ID: 922585605

View in Genome Browser
Species Human (GRCh38)
Location 1:226732954-226732976
Sequence GATGAAGAAAGCGCCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922585600_922585605 15 Left 922585600 1:226732916-226732938 CCTGCACACCAAGTCATACACAC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
922585597_922585605 21 Left 922585597 1:226732910-226732932 CCCCTGCCTGCACACCAAGTCAT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
922585598_922585605 20 Left 922585598 1:226732911-226732933 CCCTGCCTGCACACCAAGTCATA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
922585601_922585605 7 Left 922585601 1:226732924-226732946 CCAAGTCATACACACTCATTCCT 0: 1
1: 0
2: 1
3: 14
4: 214
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
922585599_922585605 19 Left 922585599 1:226732912-226732934 CCTGCCTGCACACCAAGTCATAC 0: 1
1: 0
2: 2
3: 9
4: 108
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
922585596_922585605 22 Left 922585596 1:226732909-226732931 CCCCCTGCCTGCACACCAAGTCA 0: 1
1: 0
2: 2
3: 20
4: 280
Right 922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922585605 Original CRISPR GATGAAGAAAGCGCCACAGG AGG Intronic
902383903 1:16065558-16065580 CCTGTAGAAAGAGCCACAGGTGG - Intronic
902640358 1:17762833-17762855 CACGCAGAAAGCGCCAGAGGTGG - Intronic
903010576 1:20327413-20327435 GATGCAGAAGGTCCCACAGGAGG + Intronic
903368104 1:22817206-22817228 GATGATGATAATGCCACAGGTGG - Intronic
903417437 1:23193596-23193618 AATGTAGAAGGCCCCACAGGTGG + Exonic
911094319 1:94043300-94043322 GATGGAGACAGGGCCACAGATGG - Intronic
913211717 1:116588191-116588213 GATCAAGGAAGGGCCAGAGGAGG + Intronic
913481544 1:119293923-119293945 GAGGAAGCAAGAGCCAGAGGAGG - Intergenic
919059461 1:192613219-192613241 GATGAAGATAGGGGCATAGGAGG + Intergenic
919673667 1:200360686-200360708 GATGAAGAAATGGGCTCAGGGGG - Intergenic
920444433 1:206005215-206005237 GATGAAGAATGGGCCCAAGGAGG - Intergenic
922423452 1:225474262-225474284 GTAGAAGACAGTGCCACAGGCGG - Intergenic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
924155958 1:241176825-241176847 GAGGAGGAAAGCAGCACAGGAGG - Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1063115021 10:3067186-3067208 GATGACGGGAGCGCCACAGGTGG - Intronic
1063557774 10:7097039-7097061 GGTGAAGAAAGAGTCACGGGTGG - Intergenic
1065932412 10:30491346-30491368 GATGAAGAAATCTCCTCATGTGG + Intergenic
1068589164 10:58836322-58836344 GATGGAGAAACCAGCACAGGGGG - Intergenic
1069425772 10:68287561-68287583 GATGGTGAAGGGGCCACAGGAGG - Intronic
1070745725 10:78932563-78932585 GATGAAGAGGGCTCCAGAGGGGG - Intergenic
1072162932 10:92785124-92785146 GTTAAAGCAAGAGCCACAGGAGG - Intergenic
1076834735 10:133015328-133015350 GAGGAAGAAAGCCCCTCAGCCGG + Intergenic
1077554447 11:3219183-3219205 GAAGAGGAAGGCGCCACACGTGG - Intergenic
