ID: 922585090

View in Genome Browser
Species Human (GRCh38)
Location 1:226728011-226728033
Sequence GTGGTGAATTTTCAGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922585090_922585099 24 Left 922585090 1:226728011-226728033 CCCTTCAGCTGAAAATTCACCAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 922585099 1:226728058-226728080 TTTTTCTACTTATTCAAAGATGG 0: 1
1: 0
2: 5
3: 64
4: 777
922585090_922585101 26 Left 922585090 1:226728011-226728033 CCCTTCAGCTGAAAATTCACCAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 922585101 1:226728060-226728082 TTTCTACTTATTCAAAGATGGGG 0: 1
1: 0
2: 0
3: 21
4: 445
922585090_922585100 25 Left 922585090 1:226728011-226728033 CCCTTCAGCTGAAAATTCACCAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 922585100 1:226728059-226728081 TTTTCTACTTATTCAAAGATGGG 0: 1
1: 0
2: 4
3: 43
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922585090 Original CRISPR GTGGTGAATTTTCAGCTGAA GGG (reversed) Intronic
901892847 1:12282844-12282866 GTGGAGAATCTTCTGTTGAAAGG + Exonic
902425820 1:16320841-16320863 TTGGTGAATTTAGAGCTGAGTGG - Intronic
906693850 1:47811025-47811047 GTGGAGAATTTCCAGCACAAGGG + Intronic
907088232 1:51699035-51699057 CTCTTGAATTTTCAGCTGGAAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908912373 1:69087034-69087056 GGGGTGAAATTTCAGAGGAAGGG + Intergenic
909154670 1:72058146-72058168 ATGGTGAAGTTTCATGTGAAGGG - Intronic
909793913 1:79709192-79709214 GTTGTGAATTTACAGCTGATGGG + Intergenic
910791301 1:91053990-91054012 GTGGTTAATTTTGAGCTGTGAGG - Intergenic
912936629 1:114008629-114008651 TTGGTAAATTTTGAGCTGCAGGG - Intergenic
913287771 1:117242308-117242330 CTGGAAAATTCTCAGCTGAATGG + Intergenic
917231521 1:172843021-172843043 GTGGTGCATTTTCGGCTCACTGG + Intergenic
917922071 1:179758982-179759004 GTGCTTAATATGCAGCTGAATGG - Intronic
918136459 1:181678376-181678398 GTGGTGCCTTTTCAGGTGAATGG - Intronic
921560308 1:216650128-216650150 CTGGTGAATTTTCTGAAGAAAGG + Intronic
922585090 1:226728011-226728033 GTGGTGAATTTTCAGCTGAAGGG - Intronic
1063802750 10:9599308-9599330 CATGTGAATTTTCAGCTGTAAGG + Intergenic
1064201853 10:13291315-13291337 TTGCTGAATTTTCAGATGACTGG - Intronic
1065093537 10:22259270-22259292 ATGGTCCATCTTCAGCTGAAAGG + Intergenic
1067916548 10:50406140-50406162 ATGGTGAATTTGTAGCTGAGAGG - Intronic
1074510387 10:114106499-114106521 TTGGTCATATTTCAGCTGAAAGG - Intergenic
1075463782 10:122636314-122636336 GGGCTTGATTTTCAGCTGAAAGG + Intronic
1077677623 11:4210587-4210609 GTGCTGAATTATCAAATGAAGGG - Intergenic
1077838903 11:5951703-5951725 GTGTTAAATGTTGAGCTGAAGGG - Intergenic
1078770081 11:14341121-14341143 GTGTTGAATTTTCAGGGGGAGGG - Intronic
1079367093 11:19818977-19818999 CTGGTGAATGTTCAGATGGATGG - Intronic
