ID: 922581836

View in Genome Browser
Species Human (GRCh38)
Location 1:226703804-226703826
Sequence GAAAGGATGTGTTTCAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581832_922581836 -5 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581836 1:226703804-226703826 GAAAGGATGTGTTTCAGTCTGGG 0: 1
1: 0
2: 0
3: 23
4: 236
922581831_922581836 -2 Left 922581831 1:226703783-226703805 CCGCCAGCTTCCGGCTTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 922581836 1:226703804-226703826 GAAAGGATGTGTTTCAGTCTGGG 0: 1
1: 0
2: 0
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581836 Original CRISPR GAAAGGATGTGTTTCAGTCT GGG Intronic
902052799 1:13577402-13577424 GAATGAATGTGTTTCAGTGTGGG - Intergenic
905093440 1:35448336-35448358 GAAAGCATGTGGATCAGTCATGG + Intronic
907245505 1:53105952-53105974 GAAAGTATGTGGCACAGTCTGGG - Intronic
908137597 1:61149189-61149211 GAAAGGAAATGGTTCAGGCTGGG - Intronic
909074087 1:71032116-71032138 TAAAGGATGAGTTGTAGTCTGGG - Intronic
909323315 1:74317733-74317755 CAAAGGAGGTTTTCCAGTCTGGG + Intronic
909845230 1:80385611-80385633 CAATGGATGAGTTTCAGTTTGGG - Intergenic
910077378 1:83297402-83297424 AAAAAGATGTCTTTCTGTCTTGG + Intergenic
910492452 1:87787481-87787503 GAAAGGAAGTATTTCAATCTGGG - Intergenic
912705825 1:111911261-111911283 AAAATGATATGTTTCAGTGTGGG + Intronic
914251425 1:145924988-145925010 AAAAGGATGTGGCTCAGGCTGGG - Intergenic
914681500 1:149941879-149941901 GAAGGGATGTGTATATGTCTAGG - Exonic
915005895 1:152635990-152636012 GAAAAGTTGTGTTACATTCTAGG - Intergenic
915934614 1:160083400-160083422 GAAAGACTGTGTATCAGTCTTGG + Intronic
917437514 1:175036077-175036099 GAAACATTGTGTTTCAGCCTGGG - Intergenic
918663617 1:187119790-187119812 GAAAGCATGTATTACAGTCTTGG + Intergenic
921102325 1:211939989-211940011 GAAAGCCTGGGTTTCACTCTTGG - Intergenic
921590674 1:216999455-216999477 GAGAGGATGTGATTGAGACTTGG + Intronic
922581836 1:226703804-226703826 GAAAGGATGTGTTTCAGTCTGGG + Intronic
922988350 1:229884269-229884291 GAAAGTCTGAGTTTGAGTCTTGG - Intergenic
923783614 1:237047362-237047384 GAAAGGATGGATTCCAATCTTGG - Intronic
924306862 1:242698496-242698518 GAAAGGAGGTGTATTAGTCCGGG + Intergenic
1062822318 10:543603-543625 TAAAGGATGTGTTTGAGCCTAGG - Intronic
1063843283 10:10096147-10096169 GAAATGATGTGTGTCACTTTGGG + Intergenic
1065603682 10:27394329-27394351 GAAGGCATGTGTTTGAATCTTGG + Intergenic
1065767373 10:29042992-29043014 GAAAGGTTGATTTTCTGTCTGGG + Intergenic
1066225177 10:33375617-33375639 GACCAGAAGTGTTTCAGTCTTGG + Intergenic
1067135257 10:43602159-43602181 GAGAGGATGTCTCTTAGTCTTGG + Intergenic
1067862506 10:49867032-49867054 TAAAAGATGTGTTCCAGTTTCGG - Intronic
