ID: 922585630

View in Genome Browser
Species Human (GRCh38)
Location 1:226733097-226733119
Sequence CTGTGTGAGTGGGGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922585623_922585630 24 Left 922585623 1:226733050-226733072 CCAGGGGTTGGTTATGTGACTGG No data
Right 922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG 0: 1
1: 0
2: 3
3: 56
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922585630 Original CRISPR CTGTGTGAGTGGGGTGAGCA AGG Intronic
900170789 1:1267714-1267736 CGGGGTGAGTGGGGTGCCCAGGG - Intronic
900427612 1:2587607-2587629 CTGCGGGGGTGGGCTGAGCACGG + Intronic
901086659 1:6615000-6615022 ATGTGTGAGGGGGGTGCGCCAGG - Intronic
901391607 1:8949693-8949715 CTGGGTGGGTTGGGTGAGCTCGG - Intronic
901679740 1:10906146-10906168 CTGTGGGGGTGGGGAGAGCCTGG + Intergenic
902037186 1:13466546-13466568 TTGAGTGAGTGGGCTGAGTAAGG - Intergenic
902380811 1:16051455-16051477 CTGTGGGAGTGGGGAGCCCAGGG - Intronic
902396535 1:16135017-16135039 CTGTGTGAGTTGGGGGACCCTGG - Exonic
902435838 1:16397710-16397732 CTGATTGAGTGGGCTGAGAAAGG - Exonic
902578901 1:17396093-17396115 CTGTGGGAGTGGGCTGGGCATGG + Intronic
903332878 1:22605444-22605466 TTTTGTGAGTGGTGTGAGCAGGG - Intergenic
903756843 1:25668236-25668258 CTGAGTGGGTGGGGTGGCCAAGG - Intronic
904107672 1:28099485-28099507 CTGAGTTAGTTGGGTTAGCAGGG + Intergenic
904237860 1:29125531-29125553 CTCTGTGAGTGGGATGAGAGGGG - Intergenic
904880296 1:33691264-33691286 CTGTGAGCGTGGGGTGGCCATGG + Intronic
905249095 1:36636589-36636611 CTGTGTGTGTCGGGTGGGAATGG + Intergenic
905343477 1:37295350-37295372 CTGTGAGAGTCTGGTGTGCATGG + Intergenic
906197382 1:43937311-43937333 GTGTGTGAGTGCGATCAGCAAGG - Intergenic
906264278 1:44417023-44417045 CTCTGGGACTGGGGTGGGCAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906678054 1:47707845-47707867 CGATGTGAGTGGGGTGGGGACGG + Intergenic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907473547 1:54690251-54690273 CTTTGGGAGTGGGGTGAGAAGGG + Intronic
907554657 1:55333814-55333836 CTGTTTGAGTAGGGTGGCCAAGG + Intergenic
907899109 1:58721217-58721239 TTGTGAAAGTGGGGAGAGCAGGG + Intergenic
908278376 1:62501050-62501072 GGGGGTGAGTGGGGTGGGCAGGG + Intronic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
910278875 1:85476486-85476508 CTGTGTGGAGGGGGTGAGCTGGG - Intronic
910344335 1:86218426-86218448 CTGTGTAGTTGGGGTCAGCATGG + Intergenic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
911267065 1:95754565-95754587 GTGTGTGAGTGAGTGGAGCATGG - Intergenic
911678532 1:100687545-100687567 TTGTGTGAGTGTGGTGATCAGGG - Intergenic
912159690 1:106966705-106966727 CTGTGTGAGTGTGGTAATGAAGG - Intergenic
912183818 1:107250472-107250494 CTGTGTTAGTGTGCTGACCATGG + Intronic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
912395975 1:109344313-109344335 CTGTGAGAGGGTTGTGAGCAGGG - Intronic
913053234 1:115134968-115134990 CTGTGAGTGTGGGGCAAGCATGG + Intergenic
915537161 1:156543799-156543821 ATCTGTGATTGGGATGAGCAGGG + Intronic
915771068 1:158424745-158424767 GTGTGTGTGTGTGGTGAGAAAGG + Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916001592 1:160621645-160621667 CAGTGTGTATGTGGTGAGCATGG + Intronic
916962688 1:169905137-169905159 GTGTGTATGTGGGGTGAGGAAGG - Intergenic
917562008 1:176168399-176168421 CTGGGTGGGTGGGGGGAGTACGG + Intronic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
918134798 1:181662108-181662130 CTGGGTGAGTTGTGTGACCATGG + Intronic
918319688 1:183352822-183352844 CAGTCAGAGAGGGGTGAGCATGG - Intronic
918647769 1:186922146-186922168 ATGTGTGTGTGGTGTGAGCATGG - Intronic
919639596 1:200035615-200035637 CTGGGTGAATGGGGCGCGCACGG + Intronic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
922051864 1:221998555-221998577 GAGTGTGCTTGGGGTGAGCATGG - Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
923091965 1:230747706-230747728 AGGGGTGAGTGGGGCGAGCAGGG + Exonic
923512303 1:234663048-234663070 GTGAGTGAGTGAGGTGAGCGAGG - Intergenic
924631911 1:245748827-245748849 GTGTGTGAGTGTGGTATGCACGG - Intergenic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062831360 10:608172-608194 CTGTGTGTGTGGGGTGTGTGTGG - Intronic
1063280034 10:4618326-4618348 CAGTGTGATTGGTGTGAGCTTGG - Intergenic
1063578271 10:7281376-7281398 CAGTGGGAGGGGGGTGTGCAGGG - Intronic
1063606983 10:7531302-7531324 CTGCGAGAGTGGGGAGGGCAGGG + Intergenic
1063965635 10:11344106-11344128 CAGTGGGAGTGGGGTGACCCAGG - Intergenic