1084903126 11:72325101-72325123 ATGATGAATATTCAGCTGAGGGG - Intronic
1088475428 11:110233312-110233334 GTGCTGAATTATCAAATGAAGGG - Exonic
1089044968 11:115492879-115492901 TATGTGAATTTTCAGCTGCATGG - Intronic
1091555107 12:1567010-1567032 TTTGTGAATGTTCAGCTGAGGGG + Intronic
1095491709 12:42741826-42741848 GTTGTGAATTTTAATCTTAAGGG - Intergenic
1096043827 12:48544444-48544466 GTGATGGATATACAGCTGAAAGG + Intergenic
1096175833 12:49518029-49518051 TTAGTTAATATTCAGCTGAAAGG + Intronic
1098410761 12:70181196-70181218 GTGCTATATTTTTAGCTGAAAGG + Intergenic
1102747953 12:115266494-115266516 GTGATGCATTTTCAGATGAGAGG + Intergenic
1103174046 12:118846308-118846330 TTGGTTGATTTTGAGCTGAATGG - Intergenic
1104220013 12:126773630-126773652 GAGCTAAATTTTCAGCTGTAAGG + Intergenic
1105494950 13:20922275-20922297 GTGTTTAATCTTCAGCTGCAGGG + Intergenic
1109727380 13:66360745-66360767 GTGGTGGATTTCAAGGTGAATGG + Intronic
1112633265 13:101184927-101184949 AAGGTGAAATTTCAGCTAAAGGG - Intronic
1112762647 13:102708869-102708891 AGGGTGAATTTGGAGCTGAAAGG - Intergenic
1113202065 13:107876732-107876754 CTTGTGAAGTTTCCGCTGAAAGG - Intergenic
1115034168 14:28837430-28837452 AGGGTGAATTTTGAGCTGAGAGG - Intergenic
1117055613 14:51909333-51909355 AAGGTGAATTTTCAAGTGAAAGG + Intronic
1118848872 14:69569968-69569990 GTGGGGCAATTTCAGCTTAATGG + Exonic
1119682355 14:76602449-76602471 GTGGTCAATTTCCAGCTGAGAGG + Intergenic
1119843521 14:77811050-77811072 CTGGAGTATTTTCTGCTGAAAGG - Intronic
1120729801 14:87990015-87990037 GAGGTGGAATTTGAGCTGAAAGG - Intronic
1121235173 14:92386869-92386891 GTGGTGAAATTTCCGGTCAAGGG + Intronic
1122163477 14:99803152-99803174 GTGGTGAGTTTCCTGGTGAAAGG + Intronic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1123504657 15:20928713-20928735 TAGGTGACTTTTCAGCTGTAGGG - Intergenic
1123561906 15:21502414-21502436 TAGGTGACTTTTCAGCTGTAGGG - Intergenic
1123598148 15:21939695-21939717 TAGGTGACTTTTCAGCTGTAGGG - Intergenic
1125265459 15:37874708-37874730 GTGCTCCATTTTCACCTGAAAGG + Intergenic
1130211673 15:81928964-81928986 GAGGTGAATTTTTAAATGAATGG + Intergenic
1132202561 15:99964917-99964939 GTGGAGAAGTTCCAGCAGAACGG + Intergenic
1202970249 15_KI270727v1_random:229540-229562 TAGGTGACTTTTCAGCTGTAGGG - Intergenic
1133052770 16:3127006-3127028 GTGGTGGGTTTTCAGGAGAATGG + Intergenic
1135836413 16:25829880-25829902 GTGGTGCAATCTCAGCTTAATGG + Intronic
1137938372 16:52657406-52657428 GAGATGACTTTTAAGCTGAATGG + Intergenic
1145287395 17:21516390-21516412 GTTTTGAATTCACAGCTGAAGGG - Intergenic
1145390228 17:22449988-22450010 GTTTTGAATTCACAGCTGAAGGG + Intergenic
1146241566 17:31233342-31233364 TAGGTGATTTTTCAGCTGTAGGG + Intronic