1069755740 10:70773575-70773597 GAAGGGCTGGGATTCAGTCTTGG - Intronic
1074908987 10:117890280-117890302 TCAAGGATGTGTTATAGTCTTGG + Intergenic
1076211303 10:128647151-128647173 GACCGGATGTGTCTCAGTCGAGG - Intergenic
1079308410 11:19344601-19344623 GATAGGATGTGTTGCCCTCTAGG + Intergenic
1079326877 11:19500981-19501003 GAAGGGCTGTGTTTCTTTCTGGG + Intronic
1080289367 11:30653604-30653626 GAAGGGAGGTGTTTGAGTCATGG - Intergenic
1080684357 11:34503149-34503171 AAAAGGATTAGTTTCAGTTTGGG - Intronic
1083771718 11:64871256-64871278 GAAAGCAGGTGTTTCCCTCTCGG - Intronic
1084266125 11:68006126-68006148 GAGAGGAGGTGTATCAGTCAGGG - Intergenic
1085641158 11:78193767-78193789 GAAATGATGTGTTCGATTCTGGG - Intronic
1086011210 11:82105597-82105619 GAAAGGAGGTGTTTTGGTCGTGG - Intergenic
1086865797 11:91978673-91978695 GATAGAATGAGATTCAGTCTTGG - Intergenic
1087347931 11:96994698-96994720 GAAAGTATCTGTATCAGTCAGGG - Intergenic
1087928222 11:103945327-103945349 GAAATGATGTGTGTCAGTCAGGG - Intronic
1088749061 11:112828566-112828588 GACAGGGTGTGGTTCAGTTTGGG - Intergenic
1088794555 11:113256730-113256752 GAAAGGGTGATTTTCAGTGTGGG - Intronic
1090519413 11:127462243-127462265 GAAAGGATCTCTTTCTCTCTAGG + Intergenic
1091717673 12:2791245-2791267 GGAAGGATTTGCTTCAGCCTGGG + Intergenic
1092164527 12:6334858-6334880 GAAAGGATGTGTTTTTGATTGGG + Intronic
1095135072 12:38590748-38590770 AAAAGCATGTGTTCAAGTCTTGG + Intergenic
1095327892 12:40920047-40920069 TAAAAACTGTGTTTCAGTCTTGG - Intronic
1098711270 12:73765535-73765557 AAAAGTATGTTTTTCAGGCTGGG + Intergenic
1099047529 12:77740606-77740628 TAAAGGATGTATTTCACTCATGG + Intergenic
1099733369 12:86534893-86534915 GAATAGGTGTATTTCAGTCTAGG - Intronic
1100959082 12:99943171-99943193 GAAAGGATGGGTTTCAGATGTGG - Intronic
1101371548 12:104136303-104136325 GAAAGGATGTGTTTTTGTTTTGG - Intronic
1102125113 12:110474138-110474160 TAAAAAATGTGTTGCAGTCTGGG + Intronic
1103215476 12:119198440-119198462 GAAAAGAGGTGTTTCAGATTGGG + Intronic
1103267971 12:119646983-119647005 GGAATGATGTGATTAAGTCTAGG - Intergenic
1108329940 13:49375903-49375925 GAAAGGATGAGCTGAAGTCTGGG + Intronic
1108955364 13:56149283-56149305 GAAAACATGTGTATCAGTTTGGG + Intergenic
1110357833 13:74588953-74588975 GTAAGCATGTGTCTCAGTTTGGG - Intergenic
1111032603 13:82624177-82624199 AGAAGGATGTATTTTAGTCTTGG + Intergenic
1111069147 13:83140840-83140862 GAAGGAATGTGATTCAGTTTTGG - Intergenic
1111534526 13:89585582-89585604 GAAAGGATGTGCCTCAGTGTTGG - Intergenic
1111651986 13:91103251-91103273 GAAAGAATGTGGTTTGGTCTAGG + Intergenic
1116560869 14:46377132-46377154 GAGAGGGTGTGTTTCACTCAGGG + Intergenic
1116865940 14:50031683-50031705 GAAGGGATGTGTGTCATTTTAGG - Intergenic