1064008642 10:11717518-11717540 CTGCAGGGGTGGGGTGAGCAGGG + Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067211252 10:44261781-44261803 CTGGGTGAGTGAGGTGTGCAAGG - Intergenic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067414498 10:46093164-46093186 TTGTGTGTGTGGGGTGTGCTGGG - Intergenic
1067434560 10:46267706-46267728 TTGTGTGTGTGGGGTGTGCTGGG - Intergenic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068629491 10:59284824-59284846 GTGTGTGAGGTGGGTGTGCATGG - Intronic
1068826664 10:61447840-61447862 CAGAGTGAGGGGGGTGTGCAGGG - Intronic
1069107825 10:64405504-64405526 CAGGTTGAGTGAGGTGAGCAGGG + Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070811614 10:79300939-79300961 CTGCGTGAGTGTGGTGGGCCAGG + Exonic
1071288500 10:84171359-84171381 GTGTGTGTGTGGTGTGAACATGG - Intergenic
1074558751 10:114516107-114516129 CTAAGGGAGTGAGGTGAGCAAGG + Intronic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076554933 10:131315093-131315115 CTGTGAGACTGGGGAGAGCCTGG + Intergenic
1077444673 11:2585458-2585480 CTGTGGTGATGGGGTGAGCACGG + Intronic
1077669595 11:4145521-4145543 CTGTGTGCCTGAGGTCAGCACGG + Intergenic
1078011814 11:7578194-7578216 CTGAGTGTGTGGTATGAGCAAGG + Intronic
1078091319 11:8266372-8266394 CAGCTTGGGTGGGGTGAGCATGG - Intronic
1078768325 11:14321516-14321538 AAGTGGGAGTGGGGAGAGCAGGG + Intronic
1081264202 11:40999232-40999254 CAGTGTGAGCGAGGTGTGCAGGG - Intronic
1081501160 11:43668004-43668026 ATGCTTGAGTGTGGTGAGCAAGG + Intronic
1081670896 11:44942004-44942026 GTGTGTGTGTGGCGTGAGTATGG - Intronic
1083654613 11:64223513-64223535 CTGTGACAGGGTGGTGAGCAGGG - Exonic
1083758781 11:64804817-64804839 CTGGGCCAGTGGGGAGAGCAAGG + Intronic
1084267368 11:68011965-68011987 ATGTGTGAGTGGGGAGACCTTGG - Intronic
1084870954 11:72098246-72098268 CAGTGTGAGAAGGGTGGGCAGGG + Intronic
1085532614 11:77200966-77200988 CTGTGACAGTGCAGTGAGCAGGG + Intronic
1086738882 11:90341929-90341951 CTGTGTGTGTTGGGAGTGCAGGG - Intergenic
1086971117 11:93082126-93082148 GTTTGTGAGTGGGGGAAGCAAGG - Intergenic
1087435316 11:98109859-98109881 TTGTGTGTGTGGGGTGAGGTAGG + Intergenic
1087684271 11:101245510-101245532 GTGTGTGTGTGGTGTGAGCGTGG + Intergenic
1088895475 11:114075015-114075037 ATGTGTGTGTGGGGTGGTCAAGG + Intronic
1089357319 11:117862366-117862388 CTGTGTGAGTGGGGCACGCAGGG - Intronic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1090876323 11:130791749-130791771 CTGTGGGTGTGGGCTGGGCACGG + Intergenic
1091168510 11:133501099-133501121 CAGTGTGGGTGGTGGGAGCAGGG - Intronic
1091750110 12:3017083-3017105 CTGTGGTAGAGAGGTGAGCAAGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092736922 12:11591948-11591970 TTGTGGGAGTGGGTTGGGCAGGG - Intergenic
1093958686 12:25250587-25250609 CTGGGTGAGAGGGGTCTGCAGGG - Intronic
1094415482 12:30210866-30210888 CAGTGGCAGTGGCGTGAGCATGG - Intergenic
1096207501 12:49735201-49735223 GTGTGCGTGTGGTGTGAGCATGG + Intronic
1096718612 12:53505448-53505470 CTCTGTTACTGGGGTGAGGAGGG + Intronic
1096967051 12:55637019-55637041 CTGTGTGAGGAGGATGATCAGGG - Exonic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1098748057 12:74265259-74265281 GTGTATGTGTGGTGTGAGCATGG + Intergenic
1099051238 12:77783799-77783821 CTATGTGACTGAGGTGAGTAGGG + Intergenic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1100245715 12:92754581-92754603 CTTTGTGTGTGGGGTCAGTACGG - Intronic
1102422251 12:112813237-112813259 CTGGGTGATTGGGGAGACCAAGG + Intronic
1102463621 12:113115310-113115332 TTGGGTGAGTGGGGTGAGCTGGG - Intronic
1103635977 12:122305691-122305713 CTGAGTCAGTGGGCTGAGAAAGG + Intronic
1103726275 12:122998777-122998799 CTGGGTGGGTGGGGAGGGCAGGG + Intronic
1103909499 12:124344578-124344600 GAGGGTGAGTGGGGTGTGCATGG - Exonic
1103948500 12:124539846-124539868 CTTTGTGGCTGGGGTGAGCCAGG - Intronic
1104307278 12:127621175-127621197 CTTAGTGAGTGGACTGAGCACGG + Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1105853500 13:24356631-24356653 GTGTGTGTGTGGAGTGAGCGTGG - Intergenic
1107127225 13:36858655-36858677 CTGTGAGGATGGGGTGGGCATGG - Intronic
1107549709 13:41463491-41463513 GTGTGTGTGTGTGGTGGGCAGGG + Intronic
1110486631 13:76052003-76052025 CTGTTTCAGTGGGGTGTGTAGGG - Intergenic
1111331987 13:86771115-86771137 GTGTGTGTGTGGGCTGCGCAAGG - Intergenic
1114083243 14:19219476-19219498 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1114533349 14:23408722-23408744 CTGTGTGAGGGAGGTCAGAATGG - Intergenic
1115306912 14:31943347-31943369 CTGTGAGGGTGGGGTGAGTGGGG - Intergenic
1115888813 14:38004296-38004318 GTGTGTGAGTGGGGTGGGGTGGG + Intronic
