112375 AGAAAGGGTGTGTTTCTGGAAGG - Intronic
1157993622 18:52527991-52528013 AGAAAGTCAGTGTTTCATTCTGG - Intronic
1158268834 18:55690191-55690213 GGAAAGGATATGTTTCTGTGGGG - Intergenic
1161263442 19:3350912-3350934 AAAAAAAATGTGTTTCAGGCTGG + Intergenic
1163901269 19:20102326-20102348 AGGAAGGATGGGTATAAGTCAGG - Intronic
1166099753 19:40564966-40564988 CGAAAGTAGGTGTCTCAGTCTGG + Intronic
1166783752 19:45355606-45355628 AGAGGGGAGGTGTATCAGTCAGG - Intronic
925217019 2:2105573-2105595 AAAATGGATGTGTATCAGTGGGG + Intronic
928367810 2:30716168-30716190 AGAAAGGATGGTTTAGAGTCTGG + Intergenic
930616057 2:53595089-53595111 ACAAAGGATGTGTTTAAATATGG - Intronic
931262920 2:60635963-60635985 AGAAAGGATCTGTATTAGTTTGG + Intergenic
931322497 2:61184835-61184857 GTAAAGGAAGTGTTTGAGTCAGG + Intronic
933558871 2:83866901-83866923 AGAATGGAGTTGTATCAGTCAGG + Intergenic
936960510 2:118068987-118069009 AGAAATTATGTGTGTAAGTCAGG + Intergenic
937714940 2:125021552-125021574 AGAAAGAAAGTGTTTCAGCTTGG + Intergenic
938417655 2:131117525-131117547 TGCATGGCTGTGTTTCAGTCAGG + Intronic
943482821 2:188442894-188442916 AGACAGGCTGTTTTTCAGACAGG - Intronic
944661226 2:201923562-201923584 AGGAAGGATGTCTTTGAGCCAGG + Intergenic
944963468 2:204902372-204902394 ATAAAGAATGAGTTTCAGCCAGG + Intronic
945237295 2:207642993-207643015 AGAAAAAATGTGTTTGAGGCCGG - Intergenic
1169526069 20:6427141-6427163 AATAAAGATGTGTTTGAGTCTGG - Intergenic
1172719496 20:36988728-36988750 AAAATGGCTGTGCTTCAGTCAGG - Intergenic
1173406453 20:42770482-42770504 AGAAAGGATCTCTTTGAGTGGGG - Intronic
1174346113 20:49931320-49931342 AGAAAGGGTCTCTGTCAGTCAGG + Intergenic
1174784025 20:53416016-53416038 AGAAAAGAAGGGTTTCAGTGGGG + Intronic
1177534693 21:22408415-22408437 AGAAAGGATGATTTACAGTAAGG + Intergenic
1177642025 21:23855759-23855781 AGAAGAGATGGGTTTCAGTGAGG + Intergenic
1177687934 21:24464671-24464693 AAAAAGTATTTGTTTCAGTATGG - Intergenic
1177798678 21:25806142-25806164 AGAAAGGATGTGTGACAGGGTGG - Intergenic
1177861501 21:26459958-26459980 AGAATGAAAGTGTCTCAGTCAGG + Intergenic
1179413826 21:41182078-41182100 AGAAAGGAAGTACTACAGTCAGG + Intronic
1180033548 21:45229432-45229454 TGAAAGGATGTGTCTGAGACGGG + Intergenic
1182047114 22:27283985-27284007 AGAAAGGGTGTGTCTTAATCTGG - Intergenic
1182112081 22:27731096-27731118 AGAAAGCATCTGTATCACTCGGG - Intergenic
1184199641 22:42958738-42958760 AGAAAGCATGTTTTTCTGTGAGG + Intronic
1184621880 22:45686222-45686244 AGCAAGGCTGTGATGCAGTCAGG + Intronic
1185213036 22:49582721-49582743 TGAAAAGATCTGTTTCAGACTGG + Intronic
950537168 3:13585361-13585383 AGGAAGGATGTATTTTAGTGGGG + Intronic
950901096 3:16498382-16498404 TGCCAGGATGTGTTTCAGGCAGG + Intronic
950963643 3:17130862-17130884 AGAAGGGCTGTGTATCAGTCAGG + Intergenic