1117521651 14:56557342-56557364 CAAAGGAAGTGTGGCAGTCTGGG - Intronic
1117637955 14:57766377-57766399 GGAAGGATTTGTTCCACTCTTGG + Intronic
1117889135 14:60399154-60399176 AAAAGGATGTGGCTCAGGCTGGG + Intronic
1121089531 14:91171500-91171522 GACGGGATGTGTCTCAGCCTTGG + Intronic
1121267661 14:92614892-92614914 GAAATGCTGTGGTGCAGTCTCGG + Intronic
1121951846 14:98177758-98177780 CAGAGGATGTGACTCAGTCTGGG - Intergenic
1122354493 14:101114801-101114823 GACAGGCTGTGTTCCAGTCCTGG + Intergenic
1124636605 15:31368921-31368943 GAAAAGAAGTGTTGCTGTCTAGG - Intronic
1124900753 15:33820276-33820298 GAAAGGATGTGTTGGGGTATAGG + Intronic
1125321586 15:38494601-38494623 CCAAGGCTGTGATTCAGTCTGGG + Exonic
1126641945 15:50836558-50836580 ATAAAGATGTGTTTCAGCCTAGG - Intergenic
1126855233 15:52832505-52832527 GAAATGAGGTGTTACAGTATAGG + Intergenic
1126953056 15:53903738-53903760 GAAGGGCTGTGTTCAAGTCTAGG + Intergenic
1129660582 15:77550770-77550792 GAAGGGAGGTGTTTCAGAGTGGG + Intergenic
1129918834 15:79300489-79300511 AAAAGGATGTCCTTCAGTCATGG - Intergenic
1131847094 15:96499675-96499697 GAAATAATGTTTTTCAGTCCTGG - Intergenic
1133096223 16:3448111-3448133 GAAAGGATGGGTTGGAGGCTGGG + Intronic
1133406875 16:5531521-5531543 GAAAAAATGTGTTTGAGCCTTGG + Intergenic
1134082401 16:11334095-11334117 GAGATGATGAGATTCAGTCTTGG - Intronic
1134170732 16:11967322-11967344 GAAAAGATCTGTTTCAAGCTGGG + Intronic
1134363375 16:13553588-13553610 GAAAGCATGTGTTTCGGTTCTGG - Intergenic
1135156052 16:20053424-20053446 GCAAGGATGGGTTTCTTTCTTGG + Intronic
1135865739 16:26100158-26100180 GATAGGTTGTTTTTCAGCCTTGG - Intronic
1137419430 16:48319004-48319026 GAATGGATATGTTTCAGATTTGG - Intronic
1137838952 16:51622047-51622069 GGAAGGATGTGTTTCATTGGGGG + Intergenic
1138484941 16:57334427-57334449 GGAAGGCTGTGTCACAGTCTCGG + Intergenic
1139668978 16:68478932-68478954 CAAAGGATGTATTTAAGTCTTGG + Intergenic
1140792699 16:78407595-78407617 GAAATGATATGTCTCATTCTTGG + Intronic
1141444058 16:84046935-84046957 GAAAGGAGGGGCTTCAGTCTCGG - Intergenic
1142519867 17:497360-497382 GAAGAAATGTGTTTCAGTTTTGG + Intergenic
1143285551 17:5786339-5786361 GAAAGCAGGTGTTTCTTTCTTGG + Intronic
1145286127 17:21507063-21507085 GGAAGGAGGAGTTTCAGGCTAGG + Intergenic
1146737304 17:35249649-35249671 GAAGGAATGTTTTTCAGTCAGGG - Intronic
1149968891 17:61195734-61195756 GAGAGGATAGCTTTCAGTCTAGG - Intronic
1150464630 17:65381624-65381646 GAAAGTAGATGCTTCAGTCTTGG + Intergenic
1152648201 17:81479998-81480020 GAAAGGATGTAGTTCAGACTTGG - Intergenic
1157721674 18:49930019-49930041 AAAAGGATGAGTTTCAGACTAGG + Intronic
1158268833 18:55690190-55690212 GAAAGGATATGTTTCTGTGGGGG - Intergenic