1117202108 14:53401537-53401559 ATGTGTGTGTGTGGTGGGCAGGG - Intergenic
1117736028 14:58769449-58769471 CAGTGAGTGTGGGGTGAGCCTGG - Intergenic
1118878222 14:69802907-69802929 CTATGGGAATTGGGTGAGCAAGG + Intergenic
1120775683 14:88434985-88435007 CTGTGATAGAGAGGTGAGCATGG + Intronic
1121538303 14:94706398-94706420 CTGTATGAGTGGGGTGCGTCCGG - Intergenic
1121594731 14:95152924-95152946 CTGGGTGAGAGGGCTGGGCACGG + Intronic
1122145528 14:99686741-99686763 CTGAGTGTGTGGGGTGCGGAGGG + Intronic
1122543074 14:102508579-102508601 CTGTGCGGGCGGGGTGAGCCTGG + Intronic
1122879472 14:104683605-104683627 CTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1202894865 14_GL000194v1_random:1246-1268 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1123945987 15:25239140-25239162 CTGTGTGTGGGAGGTGTGCAGGG + Intergenic
1125362684 15:38880592-38880614 CTGTGTGACTAGGGTGGGGAAGG + Intergenic
1125434057 15:39626976-39626998 CTCTGTGATTGGGGTGAGGGGGG - Intronic
1125471473 15:40008604-40008626 GTGTGTGTGTGGGGTGGGGAGGG - Intronic
1126247968 15:46532083-46532105 TGGTGTGAGTGGGGTGAACAGGG + Intergenic
1126442367 15:48703340-48703362 CTCTTAGAGTGGGCTGAGCAGGG - Intergenic
1126506549 15:49411000-49411022 GTGTGTGGGGGGGGTGGGCAGGG + Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1128632681 15:69281975-69281997 CTGTGGGTGTGGGGTTATCAGGG - Intergenic
1128810382 15:70567066-70567088 GTTTGTGAGTGTGGTGGGCAGGG + Intergenic
1128873673 15:71184368-71184390 CTGTGTGAGATGGGACAGCATGG + Intronic
1129169185 15:73797525-73797547 CTGTGGGAGTGGGGCGCCCATGG + Intergenic
1129302264 15:74632179-74632201 CTGTCTGCGTGGGGAAAGCAGGG + Exonic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129907038 15:79195735-79195757 CTGTGTGAGAGCGACGAGCAGGG - Intergenic
1130368788 15:83264954-83264976 CTGGGAGAGTAGGGTGAGCAGGG - Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130895117 15:88164066-88164088 CTGGGTGTATGGGGTGAACAAGG + Intronic
1132510461 16:338427-338449 CTGTGTGGGTGGGTTGTGAAAGG - Intronic
1133112400 16:3556386-3556408 CTGTGTGTGTGGCCTGAGCAGGG - Intronic
1133308770 16:4829136-4829158 CTGAGGGAGTGGTGAGAGCAAGG - Intronic
1134333300 16:13270112-13270134 CTGTTGGAGTCCGGTGAGCAAGG - Intergenic
1135724917 16:24846596-24846618 GTGTGTTTGTGGGGTGGGCATGG + Intronic
1136085597 16:27882681-27882703 CGGGATGAGTGGGGTGGGCATGG - Intronic
1136114953 16:28088775-28088797 GTGTGTGTGTGGGGTGTGTAAGG - Intergenic
1136605607 16:31331367-31331389 CTGTGTGACTGGGGCGAGTCTGG + Intronic
1136924546 16:34359751-34359773 CTTTGTGAGTGTGGTGGGCATGG + Intergenic
1136980027 16:35052055-35052077 CTTTGTGAGTGTGGTGGGCATGG - Intergenic
1137041834 16:35620371-35620393 GTGTGTGTGTGGTGTGAGCGTGG - Intergenic
1138097470 16:54223305-54223327 CTGTGTGAGTGGGGCCATCTGGG + Intergenic
1138510587 16:57506469-57506491 CTGTGTGAGGGGCGTGACAAAGG + Intergenic
1138557826 16:57783024-57783046 TTGTGGGAGTGGGGTAAGCTCGG + Intronic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1139648376 16:68348464-68348486 CTGTGTTAGGGTGGTCAGCACGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140235094 16:73151915-73151937 CTGTGTGGGTGGGGTGGGGGTGG - Intergenic
1140700728 16:77579261-77579283 GTGTCTGTGTGGGGTGGGCAAGG - Intergenic
1141098122 16:81177451-81177473 GTGTGTGTGTGTGGTGAGCAGGG + Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1142045869 16:87924936-87924958 CTCTGTGATTGGGGAGAGAAGGG - Intronic
1142104799 16:88296724-88296746 ATGTGTGTGTGGGTGGAGCATGG - Intergenic
1142744095 17:1946805-1946827 CTGTGTGAATTGTGTGTGCACGG + Intronic
1143097532 17:4486338-4486360 CTGCGTGTGTGGGGTGGGGAGGG + Intronic
1143636133 17:8164500-8164522 CTGTGGGAGGTGAGTGAGCAGGG + Intergenic
1144132184 17:12257079-12257101 CTGTGGGAGTGTTGTCAGCAGGG + Intergenic
1144133254 17:12268142-12268164 CTGTGTCCTTGGGGTGAGCCAGG + Intergenic
1144752941 17:17662632-17662654 CGGTGTGGGTGGGATGGGCAAGG - Intergenic
1145743423 17:27294654-27294676 CTGTGTGGCTGGGGCGGGCAAGG + Intronic
1146061112 17:29607886-29607908 CTGTGGGGCTGGGGTGAGCAGGG - Intronic
1146446739 17:32938048-32938070 CTGGGTGAGTAGGATCAGCACGG + Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146650841 17:34605351-34605373 CTCAGTGAGTGGGGTCAGCCAGG + Intronic
1146677094 17:34781154-34781176 CTGCCTGGGTGAGGTGAGCAGGG + Intergenic
1147212789 17:38881753-38881775 GTGTGTGAGTTTGGTGTGCAGGG + Intronic
1147427248 17:40351717-40351739 ATGTGTGGGTTGGGTGGGCATGG + Intronic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1149599060 17:57881639-57881661 CAGAGTGAGGTGGGTGAGCAGGG + Intronic