951320036 3:21233537-21233559 AAAAATGATGTGTTTAGGTCTGG - Intergenic
951615737 3:24541575-24541597 AGCAAGGAAATGTTTTAGTCAGG - Intergenic
951675072 3:25229883-25229905 AGAGAGGATGAGCTTCAGTTGGG - Intronic
952570768 3:34713030-34713052 AGAAAGCATTTGTATTAGTCAGG - Intergenic
953056331 3:39390334-39390356 ATAAAGGAAGTGTTTGAGTGGGG + Intronic
953227965 3:41037856-41037878 AGGAAGGTTGAGTGTCAGTCAGG - Intergenic
958104380 3:89053728-89053750 AGAGAGGATGTCTTACAGTGTGG + Intergenic
958538070 3:95430569-95430591 AGAAAAGATGTGTTTGCGGCCGG + Intergenic
959167335 3:102797104-102797126 AGAAAAGAGATTTTTCAGTCAGG - Intergenic
959213594 3:103420891-103420913 AGAAAAAATGTATTTCAGTCAGG + Intergenic
959511079 3:107212995-107213017 AAAAAGGATGTTTTTAAGTGAGG - Intergenic
960906402 3:122605958-122605980 AGAAAGATTGTCTTTCAATCAGG + Exonic
961814489 3:129542380-129542402 AGAAAGGGTGTGATTTAGCCAGG + Intergenic
963720772 3:148859492-148859514 TGAAAGGATGTGTATCTCTCAGG - Intronic
965230031 3:166038612-166038634 ACAAGGGATGTGTATTAGTCTGG - Intergenic
965551769 3:169973268-169973290 AGAAAGTATATTTTGCAGTCAGG + Intronic
965658723 3:171018140-171018162 AATAAGGATATGTTTCACTCAGG - Intronic
966079878 3:175988074-175988096 AGAGAGGAAGTGTATTAGTCAGG - Intergenic
966280116 3:178216225-178216247 AGAAAGCATCTCTTTCAGTGTGG + Intergenic
966348403 3:179003769-179003791 AGATAGGATGTGTTTTTGGCAGG + Intergenic
968288359 3:197521171-197521193 AGAAAGGGTGTGCGTCATTCAGG - Intronic
969135229 4:5023873-5023895 GGAAGGGTTGTGTTCCAGTCTGG - Intergenic
969177439 4:5409440-5409462 AGAAAGGAAGTGTATTAGTCAGG + Intronic
969878465 4:10153790-10153812 ATAAAGGATGTGTTTTCGTTTGG - Intergenic
973087788 4:46089560-46089582 AGAGAGGATGTCTTTTAATCTGG + Intronic
974950311 4:68578259-68578281 AAAAAGGCTGGGTTTCTGTCAGG - Intronic
975534122 4:75431277-75431299 TGAAAGGATGTATTACAGTCAGG - Intergenic
977802405 4:101251981-101252003 AGAGAGGATTTGTTTCAGAAAGG + Intronic
977893030 4:102333943-102333965 GGAAAGAATGTGTTTCAGGTAGG + Intronic
978000040 4:103546731-103546753 AAAATGGCTGTGCTTCAGTCAGG - Intergenic
978404272 4:108363228-108363250 TGAAAGAAAGTGTATCAGTCAGG + Intergenic
978601923 4:110437618-110437640 AAGAAAGATGTTTTTCAGTCAGG + Intronic
979489036 4:121303361-121303383 AGAAAGCCAGTGATTCAGTCTGG - Intergenic
980267182 4:130532060-130532082 AGAAAGGATGTTTATCTGCCTGG + Intergenic
981019911 4:140015303-140015325 AAAAAGGATGTCTATCACTCTGG + Intronic
981212975 4:142130541-142130563 AGAAACAATGTGTATCAGACAGG + Intronic
983112276 4:163767220-163767242 AGAAAAGAAGTTTTTCTGTCTGG - Intronic
984317293 4:178142835-178142857 AAAATGGGTGTGCTTCAGTCAGG + Intergenic
986360935 5:6977578-6977600 AAAAAGGCTGTGTCTCAGTGTGG + Intergenic
986514534 5:8547463-8547485 AGCAAGGATGTGCTTCAGGCTGG + Intergenic