1159081493 18:63740559-63740581 CAAAGGACGTGGTTCAGGCTGGG - Intergenic
1159884224 18:73888894-73888916 GAAAGAATGCTTTTCAGACTAGG + Intergenic
1161263443 19:3350913-3350935 AAAAAAATGTGTTTCAGGCTGGG + Intergenic
1166708798 19:44924174-44924196 GAAGGGATGGGATTCAGACTAGG + Intergenic
1168308182 19:55447481-55447503 GAAGGGATGTGTCTCTGTGTGGG - Intergenic
925142896 2:1562235-1562257 GAAAGGCGGTGTTTCATTCCTGG + Intergenic
925767189 2:7247627-7247649 GATAGTATGTGTCTGAGTCTAGG - Intergenic
926387332 2:12349715-12349737 GAAAGCTTGGGTTTAAGTCTAGG - Intergenic
926949052 2:18221436-18221458 GATGGGATGTTTTTCAGTATGGG - Intronic
928117522 2:28557453-28557475 GAAAGCATGTTTTTCAGATTAGG + Intronic
929676146 2:43932005-43932027 GAAAGGACTTTTTTCAGACTAGG + Intronic
930262560 2:49164629-49164651 GAGTTGATGTGTGTCAGTCTAGG + Intergenic
931322498 2:61184836-61184858 TAAAGGAAGTGTTTGAGTCAGGG + Intronic
931431575 2:62212862-62212884 CATAGAATGTTTTTCAGTCTGGG - Intronic
933417217 2:82001980-82002002 GAAAGGATGATTTTCATTCCTGG - Intergenic
933854862 2:86403427-86403449 GAAAGGATGAGTAGCAGTGTTGG + Intergenic
933875122 2:86612736-86612758 GAAAACATGTGTTTGACTCTTGG - Intronic
937714941 2:125021553-125021575 GAAAGAAAGTGTTTCAGCTTGGG + Intergenic
940864530 2:158804663-158804685 AAAAGGATGTGTGTCAGGTTTGG - Intronic
941063130 2:160870647-160870669 GAAAAGATGTATTACTGTCTTGG - Intergenic
945029663 2:205651479-205651501 CTAAGAATGTGTTTCTGTCTAGG - Intergenic
945156184 2:206841049-206841071 GAAATGATGTGTGTAATTCTGGG + Intergenic
945957254 2:216098007-216098029 GAAAGGAGTTATTTCAGTGTAGG + Intronic
946722947 2:222630384-222630406 GAAACGATTTGTCTCAGTCATGG - Intronic
947025447 2:225733103-225733125 AAAGGGATGTGTTTTAGTCAAGG - Intergenic
1170199829 20:13730990-13731012 GAAAGGATCTGTTGGAGTCAAGG + Intronic
1170476484 20:16720046-16720068 GAAAGGATGCTTTTCAGCCTAGG + Intergenic
1174194171 20:48761344-48761366 GCAAGGATGTTTGTCTGTCTAGG + Intronic
1174577390 20:51546253-51546275 AAAAGGAAGTGCTTCAGACTAGG + Intronic
1175109241 20:56634899-56634921 TAAAGGTTGTGTTGCATTCTTGG - Intronic
1175649030 20:60700909-60700931 GAAAGCAAGTGTAACAGTCTGGG + Intergenic
1176697119 21:9991678-9991700 GAAAGGAAAAGTTTGAGTCTTGG - Intergenic
1177798677 21:25806141-25806163 GAAAGGATGTGTGACAGGGTGGG - Intergenic
1178033269 21:28552362-28552384 CAAAGGCTGTATTTAAGTCTAGG - Intergenic
1178355004 21:31903618-31903640 AAATGTTTGTGTTTCAGTCTTGG + Intronic
1180957838 22:19749049-19749071 GACAGAGTATGTTTCAGTCTAGG - Intergenic
1182047113 22:27283984-27284006 GAAAGGGTGTGTCTTAATCTGGG - Intergenic
1184177036 22:42794363-42794385 GAAAGGGTGTCTTTGGGTCTCGG - Intergenic
950494824 3:13327452-13327474 GAAAGGAGGGCTCTCAGTCTCGG + Intronic