1150340229 17:64360606-64360628 GTGTGTGTGTGTGGTGAGAAGGG + Intronic
1151584989 17:75003497-75003519 CTGCGTGAGGGGTGCGAGCAGGG - Exonic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152435748 17:80274904-80274926 GTGTGTGAGTGGGGTGTGAGTGG + Intronic
1152435782 17:80275070-80275092 GTGTGTGAGTGGGGTGTGTTGGG + Intronic
1152436761 17:80281106-80281128 GTGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436769 17:80281138-80281160 GTGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436780 17:80281191-80281213 GTGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436787 17:80281218-80281240 GTGTGTGAGTGGGGTGTGTGTGG - Intronic
1152436805 17:80281311-80281333 GTGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436854 17:80281566-80281588 GTGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436865 17:80281642-80281664 GTGTGTGAGTGGGGTGAGTGGGG - Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1153245276 18:3067212-3067234 CTGTGTGACTTGGGTGTGAATGG - Exonic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154017983 18:10637407-10637429 ATGTGTGAGTGGGAGGGGCAGGG + Intergenic
1154186887 18:12192175-12192197 ATGTGTGAGTGGGAGGGGCAGGG - Intergenic
1155077039 18:22367795-22367817 CTGTGTGTGTGGCGGGAGCTGGG + Intergenic
1156281003 18:35638455-35638477 GTGTGTGTGTGGGGTGGGGAAGG - Intronic
1156707219 18:39897958-39897980 CTGTGTGAGTCCAGTGAGCATGG - Intergenic
1157104398 18:44759589-44759611 CAGTGTGTGTGGGGTGAGCTGGG + Intronic
1157315851 18:46589014-46589036 CTGGCTAAGTGGGGTGGGCATGG + Intronic
1158076663 18:53537823-53537845 CTGAGTCAGTGGGCTGAGAAAGG - Intergenic
1158621832 18:59039701-59039723 CTGGTGGAGTGGGGTGAGGATGG + Intergenic
1159090250 18:63840170-63840192 CTGTGTGTATGATGTGAGCAGGG - Intergenic
1160164470 18:76497457-76497479 TTGTGTGTGTGGAGTGAGCTAGG - Exonic
1161260496 19:3335315-3335337 CTGTGCCAGTGGGGTCAGCGGGG + Intergenic
1161350883 19:3790865-3790887 CTGTGTGATAGGTGTGAGCCTGG + Intronic
1161492353 19:4568978-4569000 CAGTGAGATTGGGCTGAGCAGGG - Intergenic
1162518726 19:11166458-11166480 GAGTGTGAGTGGGGTGGGCCAGG + Intronic
1162672422 19:12268187-12268209 CTTTGTGACTGGGGTGGGGAAGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163501428 19:17678755-17678777 CTCTGTGAAGGGGGTGGGCAGGG + Intronic
1163834126 19:19563003-19563025 CTGTGTGTGTGGTGTGTGCCAGG - Intronic
1164013703 19:21233310-21233332 TTGTGTGAGTGCTGTCAGCATGG - Intronic
1164018255 19:21272721-21272743 CTGTGTGAGAGGGGAGATCTGGG + Intronic
1164217581 19:23163293-23163315 GTGTGTGTGTGGTGTGAGCGTGG - Intergenic
1164902593 19:31940562-31940584 CTGTGTGGGTGGGTTGGCCATGG - Intergenic
1165070114 19:33250847-33250869 CTGTGTGTGTGGTGTGAGTGTGG - Intergenic
1165164629 19:33843164-33843186 CTGTATGTGTGTGGTGAGCAGGG - Intergenic
1165354919 19:35298410-35298432 TTGTGTGTGTGGTGTGTGCATGG - Intronic
1166410482 19:42553086-42553108 CTGTGTGAGCTGGGAGAGAATGG + Intronic
1167240186 19:48338883-48338905 CTGAGGGTGAGGGGTGAGCAGGG + Intronic
1167385058 19:49158087-49158109 CTGTGTCCGTGGGGAGCGCACGG + Intronic
1167495161 19:49813249-49813271 CTGTTTGAGTTGGGTGAAGAAGG - Exonic
1167535246 19:50046295-50046317 CTGTATAAATGGGGTGAGCAAGG + Exonic
1167621765 19:50564703-50564725 CAGAGAGAGTGGGGTGAGAAGGG + Intronic
1168411175 19:56141345-56141367 CTGAGAGAGTGAGGTGAGCGAGG + Exonic
925355523 2:3238529-3238551 CAGTGGCAGTGGGGTGTGCATGG - Intronic
926634526 2:15165661-15165683 CGGTGGGAGTGGGGTGGACAGGG + Intergenic
926953006 2:18264366-18264388 GTGTGTGAATGGGGTGGCCAGGG + Intronic
927145797 2:20164983-20165005 GTGTGAGTGTGTGGTGAGCATGG - Intergenic
927436578 2:23071753-23071775 GTCTGTGAGTGGGGTGGGGATGG - Intergenic
927981097 2:27375706-27375728 CTCTGTGAGTCGGGTTAGGAGGG + Exonic
929593318 2:43160689-43160711 GTGTGTGTGTGTGGTGGGCAGGG + Intergenic
930719893 2:54628883-54628905 CTGTGTGAGGGAGCTCAGCATGG - Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931748049 2:65307946-65307968 CTGTGTGAATGGGGGGGGCGGGG - Intergenic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932420719 2:71599787-71599809 CTGGGTGGGTGTGGTGAACAGGG + Intronic
933076310 2:77931716-77931738 CTGTGTGGGTTGGGTGATCATGG - Intergenic
933793676 2:85903576-85903598 CTGTGCGTGGGGGGTGAGCCAGG + Intergenic
934058144 2:88269777-88269799 GTCTCTGAGAGGGGTGAGCAAGG + Intergenic
935267914 2:101410279-101410301 GTATGTGAGTGTGGTGAGCGTGG - Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936063451 2:109313147-109313169 CTGTGTGCATGGGCTGAGCTGGG + Intronic
