ID: 922581838

View in Genome Browser
Species Human (GRCh38)
Location 1:226703825-226703847
Sequence GGTTTCCTCATTTGCAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12674
Summary {0: 3, 1: 62, 2: 602, 3: 3090, 4: 8917}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922581832_922581838 16 Left 922581832 1:226703786-226703808 CCAGCTTCCGGCTTGGGAGAAAG No data
Right 922581838 1:226703825-226703847 GGTTTCCTCATTTGCAAAATGGG 0: 3
1: 62
2: 602
3: 3090
4: 8917
922581834_922581838 9 Left 922581834 1:226703793-226703815 CCGGCTTGGGAGAAAGGATGTGT 0: 1
1: 0
2: 0
3: 20
4: 303
Right 922581838 1:226703825-226703847 GGTTTCCTCATTTGCAAAATGGG 0: 3
1: 62
2: 602
3: 3090
4: 8917
922581831_922581838 19 Left 922581831 1:226703783-226703805 CCGCCAGCTTCCGGCTTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 922581838 1:226703825-226703847 GGTTTCCTCATTTGCAAAATGGG 0: 3
1: 62
2: 602
3: 3090
4: 8917

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922581838 Original CRISPR GGTTTCCTCATTTGCAAAAT GGG Intronic
Too many off-targets to display for this crispr