987450690 5:18080207-18080229 AGAAAGGATGTGTTGCTGTTGGG - Intergenic
990211894 5:53489724-53489746 AGAAAGGCTGTTTCTCAGTTTGG - Intergenic
990221517 5:53595774-53595796 TGAAAGGATTAGTTTCAGTTTGG + Intronic
992120147 5:73584400-73584422 AGAATGAATGTGTGTCAGTGGGG + Intergenic
993943922 5:94095953-94095975 AGAAAGGATTTCTTTCAGTAGGG - Intronic
994159245 5:96537159-96537181 AGCAAGGGTGGGCTTCAGTCTGG - Intronic
994408782 5:99380199-99380221 AAAAATGATTTTTTTCAGTCTGG + Intergenic
995407282 5:111812953-111812975 AGATAGTATGTTGTTCAGTCAGG + Intronic
995825773 5:116297296-116297318 AGAAAGTATTTTTTTCATTCTGG - Intronic
995940124 5:117571697-117571719 ACTAAGGATGAGTTTCAGTTTGG - Intergenic
996742260 5:126811318-126811340 TGAAAGGAAGTGTTTCTATCTGG + Intronic
997667463 5:135643123-135643145 ACCAAGGATGTGTCGCAGTCCGG - Intergenic
999093327 5:148956662-148956684 AGAAAGGATCTGTGACACTCAGG - Intronic
1000642467 5:163718781-163718803 AGGAAGGGTGTGTGTCAGTGGGG - Intergenic
1000916961 5:167094312-167094334 AGAAAGGATGGATTACAGTGGGG - Intergenic
1001188413 5:169601137-169601159 ACAAAGGATGCATTTCAGTGAGG + Intronic
1004144327 6:13050911-13050933 AGAAAAGATGGGATTCAGCCAGG - Intronic
1004451762 6:15754206-15754228 AAAAAGGATGAGTTTCAGTCTGG - Intergenic
1005121031 6:22389709-22389731 AGGAAGGATGTGTCAGAGTCAGG + Intergenic
1007033393 6:38650057-38650079 TAAAAGGATGTGTTTAGGTCAGG + Intergenic
1007959910 6:45949234-45949256 AGTAAGGATCTGTTTCTTTCTGG - Exonic
1008022774 6:46599868-46599890 AGAAAGGCTTTATTTCAGTGGGG - Intronic
1012266285 6:97147754-97147776 AGAAAGGAGATGTTCCATTCTGG + Intronic
1013842774 6:114417983-114418005 AGAAAGGATGTGGTTCTGTTTGG + Intergenic
1014122485 6:117740868-117740890 AGAAAAGATGTTTATCAGTGGGG - Intergenic
1015820674 6:137257276-137257298 AGAAAGAATGTGTTTCACCAGGG - Intergenic
1016613475 6:146020634-146020656 ATAAAGGATGTGTTTCAGGTAGG + Intergenic
1017916939 6:158838333-158838355 CAAAAGGATCTGTTTCAGGCTGG + Intergenic
1018179071 6:161204786-161204808 TGAAAATATGTGTTTCACTCTGG - Intronic
1018880343 6:167872469-167872491 GGAAAGGATGAGTATCAGTCAGG + Intronic
1019222573 6:170485644-170485666 AGATGGGATTTGTGTCAGTCAGG - Intergenic
1019277576 7:183990-184012 AGAAAGGACGTGTTTCCGAGCGG + Intergenic
1019717790 7:2548318-2548340 GGAAAGAATGTGGTTCAGTAAGG + Intronic
1020171865 7:5851238-5851260 AGAAAGCAAATGTTCCAGTCTGG - Intergenic
1025621834 7:63180113-63180135 AAGAAAGATGTTTTTCAGTCAGG + Intergenic
1027567269 7:79811443-79811465 AGTAAGGATGAGTTTTAGTAAGG - Intergenic
1028319029 7:89437490-89437512 AAAATGGTTGTGCTTCAGTCAGG + Intergenic
1028683767 7:93569430-93569452 AGAAATGAAGTGTTACAGGCAGG - Intronic
1030978352 7:116155147-116155169 CAGAATGATGTGTTTCAGTCAGG - Intronic
1032786097 7:135200972-135200994 AGAAAGCCTGTCTTTCATTCTGG - Intronic