950963644 3:17130863-17130885 GAAGGGCTGTGTATCAGTCAGGG + Intergenic
951202411 3:19890086-19890108 GACAGCATCTGTTTCAGTTTTGG - Intronic
954171839 3:48809997-48810019 GAAATGATGTGCCTCAGACTAGG - Intronic
954177556 3:48856626-48856648 GAAGGGATGGGTTGCAGGCTGGG + Intergenic
954224200 3:49172089-49172111 GTCAGGGTGTGTTTCAGACTAGG - Intronic
954453188 3:50582734-50582756 GAAGGCAGGAGTTTCAGTCTTGG + Exonic
956320586 3:67992074-67992096 GAAGGGATGTGTTTCACTAGTGG + Intergenic
958265130 3:91429387-91429409 GAAAACATATGTTTCTGTCTAGG + Intergenic
963570575 3:146989915-146989937 GACTGGATGAGTTTCATTCTTGG + Intergenic
963588430 3:147225487-147225509 GAAAGGACAAGTTACAGTCTGGG - Intergenic
963903935 3:150758451-150758473 GAAGGGGTGAGTTTAAGTCTGGG + Intronic
965012311 3:163109251-163109273 GGAAGGAAATGTTTCAGTCTTGG + Intergenic
965788156 3:172358476-172358498 GAAAGGATGGGCTTCTTTCTAGG - Intronic
966280117 3:178216226-178216248 GAAAGCATCTCTTTCAGTGTGGG + Intergenic
969135228 4:5023872-5023894 GAAGGGTTGTGTTCCAGTCTGGG - Intergenic
969149489 4:5157036-5157058 AAATGGATTTGTTACAGTCTGGG - Intronic
969177440 4:5409441-5409463 GAAAGGAAGTGTATTAGTCAGGG + Intronic
969940307 4:10725229-10725251 GAAAGGGTGTGCTCCAGTCAAGG - Intergenic
972798115 4:42443197-42443219 GAAATGGTGAGTTTCTGTCTGGG - Intronic
973972571 4:56228109-56228131 GAAAGGCAGAATTTCAGTCTTGG - Intronic
974393946 4:61310903-61310925 GAATGGATATATTCCAGTCTAGG + Intronic
975534121 4:75431276-75431298 GAAAGGATGTATTACAGTCAGGG - Intergenic
976077128 4:81312437-81312459 GAAATGAAGAGTTTCAGCCTAGG + Intergenic
976869225 4:89770230-89770252 GAAAGGGTCTGTTGCAGTTTTGG - Intronic
977251039 4:94689063-94689085 GAAAGGATGAGGCACAGTCTGGG + Intergenic
978404273 4:108363229-108363251 GAAAGAAAGTGTATCAGTCAGGG + Intergenic
979489035 4:121303360-121303382 GAAAGCCAGTGATTCAGTCTGGG - Intergenic
980732558 4:136842066-136842088 GAAAGTATCTGTTTGACTCTGGG - Intergenic
981019912 4:140015304-140015326 AAAAGGATGTCTATCACTCTGGG + Intronic
982459255 4:155647941-155647963 GAAAAGATGAGTCTCAGACTGGG + Intergenic
982482321 4:155927472-155927494 AAAAAGTTGTGTTTCAGGCTGGG + Intronic
983503158 4:168523480-168523502 GAAAGAAAATGTTTCAGTTTTGG + Intronic
986347852 5:6851112-6851134 GCAGGGATGTGTTTCAGATTAGG + Intergenic
986360936 5:6977579-6977601 AAAAGGCTGTGTCTCAGTGTGGG + Intergenic
986514535 5:8547464-8547486 GCAAGGATGTGCTTCAGGCTGGG + Intergenic
987450689 5:18080206-18080228 GAAAGGATGTGTTGCTGTTGGGG - Intergenic
989370215 5:40698640-40698662 TAATTGATGTGTTTCAATCTCGG - Intergenic
989784242 5:45308010-45308032 GGGAGGAGGTGTTTCAGTCATGG + Intronic
990211893 5:53489723-53489745 GAAAGGCTGTTTCTCAGTTTGGG - Intergenic