1149346661 17:55744301-55744323 TTGGTGAATTTTCAGGGAAATGG - Intergenic
1153120192 18:1714769-1714791 GTGTACAATTTTCAGCTGATGGG - Intergenic
1154055503 18:11009440-11009462 GTGCTGGAGATTCAGCTGAAGGG + Intronic
1157135388 18:45049155-45049177 GTCATGAATTTTCAACTGAATGG + Intronic
1158439698 18:57464396-57464418 GTGTTGAAATTTCAGATGAGGGG - Intronic
1158529116 18:58242414-58242436 GTGGTTAAGTACCAGCTGAAAGG + Intronic
1159138350 18:64363092-64363114 GTTGAGAATTTTAAGATGAAGGG - Intergenic
1159880872 18:73857405-73857427 TTTGTGAATATGCAGCTGAAAGG + Intergenic
1164788384 19:30956079-30956101 ATGGGCAATTATCAGCTGAAAGG - Intergenic
1166426594 19:42684522-42684544 GTGGTGAATCTTGAGAGGAAAGG + Intronic
1167623736 19:50573095-50573117 GTGGTGAAATCTCAGCTCACTGG - Intergenic
925044729 2:764204-764226 GTGGTCAATTTTCAGCTCCTTGG + Intergenic
926552619 2:14318196-14318218 GTGGTCAATATTCAACTGATTGG - Intergenic
926929307 2:18021437-18021459 CTTGTGGAATTTCAGCTGAAAGG + Intronic
927143955 2:20148710-20148732 GTGGGATATTTTCATCTGAATGG - Intergenic
928323719 2:30303430-30303452 GTGGGGTATTTTCAGGTGAGAGG + Intronic
929960249 2:46490805-46490827 GCGGAGAATGATCAGCTGAATGG - Intronic
934029920 2:88034360-88034382 TTTGTGAATTTTCAGATGATTGG - Intronic
935195214 2:100809713-100809735 GATGTAAATTTGCAGCTGAAGGG - Intergenic
935690793 2:105730674-105730696 GTTGTGAAATTGCAGGTGAAGGG - Intergenic
936915427 2:117635012-117635034 GTGGTGAATGTTCGGCTGGTAGG - Intergenic
937123305 2:119455838-119455860 GACATGAATTTTCAGATGAAAGG + Intronic
937156870 2:119725832-119725854 GTGGAGAATCCTGAGCTGAAAGG + Intergenic
938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG + Intergenic
941963910 2:171281722-171281744 GTGGCTAATTTTCTACTGAAGGG - Intergenic
943671433 2:190665875-190665897 GTGGTGAGGTTTCAGCTTTATGG + Intronic
944202314 2:197120768-197120790 GAGGTGAATGTTGAGCTGATAGG - Intronic
945797002 2:214377676-214377698 GTGTGGAATTTTCAACTGTATGG + Intronic
948964585 2:241367778-241367800 GTGCTGATTTTCCAGCAGAAGGG + Intronic
949008195 2:241662674-241662696 GTGGTGAGTTTCCTGCTGACTGG - Intronic
1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG + Intronic
1176844401 21:13865522-13865544 GTGGTGCATTTGTGGCTGAAAGG - Intergenic
1183710115 22:39498400-39498422 GTGGAGATTTTACAGGTGAATGG + Intergenic
1185149306 22:49154878-49154900 GTGCTGAATTATCAGCTAATGGG - Intergenic
950353126 3:12376738-12376760 GCTGTGAAGTTTCAGCAGAAGGG - Intronic
951493958 3:23304204-23304226 GTGGTGAAATTATAGCAGAAGGG + Intronic
952183608 3:30944978-30945000 GGGGTGAATTTGGAGCTGAGAGG - Intergenic
952720622 3:36528840-36528862 GTCTTGAATTTTCCCCTGAAAGG - Exonic
954498068 3:50983513-50983535 GTGCTCAACTTTCAGCAGAAAGG - Intronic
