ID: 922585787

View in Genome Browser
Species Human (GRCh38)
Location 1:226734225-226734247
Sequence CAAAATCGCCCCAATCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922585787_922585790 29 Left 922585787 1:226734225-226734247 CCAGGCTGATTGGGGCGATTTTG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 922585790 1:226734277-226734299 AAAAGCAGAGTTTCATGAAAAGG 0: 1
1: 0
2: 4
3: 51
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922585787 Original CRISPR CAAAATCGCCCCAATCAGCC TGG (reversed) Intronic
901886503 1:12227150-12227172 CAAAACCCCCCAAATCAGCTGGG + Intergenic
902948187 1:19859166-19859188 CAAAATAGCCCCAATGGGCTTGG + Intergenic
914378140 1:147091580-147091602 CAAAATCTCACCAATCAGCTGGG + Intergenic
918814947 1:189170173-189170195 CATAATAGCCCTAATCAGTCAGG - Intergenic
919247268 1:195004435-195004457 TGAAATCGCACCACTCAGCCTGG + Intergenic
919528029 1:198679169-198679191 CATAGTCGTCCCACTCAGCCTGG + Intronic
921384208 1:214552474-214552496 CAGAATCGCCCCACCCTGCCTGG + Intergenic
922585787 1:226734225-226734247 CAAAATCGCCCCAATCAGCCTGG - Intronic
1068882628 10:62066420-62066442 CAAAATGGCCCAATTCATCCAGG + Intronic
1071605108 10:86980489-86980511 CCAAATCACCCCAATCAACAGGG + Intronic
1082383014 11:51972037-51972059 CAAAACTGCTCCAATCAGACAGG - Intergenic
1082614842 11:55347200-55347222 CAAAATCTCCCCAACACGCCTGG + Intergenic
1082778725 11:57269528-57269550 CAGAATCATCCCACTCAGCCTGG + Intergenic
1088605192 11:111523033-111523055 CAACATCGCGCCATTTAGCCTGG + Intronic
1091856129 12:3741861-3741883 CCAATTAGGCCCAATCAGCCTGG + Intronic
1094665042 12:32511596-32511618 AAAAATCACACCAATCAGGCCGG - Intronic
1096276052 12:50209117-50209139 AAAAATAGACCCAATCAGGCCGG - Intronic
1096909546 12:54968604-54968626 CAAAACAGCCACAATGAGCCAGG - Intronic
1098855333 12:75646468-75646490 CAAATTCTCCACAATCAGTCAGG + Intergenic
1099973416 12:89523899-89523921 GAAAGTGGCCCCAATCAGACGGG + Exonic
1099979062 12:89577825-89577847 CAAAATCAGCCCAATCAACATGG - Intergenic
1104643074 12:130479741-130479763 CAAGGTGGCCCCCATCAGCCAGG + Intronic
1105589599 13:21779069-21779091 AAAAATGGCCCCAATAGGCCGGG - Intergenic
1107201342 13:37722249-37722271 CCACATCAGCCCAATCAGCCTGG + Intronic
1115603850 14:34981072-34981094 CAAAATCGCTCGAATCAGGGAGG + Intergenic
1117032036 14:51682897-51682919 CTACATCACCCCCATCAGCCAGG + Intronic
1117523977 14:56579452-56579474 CAAAAGGGCCACGATCAGCCAGG - Intronic
1123801495 15:23825866-23825888 AAAAATTGCCCCTATCAGCTAGG + Intergenic
1124032338 15:26022989-26023011 CAAAATCACACCACTCTGCCTGG - Intergenic
1126166922 15:45661254-45661276 CCCAATCACCCCAATCACCCAGG - Intronic
1126564231 15:50077854-50077876 CACAATGGCCCCAGTCAGGCAGG - Intronic
1127403473 15:58615396-58615418 TAAAATAGGCCCATTCAGCCAGG - Intronic
1135335941 16:21600413-21600435 AAATGTCACCCCAATCAGCCTGG - Intronic
1136682276 16:31975375-31975397 CAAAAGCTCCCCCATCAGCTGGG - Intergenic
1136782533 16:32916543-32916565 CAAAAGCTCCCCCATCAGCTGGG - Intergenic
1136887261 16:33937307-33937329 CAAAAGCTCCCCCATCAGCTGGG + Intergenic
1139763772 16:69209298-69209320 CAAAATCTTCCCAAACAGCATGG - Intronic
1142141342 16:88474133-88474155 CAATCTCTCCCCTATCAGCCGGG + Intronic
1203085192 16_KI270728v1_random:1180531-1180553 CAAAAGCTCCCCCATCAGCTGGG - Intergenic
1147142794 17:38468713-38468735 CAAAAGCTCCCCCATCAGCTGGG - Intronic
