ID: 922581837

View in Genome Browser
Species Human (GRCh38)
Location 1:226703824-226703846
Sequence GGGTTTCCTCATTTGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5908
Summary {0: 1, 1: 6, 2: 122, 3: 1013, 4: 4766}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581832_922581837 15 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581837 1:226703824-226703846 GGGTTTCCTCATTTGCAAAATGG 0: 1
1: 6
2: 122
3: 1013
4: 4766
922581831_922581837 18 Left 922581831 1:226703783-226703805 CCGCCAGCTTCCGGCTTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 922581837 1:226703824-226703846 GGGTTTCCTCATTTGCAAAATGG 0: 1
1: 6
2: 122
3: 1013
4: 4766
922581834_922581837 8 Left 922581834 1:226703793-226703815 CCGGCTTGGGAGAAAGGATGTGT 0: 1
1: 0
2: 0
3: 20
4: 303
Right 922581837 1:226703824-226703846 GGGTTTCCTCATTTGCAAAATGG 0: 1
1: 6
2: 122
3: 1013
4: 4766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581837 Original CRISPR GGGTTTCCTCATTTGCAAAA TGG Intronic
Too many off-targets to display for this crispr