1033536053 7:142313047-142313069 AGAAAGGATGTAAAGCAGTCAGG + Intergenic
1033641392 7:143265415-143265437 AGAAAGGATGTCTGTGATTCAGG + Intronic
1034294546 7:149960501-149960523 TGAAAGGATGTATTACAGTTGGG - Intergenic
1034811512 7:154136353-154136375 TGAAAGGATGTATTACAGTTGGG + Intronic
1035493010 7:159296186-159296208 AGAAAGGCTGGGTTTCTCTCTGG + Intergenic
1036211222 8:6842765-6842787 ACAAAGGGTGTGATTCAGTGGGG - Intergenic
1037046938 8:14318085-14318107 AGAAAGGTTGTATTTCAATTCGG + Intronic
1037092199 8:14934107-14934129 AGAAAGGATATGTTTTTGTAAGG - Intronic
1037323551 8:17666291-17666313 AAAAAGGATGATTTTAAGTCAGG + Intronic
1038284378 8:26193825-26193847 GGAAAGGAAGTGTTTCAGCTAGG - Intergenic
1038367879 8:26955189-26955211 AGGCAGGATGTGTTTCAGCAGGG - Intergenic
1040504771 8:48037284-48037306 AGAAATAATGTGTTTCAGCAGGG + Intronic
1042898078 8:73692862-73692884 AGAAATGAAGTGTTACAGCCAGG + Intronic
1047945815 8:129878218-129878240 ATAAAGGATCTGTTACAGTTTGG - Intronic
1049912232 9:280370-280392 TGAAAGGAGGCGTATCAGTCAGG + Intronic
1052608043 9:30731200-30731222 AGAAAGGATGTGTGTGTGTTGGG - Intergenic
1055119143 9:72638131-72638153 AGAAAGTATATGTTTCAGACAGG - Intronic
1057238890 9:93391421-93391443 AGAATGGCTGTGCTTCAGTCAGG - Intergenic
1057750390 9:97787988-97788010 AGAAAGTATGAGGTGCAGTCTGG + Intergenic
1058547731 9:106078736-106078758 ATAAAATATGTGTTGCAGTCTGG + Intergenic
1059927360 9:119223664-119223686 AGACAGAATGTGTTTCAGAGAGG + Intronic
1062086043 9:134649048-134649070 TGAAAGGAGGTGTTCCAGGCAGG + Intronic
1062136435 9:134930840-134930862 AGAAAGGCTGTGCTCCAGTGGGG + Intergenic
1062471483 9:136707580-136707602 AGACAGGATGTGCTTCATTTGGG + Intergenic
1185930208 X:4194416-4194438 TGAAAGAATGTGTTACAGGCTGG - Intergenic
1185992824 X:4911221-4911243 AGAAGGGATGTGCTTTAGTATGG + Intergenic
1187200206 X:17127402-17127424 AGGATGGATGTGTGTCAGTCTGG + Intronic
1187398768 X:18940904-18940926 AGAAAGCAGCTGTCTCAGTCAGG - Intronic
1187941148 X:24382961-24382983 ATAAAGGATTTGTTTCTCTCAGG - Intergenic
1188340431 X:28994193-28994215 AGAAAGGAAGGGTTTGGGTCTGG + Intronic
1189114974 X:38332920-38332942 AGAAATGAAATGTTTCAGGCTGG + Intronic
1189144752 X:38644145-38644167 AGAGAGGTTTTGTTTCAGTAGGG + Intronic
1190163270 X:48049662-48049684 ACAAAGGATGAGTGTCAGCCTGG + Intronic
1195603900 X:106780206-106780228 GTAAAGTATATGTTTCAGTCTGG - Intronic
1200756746 Y:6997041-6997063 ACAAAGGATGTCTTTCTTTCAGG + Intronic
1200788253 Y:7277343-7277365 AGAAAAAATGGGTTTCAGTCTGG + Intergenic
1202170115 Y:22034508-22034530 AGAAAGCATGTGTGTCAGCATGG - Intergenic
1202221251 Y:22551865-22551887 AGAAAGCATGTGTGTCAGCATGG + Intergenic
1202321864 Y:23643797-23643819 AGAAAGCATGTGTGTCAGCATGG - Intergenic
1202548903 Y:26026259-26026281 AGAAAGCATGTGTGTCAGCATGG + Intergenic