1080214168 11:29822564-29822586 GATGAAGAAAGCTTCAGAGCTGG + Intergenic
1082997359 11:59264573-59264595 GATGAAGAAACAGGCTCAGGTGG - Intergenic
1085912969 11:80850567-80850589 GATGGAGAAAGAACCACACGTGG + Intergenic
1088904164 11:114141405-114141427 GATGGAGAAAGAGACAGAGGAGG - Intronic
1091553265 12:1552883-1552905 GATGACGAAGGGTCCACAGGGGG - Intronic
1103916464 12:124378336-124378358 GAAGAAGAAAGCGCCGGCGGCGG - Exonic
1106895394 13:34294852-34294874 GAAGAAGAGAGCTACACAGGGGG - Intergenic
1113215199 13:108032056-108032078 GAGGAAGAAAGAGCCAGAGGGGG + Intergenic
1115002937 14:28443220-28443242 GATGAAGAAAGCCAGAGAGGTGG - Intergenic
1115362032 14:32514719-32514741 AATGAAGAAAAAGCAACAGGTGG + Intronic
1119129570 14:72158934-72158956 GATGAAGGAAGAATCACAGGTGG - Intronic
1122842667 14:104473941-104473963 GAGGATGAAAGCGCGCCAGGAGG - Intergenic
1126343160 15:47665901-47665923 GATGAAGAAACAACCTCAGGAGG + Intronic
1129030110 15:72611783-72611805 GAAGAAGAGAGAGCCCCAGGAGG + Intergenic
1130219965 15:82011184-82011206 GATGAAGAAAGCTCTTCAGGAGG - Intergenic
1131915591 15:97262072-97262094 GATGAAGGAAACGGCACGGGAGG - Intergenic
1135764499 16:25165819-25165841 GATGAAGAAACAGGCACAGAGGG - Intronic
1137403919 16:48175509-48175531 GATGAAGAATGGGCCACGGAGGG - Intronic
1138414953 16:56866394-56866416 CAGGAAGAAAGCCCCAGAGGAGG + Intronic
1138607308 16:58097375-58097397 GATGGGGAAATCGCCACAGGGGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146949672 17:36897207-36897229 GATGAAGGAAGCACATCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1153455593 18:5278837-5278859 GATGATGATAGGGCCACTGGTGG - Intergenic
1153975171 18:10262876-10262898 GATGCAGAAAGCTGCACAGATGG - Intergenic
1154975137 18:21450150-21450172 GATAAAGCCAGTGCCACAGGTGG + Intronic
1157548611 18:48565224-48565246 GATGAAGGCAGTGCCACAGCAGG - Intronic
1160290759 18:77590966-77590988 GATGAAGAAAACTACACAGACGG + Intergenic
1160429893 18:78804092-78804114 GTTGAAGAAAGCAGCCCAGGGGG + Intergenic
1161882689 19:6967815-6967837 GAGGAAGAAAGTTCCACACGTGG - Intergenic
1162373777 19:10293500-10293522 GACGAAAAAGGCGCCACTGGTGG + Intronic
1163433902 19:17283779-17283801 GATGAGGCAAGCTCTACAGGTGG + Exonic
1164794667 19:31015999-31016021 TATGAAGAATGCGCCTCAGATGG + Intergenic
1167455858 19:49596516-49596538 GAAGAAGAAAGGGCCAGAGCGGG + Exonic
1168244581 19:55105462-55105484 GATAAAGAAAACACAACAGGTGG - Intronic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925636929 2:5949659-5949681 GGTGAAGAAAGCACTGCAGGTGG - Intergenic
927815330 2:26210792-26210814 GATGAAGAAAGCTTCACAATGGG - Intronic
928350356 2:30547179-30547201 TTTGAAGAAAGAGTCACAGGTGG - Intronic
928562076 2:32499944-32499966 GATGAAGAAAAAGTCTCAGGAGG + Exonic
929505287 2:42523466-42523488 GAAGAAGAAAGAGCTACAAGAGG + Intronic