990221518 5:53595775-53595797 GAAAGGATTAGTTTCAGTTTGGG + Intronic
990853838 5:60240442-60240464 GAAGGGATGAGTCTCAGACTTGG + Intronic
992309756 5:75483827-75483849 TAAAGGAAGTTCTTCAGTCTGGG + Intronic
992362323 5:76052614-76052636 GAAAGGATGTGTGTCACACATGG + Intergenic
994408783 5:99380200-99380222 AAAATGATTTTTTTCAGTCTGGG + Intergenic
995072761 5:107943266-107943288 AACAGGATGTATTTCAGTTTTGG - Intronic
997348774 5:133214715-133214737 GAAAGGATGTGATTTTATCTGGG + Intronic
998330396 5:141320887-141320909 GAAAAGATGAGTTTCACGCTGGG - Intergenic
1000139204 5:158385078-158385100 AAAAGAATGTGTATGAGTCTTGG + Intergenic
1000703881 5:164487586-164487608 GAAAGGAGGTGATTGAATCTTGG - Intergenic
1001338576 5:170822834-170822856 GAAAGCCTGGGTTTGAGTCTTGG + Intergenic
1001773765 5:174313826-174313848 GAAAGCGTGTGTCTCAGTCCTGG + Intergenic
1003502261 6:6712396-6712418 GAAAGGGTCTGCTTCATTCTGGG + Intergenic
1003792033 6:9556950-9556972 GATAGAACTTGTTTCAGTCTAGG - Intergenic
1004451491 6:15752115-15752137 GAAATGATGTGTGTCACTCCTGG - Intergenic
1004938628 6:20532434-20532456 GAAAGGATGTTTTCAAGTTTTGG - Intergenic
1006815798 6:36848971-36848993 GAAAAGAAGTGTTTCACCCTCGG - Intergenic
1007009766 6:38404719-38404741 AAACTGATGTGTTTCATTCTGGG + Intronic
1007235630 6:40389836-40389858 GAAAGGATGTGCTTCAGCCCTGG + Intergenic
1007959909 6:45949233-45949255 GTAAGGATCTGTTTCTTTCTGGG - Intronic
1008990254 6:57593264-57593286 GAAAACATATGTTTCTGTCTAGG - Intronic
1009178828 6:60491810-60491832 GAAAACATATGTTTCTGTCTAGG - Intergenic
1009810489 6:68657135-68657157 GAAAGGATGTGTTTATTTTTAGG - Intronic
1011497481 6:87950765-87950787 GAAGGAATGTAGTTCAGTCTAGG - Intergenic
1013642044 6:112094569-112094591 GATAGGATTTGTTTTAGTCTAGG - Intronic
1014289683 6:119543878-119543900 GAAATAATGTGTTTCAAGCTTGG + Intergenic
1014971158 6:127817131-127817153 GAAGGCATATGTTTCAGTTTAGG - Intronic
1015125502 6:129749902-129749924 AACAGGATGTGGTTCATTCTAGG - Intergenic
1016211157 6:141535339-141535361 GAAAGGATAAGTTACAGACTAGG - Intergenic
1016613476 6:146020635-146020657 TAAAGGATGTGTTTCAGGTAGGG + Intergenic
1017916940 6:158838334-158838356 AAAAGGATCTGTTTCAGGCTGGG + Intergenic
1018179070 6:161204785-161204807 GAAAATATGTGTTTCACTCTGGG - Intronic
1019210777 6:170402748-170402770 GAAGGAATGTTTGTCAGTCTGGG + Intronic
1020171864 7:5851237-5851259 GAAAGCAAATGTTCCAGTCTGGG - Intergenic
1021731822 7:23603037-23603059 TAAAGGTTGTGTTTGAGCCTAGG + Intronic
1021865169 7:24949289-24949311 GAAAGAGTGTGTTCCAGACTTGG - Intronic
1022272138 7:28818858-28818880 GATTTGATGTGTTTCAGTCATGG - Intronic
1022890998 7:34699444-34699466 GAAGGGAGATGTTTTAGTCTAGG + Intronic
1027142245 7:75666717-75666739 GTACGGATGTGTTTCAGACACGG + Intronic