936091885 2:109506931-109506953 CTGTGTGGGGTGGCTGAGCACGG - Intergenic
937100328 2:119263729-119263751 TTGTGGGGGTGGGGTGGGCAGGG - Exonic
937478443 2:122235970-122235992 GTGTAAGGGTGGGGTGAGCAGGG + Intergenic
938369789 2:130761970-130761992 CTGTGTGAGAGGGGTAGGCAGGG + Intronic
938493339 2:131777154-131777176 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
939070882 2:137540608-137540630 CTGTGTGAGTGGGGTGTTCCAGG - Intronic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
942484868 2:176428436-176428458 AAGTGTGAGTGGGGTAATCAGGG - Intergenic
942961694 2:181837236-181837258 GAGTGTCAGTGGGGTGGGCAGGG + Intergenic
943685994 2:190818952-190818974 GTGTGTGTGTGTGTTGAGCAAGG - Intergenic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946735608 2:222751529-222751551 GTGTGTGAGTGGTTGGAGCACGG + Intergenic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
947628088 2:231633749-231633771 CTGTGTGAGTGTAGAGACCAAGG + Intergenic
947751499 2:232535094-232535116 CAGAGAGAGTGGGGTGAGAAGGG - Intronic
947832417 2:233150918-233150940 CTGAGAGAATGGGGTGTGCAGGG + Intronic
947916783 2:233837841-233837863 CTGGGGGAGTGTGGGGAGCAGGG - Intronic
949059484 2:241948868-241948890 GTGTGTGAGGTGGGTGAGCAGGG + Intergenic
1168742198 20:201257-201279 CAGTGGGAGTGGGGAGTGCAGGG + Intergenic
1169968245 20:11240807-11240829 CTGTGTGAGGAGGTTGTGCAGGG - Intergenic
1170401166 20:15985235-15985257 GAGTGTGTGTGGTGTGAGCATGG - Intronic
1170602814 20:17854569-17854591 CTGTGTGATGGGGATGAGAAGGG + Intergenic
1170639248 20:18137558-18137580 CTGTGGGAGAGGGGTCAGCACGG + Intergenic
1170794321 20:19533222-19533244 CTGTGTGAATGGGGCCATCATGG - Intronic
1172134207 20:32676108-32676130 GTGTGTTAGTGGGGTGGGCGTGG - Intergenic
1172361660 20:34316938-34316960 CTGTGTGAGTGGGCAGGGCTGGG + Intergenic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1172913442 20:38427042-38427064 CTTTGAGGTTGGGGTGAGCAGGG - Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1173583220 20:44161971-44161993 GTGTGTGTGTGGGGTGAGTGAGG - Intronic
1173782909 20:45771541-45771563 GCGTGTAAGTGGGGTGAGGAAGG - Intronic
1174063436 20:47847929-47847951 GTGTGTGTGTGTGGTGAGCTTGG - Intergenic
1174396973 20:50252795-50252817 TTGTGAGAGTGAGGTGAGCTGGG + Intergenic
1174449119 20:50609051-50609073 CAGTTTCAGTGGGGTGAGGATGG + Intronic
1174575945 20:51537245-51537267 ATGTGTGGGTGGGGGGTGCAGGG + Intronic
1175097269 20:56551580-56551602 GTGTGTGTATGTGGTGAGCAGGG + Intergenic
1175829038 20:61952047-61952069 GTGAGTGAGTGGGGGGTGCAGGG - Intergenic
1176614562 21:9017233-9017255 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1176739210 21:10583718-10583740 CTATGTGTGTGGTGTGAGGAAGG + Intronic
1178802747 21:35811362-35811384 CTGGGAGAGAGGGGTGACCAAGG + Intronic
1178823276 21:35994227-35994249 GTGTGTGAGTGGGGTGTGTGAGG - Intronic
1179439183 21:41381135-41381157 CTGTTTTAGAGGGGTGAACACGG - Intronic
1179671103 21:42949195-42949217 GTGTGCGTGTGGAGTGAGCATGG - Intergenic
1179966060 21:44806562-44806584 CTATGTGACTGGAGTGAGCAGGG + Exonic
1180294730 22:10873791-10873813 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180497536 22:15903205-15903227 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180868725 22:19134265-19134287 CTGTGTGAGAGGGGTGCGTGTGG + Exonic
1180960957 22:19762150-19762172 CTGTGTGCCTGGGGACAGCAAGG - Intronic
1181001721 22:19990875-19990897 GTCTGTGAGTGGGGCGGGCAGGG - Intronic
1181475392 22:23164892-23164914 CTGTGGGGGTGGGGTGGGCTGGG - Intergenic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1182804659 22:33059337-33059359 GTGGCTGAGTGAGGTGAGCAAGG + Intergenic
1183737259 22:39650889-39650911 ATGTGTGTGTGAGGAGAGCAGGG + Intronic
1184226126 22:43129779-43129801 CTGTGTTGGTGGGGAGGGCAGGG + Intergenic
1184340889 22:43885311-43885333 CAGGGAGAGTGGGGTGGGCAAGG - Intronic
1184399971 22:44267995-44268017 CTTTGGGAGTGGGGTCAACAGGG + Intronic
1184674340 22:46032298-46032320 CTGTGTGACTGGGCTGAGTGGGG + Intergenic
1185224145 22:49643531-49643553 CTGGGTAGCTGGGGTGAGCAGGG + Intronic
950530700 3:13550775-13550797 CTGTGTGATGGGGGTGAGCAGGG + Intronic
951326412 3:21307594-21307616 TTGTGTGAGTGTGGTGAAAAGGG + Intergenic
951859659 3:27237654-27237676 GGGTGGGAGTGGGGTGAGGAAGG + Intronic
952591678 3:34962769-34962791 CTATGTGACTGGTGTGGGCAGGG - Intergenic
954417817 3:50402640-50402662 CTGTGGGATGGGGCTGAGCAGGG - Intronic
955050074 3:55401791-55401813 CTGTGTTAGTCTGGAGAGCAGGG - Intergenic