929690741 2:44070660-44070682 GATGAAGAAAGCTCCACAGCTGG - Intergenic
930215597 2:48693166-48693188 GGTGAAGAAAAGGCCACTGGAGG + Intronic
934121869 2:88847941-88847963 GATGCAGAGAGGTCCACAGGAGG - Intergenic
936240739 2:110786628-110786650 CATGAGGACAGCTCCACAGGTGG + Intronic
937135700 2:119550167-119550189 GCTGGAGACAGGGCCACAGGAGG - Intronic
939554543 2:143658656-143658678 GATGAAGCCAGCTCTACAGGTGG - Intronic
943062284 2:183051746-183051768 GATGAAGAAACTGTCACAGATGG - Intergenic
943235004 2:185306578-185306600 GATGAAGTAAGTGCCAGAAGGGG + Intergenic
945382634 2:209159778-209159800 GATGAAGAAACTGCAACGGGAGG - Intergenic
947949000 2:234131469-234131491 GATCAAGAATGGGCTACAGGAGG + Intergenic
949049017 2:241887292-241887314 GAGGACGGCAGCGCCACAGGTGG - Intergenic
1169659373 20:7961409-7961431 CATGAAGAAATCTCCAAAGGAGG + Intergenic
1170546021 20:17436546-17436568 GATCAAGAAAGAGGCACAGACGG - Intronic
1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG + Intronic
1180244820 21:46539886-46539908 GTTGAGGAAGGCGTCACAGGAGG - Exonic
1180998142 22:19975650-19975672 GATGAAGCCAGCTCCACTGGGGG - Intronic
1181540069 22:23568179-23568201 GATGAAGAAACCGAGGCAGGGGG - Intergenic
1182921814 22:34087277-34087299 GATAGAGAAAGAGGCACAGGAGG - Intergenic
1183993784 22:41617997-41618019 GAGGAAGAAGTAGCCACAGGAGG - Intronic
950024636 3:9811730-9811752 GATGGGGAAAGCCCCAGAGGAGG - Intronic
952497540 3:33928969-33928991 GATAACGAAAGAGCCACAAGTGG + Intergenic
952974295 3:38681070-38681092 GATGGAAAAAGGGCCATAGGTGG + Intergenic
954015800 3:47689394-47689416 GATGAAGAAACAGTCACAGCAGG - Exonic
955629527 3:60957640-60957662 GGTGAAGAAATTGACACAGGAGG - Intronic
956716884 3:72087142-72087164 GAGGAAGAAAGCGGCCCAGGTGG + Intergenic
959090015 3:101892294-101892316 GATGGAGAAAGCCACACAGAGGG - Intergenic
959827352 3:110814425-110814447 GATGAGGAAATACCCACAGGCGG + Intergenic
963061487 3:141230599-141230621 GATGAAGAAGGCATGACAGGTGG + Intronic
964090591 3:152871848-152871870 GATGAGGAAAGTTCCACTGGAGG - Intergenic
965345090 3:167538540-167538562 GATGAAGAATGTGCCAGAGATGG - Intronic
967792193 3:193561333-193561355 GATGAAGAAAGCGGCAAGGCTGG + Intronic
967845522 3:194039570-194039592 GGTGAAGAAAAAGCCACTGGTGG - Intergenic
969075147 4:4572355-4572377 AATGAAGAAAGCACCAAAAGGGG - Intergenic
975190191 4:71451651-71451673 TTTGAAGAAAGTGCTACAGGAGG + Intronic
975468393 4:74735468-74735490 GATGAAGAAAGGGCCTCACGTGG - Intergenic
984658182 4:182342755-182342777 GATGACGAAAGCACCCCACGGGG - Intronic
985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG + Exonic
985694984 5:1335177-1335199 GATGAAGAAAGCCACACTGAGGG + Intronic
985697160 5:1347086-1347108 CCTCAAGAAAGCGCCAGAGGAGG + Intergenic
988497693 5:31758763-31758785 GGTGGAGAAAGCACCCCAGGTGG + Intronic