1027295154 7:76762615-76762637 AAAAAGATGTCTTTCTGTCTTGG + Intergenic
1027668104 7:81064462-81064484 GAAGGAGTGTGTTTCAGTTTAGG + Intergenic
1027757079 7:82227801-82227823 GAAATAATGTGTTTGAGTATTGG - Intronic
1030888013 7:114962951-114962973 GAATGTATGTGTTTCTTTCTTGG + Intronic
1030935033 7:115575125-115575147 GAAAGAATGTGTTCATGTCTAGG + Intergenic
1030978351 7:116155146-116155168 AGAATGATGTGTTTCAGTCAGGG - Intronic
1032724578 7:134578885-134578907 GAAAGTAAGTGTTTTAGTTTGGG - Intronic
1032786096 7:135200971-135200993 GAAAGCCTGTCTTTCATTCTGGG - Intronic
1033596918 7:142865329-142865351 GAGAGGGTGGGGTTCAGTCTTGG + Intronic
1033763462 7:144462006-144462028 GAAGGGAAGTGTTTCCCTCTTGG + Intronic
1034463948 7:151214682-151214704 GAAATGAAGTGTTTCAGTTAAGG + Intronic
1040619881 8:49079628-49079650 GAAAGAATGTATTTCAGTTCTGG + Intergenic
1043813990 8:84778937-84778959 AAAAGGAATTATTTCAGTCTTGG + Intronic
1047879413 8:129177146-129177168 GAAAGTAAATGTTTCAGTGTAGG - Intergenic
1047945814 8:129878217-129878239 TAAAGGATCTGTTACAGTTTGGG - Intronic
1048081559 8:131133704-131133726 GGAAGAATGGGTTTCACTCTAGG + Intergenic
1051711790 9:19938430-19938452 GAAAGGAAGTGTCACAGTATTGG - Intergenic
1052529398 9:29661228-29661250 GAAAGAAAATGTTTGAGTCTAGG - Intergenic
1053634107 9:39977531-39977553 GAAAGGAAAAGTTTGAGTCTTGG - Intergenic
1053771641 9:41485972-41485994 GAAAGGAAAAGTTTGAGTCTTGG + Intergenic
1054209780 9:62273166-62273188 GAAAGGAAAAGTTTGAGTCTTGG + Intergenic
1054315212 9:63575788-63575810 GAAAGGAAAAGTTTGAGTCTTGG - Intergenic
1057668214 9:97063398-97063420 GAATGTATATGTTTCAGTATAGG + Intergenic
1059217059 9:112574168-112574190 GAAAGCAAGTGTTTCAGGTTTGG - Exonic
1059645609 9:116263725-116263747 GAAAACATGTGTTTCTGTCCTGG - Intronic
1060255777 9:122029464-122029486 GAAGGTATGTGTTTGTGTCTTGG + Intronic
1062086044 9:134649049-134649071 GAAAGGAGGTGTTCCAGGCAGGG + Intronic
1062675983 9:137744087-137744109 GAAGGTATGTGTTGCTGTCTTGG + Exonic
1185930207 X:4194415-4194437 GAAAGAATGTGTTACAGGCTGGG - Intergenic
1187127403 X:16466991-16467013 GAAGGGTTGTGTATCACTCTTGG - Intergenic
1189114975 X:38332921-38332943 GAAATGAAATGTTTCAGGCTGGG + Intronic
1189752466 X:44236485-44236507 GAAAGAATGATTTTCAGTATAGG - Intronic
1190163271 X:48049663-48049685 CAAAGGATGAGTGTCAGCCTGGG + Intronic
1193048324 X:77076670-77076692 GAAAGGATCTGTTTCTCTATGGG + Intergenic
1198999409 X:142616569-142616591 GAAAGGAAGTGTTTCTCTTTGGG + Intergenic
1199393670 X:147309618-147309640 GATGGGATGTGTTTCAGTAGTGG - Intergenic
1199782817 X:151078630-151078652 GCAAGGACGTGTTTGAGACTTGG - Intergenic
1201447715 Y:14076502-14076524 GAAAGGAACTTTTGCAGTCTTGG - Intergenic