956995933 3:74826008-74826030 GTGTGTGTGTGGTGTGAGCGTGG + Intergenic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
959924800 3:111909125-111909147 CTGGGACAGTGGGGTGGGCAGGG - Intronic
960995845 3:123339570-123339592 TTGTGAGAGTGGAGAGAGCACGG - Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961665736 3:128492400-128492422 CTGTGTGACTGGGGTGCGTGTGG - Intronic
962429804 3:135308545-135308567 CTGTGTGTCTGGGATGAGAATGG - Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963603755 3:147397408-147397430 CTGTGGGGGTGGGGTGAGGGAGG - Intronic
963973281 3:151453001-151453023 CTGTGTGCCTGGGATGGGCAGGG + Intronic
964729436 3:159849627-159849649 CAGAGTGAGTGGGGTCTGCAGGG + Intronic
966537489 3:181050928-181050950 TTGTGTGAGAGGAGGGAGCAGGG + Intergenic
966568196 3:181407581-181407603 CTGTGTGAGTTTGCTGAGAATGG - Intergenic
966854997 3:184187758-184187780 CTCTGTGAGTGGGGGAAGCATGG + Exonic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
966930687 3:184673585-184673607 CTTTGGAAGTGGGGTGAGAAAGG + Intronic
967388099 3:188929816-188929838 CTGTGAGTGTGGGGGTAGCACGG - Intergenic
968234690 3:197024564-197024586 CTGTGGGAGAGGTGTGTGCACGG + Intronic
969495130 4:7522198-7522220 AAGTGGGAGTGGGGCGAGCAGGG + Intronic
969515733 4:7647196-7647218 CCGTGGGAGTGGGGTTAGCCAGG + Intronic
969571371 4:8010683-8010705 CTCTGTGAGTGGGGAGAGCAGGG - Intronic
969611400 4:8229465-8229487 GGGTGTGATGGGGGTGAGCAGGG + Intronic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
971027242 4:22600347-22600369 GTGTGTGTGTGGTGTGAGCGTGG + Intergenic
971866308 4:32176943-32176965 CTGTGTGAGTTGGTAGAGTATGG + Intergenic
971976198 4:33691305-33691327 CTGAGTCAGTGGGCTGAGAAAGG + Intergenic
972076926 4:35101503-35101525 GTGAGTGTGTGGTGTGAGCATGG + Intergenic
973553029 4:52054002-52054024 CTGCTGGAGTGGGCTGAGCAAGG - Intronic
974912362 4:68138017-68138039 ATGTGTGGGAGGGGTGAGGAAGG + Intergenic
974949907 4:68575571-68575593 GTGTGTGTGTGCTGTGAGCATGG - Intronic
974987897 4:69051957-69051979 GTGTGTGTGTGGTGTGAGCGTGG + Intronic
976260195 4:83138132-83138154 GTGTGAGAGTGTGGAGAGCAGGG + Intergenic
977043830 4:92045229-92045251 GTGTGTGTGTGGTGTGAGCGTGG - Intergenic
978679602 4:111363653-111363675 CTGGGTGTGTGGGATTAGCATGG + Intergenic
978923591 4:114216721-114216743 TGGTGTGAGTTGAGTGAGCAAGG + Intergenic
979546286 4:121944116-121944138 CTGTGTTAGTGGGCTGTGCTGGG - Intronic
981519932 4:145650793-145650815 CTGTGAGAGTGAGGAGAGGATGG + Intronic
981604406 4:146526862-146526884 GTGTGTGTGTGGTGTGAGCGTGG + Intergenic
981993455 4:150952645-150952667 CTCTGTGCGTGGGGTGGGCGGGG + Intronic
982320600 4:154073011-154073033 TTGTAAGAGTGGGGTGAGAAAGG + Intergenic
982662873 4:158227972-158227994 GTGTGTGTGTGGTGTGAGCATGG - Intronic
983957038 4:173710080-173710102 CTGTGTGCCTGGAATGAGCAAGG + Intergenic
985360741 4:189172799-189172821 CTGTGAGACAGGGGTGATCACGG + Intergenic
985546698 5:513526-513548 CTGTGCCACTGGGGTGTGCAGGG + Intronic
986370482 5:7075293-7075315 GTGTGTGTGTGTGGTGAGCAAGG - Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
986806386 5:11312186-11312208 GTGTGTATGTGGGGTGAGTATGG - Intronic
987930739 5:24397061-24397083 GTGTGCGTGTGGTGTGAGCATGG - Intergenic
990442908 5:55864607-55864629 CTGTGTGTGTGTGGTGTGTATGG - Intronic
990820490 5:59834265-59834287 AGGTGGGAGTGGGGGGAGCATGG - Intronic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992989759 5:82272631-82272653 GTGTGTGTGTGGTGTGAGCGTGG - Intronic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
994132516 5:96246565-96246587 CTGTGCCAGTGGAGTGAGAAAGG - Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996411224 5:123161665-123161687 CTGAGTGAGTGAGGTGAAGAGGG + Intronic
997859109 5:137400493-137400515 CTGACTGGGTGGGGTGAACAGGG - Intronic
998588195 5:143450153-143450175 CTGTATCAGTGGGGTGAGGGTGG + Intergenic
998805703 5:145915974-145915996 CTGTGTCAGCTGGGTGTGCATGG - Intergenic
999133182 5:149299885-149299907 CTGTGTGTGTGTGGAGGGCAGGG - Intronic
999909000 5:156176153-156176175 TTGTGTGCGTGTGGTGATCATGG + Intronic
1000236588 5:159367147-159367169 GTGTGTGTGTGGTGTGAGTATGG + Intergenic
1001487503 5:172130013-172130035 CTGGGTGAGAGGGGAGAGGATGG - Intronic
1001586532 5:172836661-172836683 CTGTGGCAGAGGGCTGAGCATGG - Intronic
1002073937 5:176697051-176697073 CTGTGTGGTGGGAGTGAGCATGG - Intergenic
1002172946 5:177385567-177385589 GTGTGTGTGTGTGGTGAGGATGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002999366 6:2317122-2317144 GTGTGCGTGTGGTGTGAGCATGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003843167 6:10143578-10143600 CTGTGCACGTGGGGTGGGCAGGG + Intronic