990361005 5:55020030-55020052 GATGAGGAAAGTGCCACATGGGG - Intronic
991198332 5:63961102-63961124 GATGTAGAAAGCTCCAAAGGTGG + Exonic
994748351 5:103707235-103707257 AAAGAAGAAAGCGCAGCAGGCGG + Intergenic
996242272 5:121218715-121218737 GATTAAGGAAGCAGCACAGGAGG + Intergenic
997281851 5:132653995-132654017 GACAAAGAAACTGCCACAGGAGG + Intergenic
999094106 5:148962920-148962942 GAGGAAGAAAGAGCAGCAGGTGG + Intronic
1000414756 5:160972148-160972170 CATGAAGTAAGCGCCACAGTGGG + Intergenic
1001229293 5:169971885-169971907 GATGAGGAAAGTGGCAGAGGTGG - Intronic
1001585673 5:172832570-172832592 GATGGAGAAAGGGACACAGAGGG + Intergenic
1006984541 6:38168095-38168117 GGTGGAGAGAGTGCCACAGGAGG + Intergenic
1010015497 6:71101373-71101395 GATGATTGAAGCCCCACAGGAGG - Intergenic
1011633507 6:89349864-89349886 GATGAAGAAGCTGCCAAAGGAGG + Intronic
1015209588 6:130682191-130682213 AATGAAGAAAGGGCCAGGGGAGG - Intergenic
1020807056 7:12802894-12802916 GATGAGAAAATAGCCACAGGAGG + Intergenic
1020933039 7:14424381-14424403 GATGAAGAAAATGGGACAGGTGG - Intronic
1021612666 7:22473357-22473379 GATGTAGAAAGTGACTCAGGTGG + Intronic
1022103452 7:27182653-27182675 CATGGAGATAGCCCCACAGGAGG - Exonic
1022855283 7:34308336-34308358 AATGAAGTAAACACCACAGGCGG - Intergenic
1023025055 7:36042515-36042537 GATGAGGAGAGGGACACAGGTGG + Intergenic
1030367321 7:108660268-108660290 GATGAGGACAGCTGCACAGGTGG - Intergenic
1031135524 7:117879892-117879914 GAAGGAGAAAGCTCCAGAGGAGG - Intergenic
1031339597 7:120582598-120582620 GATGGAGAAAGAGGCAGAGGAGG - Intronic
1033196845 7:139334974-139334996 GATGAAGATAGCGCAAGTGGTGG + Intergenic
1038105871 8:24433145-24433167 GATGAAGGAAGAGCCATTGGAGG + Intergenic
1038730668 8:30124176-30124198 GATGAAGAAAATGCCAGAAGAGG + Intronic
1040492933 8:47941596-47941618 GATGAAGAAAGTACCAAATGTGG - Intronic
1042505101 8:69551089-69551111 GGTGATGAAAGGCCCACAGGGGG + Intronic
1045162652 8:99566423-99566445 GAAGAAGAAAACACCATAGGAGG - Intronic
1048622012 8:136144144-136144166 GAAGAAGAAAGAGGAACAGGAGG - Intergenic
1049476794 8:142800614-142800636 AATGAAGAAGGGTCCACAGGAGG + Intergenic
1052756082 9:32543167-32543189 GATGAAGAACTTGTCACAGGAGG - Exonic
1054327003 9:63717826-63717848 GGTGAACACAGGGCCACAGGTGG + Intergenic
1054950995 9:70851736-70851758 GATGAAGAAAGGGAGACAGTAGG + Intronic
1060917818 9:127401587-127401609 GCTGAAGATAGTGCCACGGGTGG - Intronic
1061372741 9:130206967-130206989 GATGAACAAAGAGAGACAGGAGG - Intronic
1192021899 X:67402833-67402855 GATGAATGAAGCCCCACAGAAGG - Intergenic
1197093814 X:122571258-122571280 GAAGAAGGAAGCCCCACATGGGG + Intergenic
1198301565 X:135338875-135338897 GATGAAGAAAGAGGAAAAGGGGG - Intronic
1198774766 X:140167757-140167779 GATGGAGAAAGGGCCAAAGGAGG - Intergenic
1201979821 Y:19894335-19894357 GATGAAGAAAGCCTCAAAGATGG + Intergenic