954956959 3:54529696-54529718 TTGGTAAATTTTGAGCTTAAAGG + Intronic
955804245 3:62717770-62717792 TTGGTGAATTTTAGGCAGAATGG - Intronic
956440017 3:69270984-69271006 ATGTTGTATTTTCAGCTGAATGG + Intronic
958869513 3:99540989-99541011 GTGATAAAACTTCAGCTGAATGG - Intergenic
961376749 3:126472166-126472188 CAGGTGAATTTTCAGCCGACAGG + Exonic
962849368 3:139296467-139296489 GTGGTTAAGTTTAAGCTGCATGG - Intronic
962856377 3:139349567-139349589 GGGGTAAATTTCCAGTTGAATGG + Intronic
966440680 3:179941344-179941366 GTAGAGAATTTTGAGCTGAGGGG - Intronic
967554871 3:190845033-190845055 GTGTTGAATTTTGAGTTGAGTGG - Intergenic
968722797 4:2220106-2220128 GGGGTGAATTTGTAGCTGAGAGG - Intronic
970415095 4:15848907-15848929 GTGGTGATTTTTCAATAGAAAGG - Exonic
971166862 4:24192424-24192446 GTAGTTAATGTTTAGCTGAACGG + Intergenic
974282866 4:59822060-59822082 GGGCTGAGTGTTCAGCTGAAGGG - Intergenic
974296904 4:60012024-60012046 TTGGTGAATTTTTAGGTGACAGG + Intergenic
976608129 4:87001714-87001736 GTGTTGAAGTCACAGCTGAAGGG + Intronic
979595611 4:122531056-122531078 GTGGCTAATGGTCAGCTGAATGG - Intergenic
980117009 4:128688868-128688890 ATGGTGAAATGTCTGCTGAAGGG - Intergenic
983064186 4:163190469-163190491 GTGGTGAATTTTGAGAGGGAAGG + Intergenic
983904162 4:173168091-173168113 GTGGTGAATTTGTAACCGAAAGG - Intergenic
984563694 4:181301791-181301813 GTGGTACATTTTCATCTTAAGGG + Intergenic
984652098 4:182281465-182281487 ATGTTGAAATTTCAGCTCAAAGG + Intronic
985770466 5:1806898-1806920 GGGGTCCATTGTCAGCTGAACGG + Intronic
988964030 5:36397870-36397892 GTGAAGAATTCTCAGATGAAAGG + Intergenic
989291315 5:39769531-39769553 GTGGTGCAGTTTCGGCTCAATGG + Intergenic
989751934 5:44905213-44905235 TTGGTGGATTATCTGCTGAATGG - Intergenic
990884776 5:60579193-60579215 ATGGTGAATTTGGAACTGAAAGG - Intergenic
991583195 5:68177782-68177804 GAGGTAAATTTTGAGCTGATGGG + Intergenic
994294799 5:98078065-98078087 TTGCTGCATTTTCAGCAGAATGG + Intergenic
994408633 5:99378382-99378404 GTGGAGAATGTTCATTTGAATGG - Intergenic
994592615 5:101791304-101791326 GTTTTGAATTTACAGCTGGAGGG - Intergenic
996543839 5:124657054-124657076 GTGGTCAATATCCAGCTGACTGG + Intronic
998811383 5:145969957-145969979 GTAGAGAATTTTCAGATTAAGGG - Intronic
998975477 5:147641499-147641521 GTTGTAAATTTTAACCTGAAAGG - Intronic
1000419986 5:161027868-161027890 CTTGTCTATTTTCAGCTGAATGG + Intergenic
1000965729 5:167653851-167653873 CTGTTGAACTTGCAGCTGAAAGG + Intronic
1003222905 6:4177600-4177622 GTGGTGAGTATTCAGAAGAAGGG - Intergenic
1010760891 6:79721795-79721817 GTGTTTTATTTTCATCTGAAAGG + Intergenic
1011008811 6:82680273-82680295 GTAGTGATTTTTGAGCTGAAGGG + Intergenic
1018008477 6:159646235-159646257 GTGGTGAAATTTCAGAGAAATGG - Intergenic
1018152121 6:160950009-160950031 GTGATGAATTGTTACCTGAATGG - Intergenic