1004413170 6:15400471-15400493 CTGTGGGGGTGGGGTGTGCTTGG + Intronic
1004891724 6:20107387-20107409 ATGTGTGAGCGCGGTGGGCAAGG - Intronic
1005891630 6:30145068-30145090 GTGTGTGTGAGGGGTCAGCAAGG - Intronic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006674793 6:35754730-35754752 CTAACTGAGTGGGGTGTGCAGGG + Intergenic
1007069142 6:39022459-39022481 CTGATTGAGTGGGCTGAGAAGGG - Intronic
1007110235 6:39309454-39309476 CTGTGTGTGTGGGGTGGGGCAGG + Intronic
1007751154 6:44072824-44072846 CTTTGTCAGTGGTGTGGGCAGGG + Intergenic
1008115955 6:47550545-47550567 TTGTGTGAATGTGGTGAACAGGG + Intronic
1010317676 6:74469242-74469264 GTGTGTGTGTTGTGTGAGCATGG + Intergenic
1010323868 6:74542940-74542962 TTGAGTGAGTGGGCTGAGAAAGG + Intergenic
1011154721 6:84317527-84317549 GTGTGTGTGTGGGTGGAGCAGGG + Intergenic
1011236000 6:85217793-85217815 CTGTCTGAGGGTGGAGAGCAAGG + Intergenic
1011991584 6:93526338-93526360 CTGTGTGTGTGGTGTGATCTTGG + Intergenic
1015171714 6:130261586-130261608 GTGTGTGTGTGGTGTGAGCGTGG + Intronic
1015491889 6:133836324-133836346 GTGTGTGAGTATGGTGGGCAAGG - Intergenic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1016177599 6:141099313-141099335 CTGTGGGGGTGGGGTGCGCATGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1017954994 6:159169853-159169875 CTGTGTGGGTGGCGGGAGCGGGG + Intronic
1017983677 6:159424285-159424307 CTGTGTGAGTTGAGTGACCAGGG - Intergenic
1018059046 6:160075975-160075997 CTGTAAGAGAGGTGTGAGCATGG + Exonic
1018123824 6:160662644-160662666 CTGTGTGTGTAGGGAGTGCAGGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018659509 6:166073278-166073300 CTGCGTGAGTGGGAGCAGCAGGG - Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018832728 6:167457379-167457401 GTGTGAGAGTGGAGAGAGCAGGG - Intergenic
1018885192 6:167929511-167929533 CTGTGTGAGTGACCTGAGGAGGG - Intronic
1018902146 6:168057031-168057053 ATGTGGAAGTGGGGTGGGCAGGG + Exonic
1023344765 7:39260016-39260038 TTGTATGTGTGGTGTGAGCATGG - Intronic
1023344771 7:39260101-39260123 TTGTGTGTGTGGTGTGAGCATGG - Intronic
1023344789 7:39260296-39260318 TTGTGTGTGTGGTGTGAACATGG - Intronic
1023344795 7:39260381-39260403 CTGTGTGTGTGGTGTGAGCAAGG - Intronic
1027469448 7:78554904-78554926 CGGTGTGAGGGGTGTGAGAATGG + Intronic
1029736261 7:102467566-102467588 CTGTGGGAGTGGGGTGAGTCAGG + Intronic
1031269709 7:119633082-119633104 CTTTCTGTGTGGGGTGAGGAGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1034575427 7:151992904-151992926 GCGTGTGCGTGGGGTGAGAAGGG - Intronic
1034964125 7:155381379-155381401 CTGGGAGAGGGGGGTGGGCAGGG - Intergenic
1035404170 7:158587539-158587561 CTGGGTGAGTGGGGGGCGCCGGG - Exonic
1035631521 8:1110446-1110468 CTGGGTCTGTGGGGTGTGCATGG + Intergenic
1035924006 8:3708080-3708102 TGGTGTGTGTGGGGTGTGCAAGG + Intronic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1039058674 8:33556459-33556481 CTGTGTGTGTGTGGTGGGCAGGG + Intronic
1039877096 8:41596244-41596266 GTGTGTGTGTGGGGTGAGCGTGG - Intronic
1040008553 8:42641678-42641700 CTGTTAGAATGGAGTGAGCATGG - Intergenic
1040739564 8:50557014-50557036 CTGTCTGAGTGGTGTGAGATGGG - Intronic
1040750118 8:50695188-50695210 GTGTGTGAGTGGGGGGATCTTGG - Intronic
1041207202 8:55511173-55511195 CTGTGTGTCTGGGGTGGGAAGGG - Intronic
1041226667 8:55707051-55707073 GTGTGTGTGTGGTGTGAGCATGG + Intronic
1041276604 8:56166363-56166385 CTGTGTTTGTGGGGGGAGCTGGG + Exonic
1042191516 8:66192186-66192208 CTGAGTGAGTGAGGTGAGCCTGG + Intergenic
1042484293 8:69333968-69333990 GTGTGTGTGTGCAGTGAGCATGG - Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1045337635 8:101223464-101223486 GTGTGTGGGAGGCGTGAGCAAGG + Intergenic
1045584914 8:103523406-103523428 CTGTGTGTGTGTGGTGAGTTAGG + Intronic
1045785435 8:105915839-105915861 CTGTGTAAGGAGGGTGAGAAGGG - Intergenic
1046739821 8:117816006-117816028 GTGTGTGTGTGGGGTGGGGAGGG + Intronic
1047498112 8:125422749-125422771 CTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1048960739 8:139574672-139574694 CTGGGTCAGTGGGGTGAGCCAGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049441309 8:142611003-142611025 CTGTGTGCTTGGGCTGGGCAGGG - Intergenic
1049573091 8:143378642-143378664 GTGTGTGAGTGGGGTGGGCCAGG + Intronic
1049714505 8:144083504-144083526 CTGGGGGAGTGGGGTGTGCCTGG + Intronic
1049728295 8:144161721-144161743 CTGTTTGAGTTGGGTGAGCGTGG + Intronic