1148483660 17:47976708-47976730 CAAAGTCGCCCCAGTCAATCTGG - Exonic
1155290117 18:24332078-24332100 TAAAATGGCCCCAAGCGGCCAGG + Intronic
1167042929 19:47033227-47033249 AAAAATAGCCCTCATCAGCCAGG - Intronic
926611502 2:14952594-14952616 GAAAAACGCCCCAAACAGGCTGG - Intergenic
933712976 2:85341310-85341332 CATAGTCGTCCCACTCAGCCTGG + Intergenic
937193766 2:120131575-120131597 CAAAATAACCCCAGTCTGCCAGG - Intronic
937233492 2:120416283-120416305 CACAATCGCTCCCAGCAGCCAGG - Intergenic
940642541 2:156361411-156361433 GAAAAAAGCCCCAATGAGCCAGG - Intergenic
944875499 2:203960718-203960740 CAAAATGGTCCCCATCAGCCTGG + Exonic
948768393 2:240234968-240234990 CCAAATCCCCCAAATCACCCTGG + Intergenic
1169928061 20:10803503-10803525 CAAACTCACCCTAAGCAGCCAGG + Intergenic
1175997127 20:62816940-62816962 CACAAGCCCCCCATTCAGCCGGG - Intronic
1179595720 21:42441688-42441710 CAAGTTCTCCCCAATCAACCAGG - Intronic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1182258356 22:29054351-29054373 CAGAATCGTCCCCATCACCCTGG - Exonic
1182669039 22:31980576-31980598 CAGAATCTCCCTCATCAGCCTGG + Intergenic
1183198334 22:36368712-36368734 CTATATCGCCCTAAACAGCCAGG + Intronic
955364553 3:58299883-58299905 CAAAACCACCCCCATCACCCAGG - Intergenic
960878983 3:122326177-122326199 CAAAACCCCCCAAATCAGCCAGG - Intronic
962705333 3:138038088-138038110 CAAAATAGCCCCCATGAGACAGG + Intergenic
962917299 3:139916276-139916298 CATCTTCCCCCCAATCAGCCTGG + Intergenic
973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG + Intergenic
980911827 4:139000975-139000997 CAAAATTGCACCAATTTGCCCGG + Intergenic
985174691 4:187188567-187188589 CAAAGTGGCCCCGATCAGCAGGG - Intergenic
990978006 5:61575765-61575787 GAGAATCGCCACACTCAGCCAGG + Intergenic
1013235489 6:108194790-108194812 CATAAGCGCCACAATCAGCTGGG - Intergenic
1013535432 6:111059226-111059248 CAAAATGGACCCTATCGGCCAGG - Intergenic
1020112895 7:5457714-5457736 CCAAGTGGCCCCCATCAGCCAGG + Intronic
1022649259 7:32259750-32259772 CAAAATGGACCCAATTAGTCTGG + Intronic
1028153442 7:87402704-87402726 CAAAATAACCACTATCAGCCGGG + Intronic
1034390818 7:150786252-150786274 CAAAATGGCCCCTTTCTGCCGGG - Intergenic
1035765025 8:2098892-2098914 CAAAATCGCCGCCGTCAACCTGG + Exonic
1038766068 8:30428873-30428895 CAAAGTAGCCCCAATAAGCTGGG + Intronic
1041191969 8:55364011-55364033 CAAAATGGCACCACTCAGTCTGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1044591686 8:93918540-93918562 CAAAATCAGCCCAATCTGCCTGG + Intronic
1044776075 8:95689372-95689394 CAAAATTGCTCCAAACAACCAGG - Intergenic
1047235929 8:123042014-123042036 CAAACTCGGCCTCATCAGCCCGG - Exonic
1047491916 8:125382153-125382175 CAAAACAGCCCCACTGAGCCAGG + Intergenic
1050290625 9:4150468-4150490 CCAAATCACCACATTCAGCCTGG + Intronic
1052785283 9:32822572-32822594 AAAAATCACCACATTCAGCCTGG + Intergenic
1052938935 9:34116623-34116645 CAAGATGGCACCACTCAGCCTGG + Intronic
1055039490 9:71854080-71854102 CAAAAACCCCAAAATCAGCCAGG - Intergenic
1056815984 9:89801289-89801311 CAAAATGGCCCCAGTTAGACTGG - Intergenic
1057988192 9:99739551-99739573 CAAAACACCCTCAATCAGCCTGG + Intergenic
1058161084 9:101571343-101571365 CAAAATCTACCCAGTCACCCAGG - Exonic
1060708431 9:125831464-125831486 CGAGATCGCACCACTCAGCCTGG - Intronic
1061520068 9:131112536-131112558 CCACATCACCCCAATCGGCCTGG + Intronic
1198302305 X:135344464-135344486 CAAATTCTCCCCACACAGCCAGG + Intergenic