1018180727 6:161221174-161221196 GGGGTGGATTTTCTGCTGACCGG - Intronic
1019947269 7:4339827-4339849 GTGGTGAATTTTAAGCAGAGGGG - Intergenic
1021094678 7:16522320-16522342 GTGGTGGGTTTTGAGCTGATAGG - Intronic
1021712805 7:23432942-23432964 GTGGTGACTTTTTAGTTTAAAGG - Intronic
1021723746 7:23530944-23530966 GTGGTCAGTTTTTAGATGAAAGG + Intronic
1023605662 7:41928565-41928587 GGGGTTAACTGTCAGCTGAAGGG - Intergenic
1028193477 7:87877689-87877711 GTTTTGAATGTTCAGCAGAATGG + Intronic
1030621962 7:111799708-111799730 GTGGTGAACTTTGAGAGGAAAGG - Intronic
1031464172 7:122087905-122087927 ATGGAGAAATGTCAGCTGAATGG + Intronic
1032678238 7:134153022-134153044 GTTGTTAATTTTCTGCTGATTGG + Intronic
1032731717 7:134649622-134649644 GTGGCTAAGTTTCAGCAGAAGGG - Intronic
1034406963 7:150910940-150910962 GTGTTGAATTTTCTGATGAGTGG - Intergenic
1035479940 7:159173890-159173912 GTGGTGAATTTTTTTCTGAAAGG + Intergenic
1036244511 8:7104827-7104849 CTGCTTAATTTTCATCTGAAAGG + Intergenic
1039649450 8:39326175-39326197 GTGGTGAACTTTGAGAGGAAAGG + Intergenic
1042748410 8:72132782-72132804 GTGGTGAAATTCAAGCTAAAGGG + Intergenic
1042982594 8:74547233-74547255 GTAGTTATTCTTCAGCTGAAAGG - Intergenic
1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG + Intergenic
1044797968 8:95923317-95923339 GTGGGGATTTTTTAGATGAAAGG - Intergenic
1047466889 8:125125420-125125442 AGGGTGAATTTTGAGCTGAGAGG + Intronic
1050005860 9:1129585-1129607 TTGGTGAATTTGCAAATGAAAGG + Intergenic
1051135154 9:13911812-13911834 CTGATCAATTTTCAGCTTAAAGG - Intergenic
1052374677 9:27705722-27705744 GATGTGACTTTTCAGCTGGAGGG + Intergenic
1053394661 9:37762237-37762259 GTGATGAATTTTCTGCTAACTGG + Intronic
1055982652 9:82019995-82020017 GTGGTCATTTCTCAACTGAATGG - Intergenic
1056370321 9:85947577-85947599 GGGGTGATTTTTCACCTCAAGGG + Intronic
1056607133 9:88095336-88095358 GTGGTGATTTTCTAGCTGATGGG - Intergenic
1059728867 9:117036505-117036527 TTGGTTAATTTTCATATGAAAGG - Intronic
1061090821 9:128425023-128425045 GTGGTTACTTTTAAGATGAAAGG + Intronic
1186443971 X:9609977-9609999 GTGTTGGAGTTTCAGCTGAAGGG + Intronic
1186967275 X:14801746-14801768 GTGGTCATTTTTAAACTGAAGGG - Intergenic
1188219234 X:27519629-27519651 GTGCTGAATTATCAAATGAAGGG + Intergenic
1188616018 X:32160114-32160136 GTGCTGAATTTCCAGCTCTAAGG - Intronic
1189555236 X:42137272-42137294 GTGTTGAATTTTCTGCTATATGG + Intergenic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1190451457 X:50585374-50585396 GTGGTGGATTTTCAGGTAGAGGG + Intergenic
1191945587 X:66531254-66531276 GTCCTGAAATTTCAGCTGAGAGG + Intergenic
1195657122 X:107342634-107342656 GTGGAGCATAGTCAGCTGAAGGG - Intergenic
1198424510 X:136502850-136502872 GTGGCAAAGTTTCAACTGAAGGG + Exonic