1049753067 8:144294787-144294809 CTGTGTGGGTGGGGTGCTCATGG - Intronic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1051811010 9:21049485-21049507 GTGTGTGTGTGGTGTTAGCATGG + Intergenic
1053163422 9:35829065-35829087 CTCTGTGCTTGGGGTGAGAAAGG + Intronic
1053412850 9:37926898-37926920 CTGTGTGAGTGGGATCTGCCTGG - Intronic
1057092981 9:92276822-92276844 GTGTGGGAGTGGGGACAGCAGGG + Intronic
1057894069 9:98892448-98892470 ATGTGTGAGTGGTGTGAGGTAGG + Intergenic
1060008724 9:120024676-120024698 CTTGGTGACTGGGGTGAGGATGG - Intergenic
1060105524 9:120870424-120870446 CTGGGTGAGTGGAGCGAGCAGGG - Exonic
1060420728 9:123467858-123467880 GTGTGTGAGTGAGGTGGACAGGG - Intronic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060885697 9:127150495-127150517 CTGTGTGGGTGGGGTGAGGGGGG - Intronic
1061396221 9:130345017-130345039 GTGTGTGTGTGGTGTGTGCATGG + Intronic
1062038625 9:134393881-134393903 CTGTATGAGTGGGCTGTGCAAGG + Intronic
1185605269 X:1365276-1365298 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605290 X:1365339-1365361 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605292 X:1365348-1365370 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605307 X:1365393-1365415 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605310 X:1365402-1365424 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605313 X:1365411-1365433 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605322 X:1365438-1365460 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605330 X:1365465-1365487 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605349 X:1365519-1365541 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605363 X:1365564-1365586 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605373 X:1365591-1365613 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605375 X:1365600-1365622 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605433 X:1365771-1365793 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605435 X:1365780-1365802 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605459 X:1365843-1365865 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605483 X:1365915-1365937 CCGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605507 X:1365992-1366014 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605662 X:1366460-1366482 CGGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605664 X:1366469-1366491 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605700 X:1366568-1366590 CCGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605721 X:1366638-1366660 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605855 X:1367052-1367074 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605864 X:1367079-1367101 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605904 X:1367196-1367218 CCGGGTGAGCGGGGTGAGCGGGG + Intronic
1185605906 X:1367205-1367227 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185605948 X:1367331-1367353 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1185606027 X:1367574-1367596 CGGGGTGAGCGGGGTGAGCCGGG + Intronic
1186558808 X:10589044-10589066 GTGTGCGTGTGGTGTGAGCATGG - Intronic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190163811 X:48054956-48054978 CTGTGGATGTGGGGTGGGCAGGG - Intronic
1190426413 X:50337732-50337754 GTGTGCGTGTGGTGTGAGCATGG - Intronic
1190511965 X:51182459-51182481 GTGAGTGAGTGGTGTGGGCAAGG + Intergenic
1191639036 X:63410246-63410268 GTGTGCGTGTGGTGTGAGCATGG + Intergenic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1194723200 X:97364549-97364571 CTGAGTAAGTGAGCTGAGCATGG - Intronic
1195227196 X:102809320-102809342 TTGTGGGAGTGTGTTGAGCAAGG - Intergenic
1195227753 X:102815679-102815701 CTGTGTGCGTGGGGTGTGTGGGG + Intergenic
1197160388 X:123316566-123316588 CTGTATGAGTGTTGTCAGCACGG + Intronic
1197335086 X:125203366-125203388 CTGGGTGCTTGGGGTGAGGATGG - Intergenic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1198213345 X:134535121-134535143 CAGTATGAGTGGGGTGGTCAAGG + Intergenic
1199807714 X:151317237-151317259 CTATGAAAGTGGGGTGAGGATGG + Intergenic
1200043922 X:153389718-153389740 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200044119 X:153391921-153391943 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200044128 X:153392020-153392042 GTGTGCGAGTGTGGTGTGCATGG - Intergenic
1200084248 X:153595571-153595593 CTGTGGGTGTGGCGTGGGCATGG - Intronic
1201423230 Y:13821735-13821757 TTGTCTGAGTGGGGTGAACATGG + Intergenic
1201896274 Y:18996179-18996201 CTGTGTCCGTGGTGTGAGCCAGG - Intergenic