ID: 922585912

View in Genome Browser
Species Human (GRCh38)
Location 1:226735552-226735574
Sequence GTATGCAGGAAGGCTGAGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922585905_922585912 3 Left 922585905 1:226735526-226735548 CCACTCTAGGTTTCTGCTGGTCC 0: 1
1: 0
2: 0
3: 18
4: 175
Right 922585912 1:226735552-226735574 GTATGCAGGAAGGCTGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922585912 Original CRISPR GTATGCAGGAAGGCTGAGTT GGG Exonic
900981397 1:6048097-6048119 AGATGGTGGAAGGCTGAGTTTGG - Intronic
901297620 1:8172737-8172759 GCATTTAGGAAGGCTGAGGTGGG - Intergenic
901470514 1:9452834-9452856 ATATGCAAGGAGGCAGAGTTAGG - Intergenic
902325253 1:15695911-15695933 CTATTCAGGAGGGCTGAGGTAGG - Intronic
902520595 1:17013449-17013471 GGCAGCAGGAAGGCTGGGTTTGG + Intergenic
902755164 1:18544647-18544669 GAGGGCAGGAAGGCTGAGTAAGG - Intergenic
902810669 1:18886149-18886171 GGATTCTGGAAGGCTGAGTCAGG - Intronic
903007067 1:20305761-20305783 GTAGGCAGGGAGGGTGGGTTTGG + Intronic
903008840 1:20316322-20316344 GGATGCAGGGAGGCCGAGCTGGG + Intronic
904305326 1:29585223-29585245 GAGGGCAGGAAGGCCGAGTTGGG + Intergenic
904343316 1:29852182-29852204 GAGGGCAGGAAGGCCGAGTTGGG + Intergenic
906079189 1:43072735-43072757 GTATTCTGGGAGGCTGAGGTGGG + Intergenic
906399136 1:45491996-45492018 CTATCCGGGGAGGCTGAGTTGGG - Intergenic
906561321 1:46759496-46759518 CTACTCAGGAAGGCTGAGGTGGG + Intronic
907168338 1:52435796-52435818 GTATTCTGGGAGGCTGAGGTGGG + Intronic
907187807 1:52624257-52624279 GCATGCTGGGAGGCTGAGGTGGG + Intergenic
907330637 1:53669108-53669130 GTCTGCAGGAGCGCTGAGCTAGG - Intronic
907644315 1:56226540-56226562 GTGGGCAGGAAGGCAGAGTTAGG - Intergenic
908346276 1:63236771-63236793 GTATGGAGGAAAGTTGACTTGGG - Intergenic
910679291 1:89845681-89845703 GTATTTTGGAAGGCTGAGGTGGG - Intronic
911335169 1:96573430-96573452 CTAGGAAGGAAGGCTGAGTGGGG - Intergenic
912258456 1:108085081-108085103 GTCTCCAGGACAGCTGAGTTGGG - Intergenic
913486415 1:119335805-119335827 GAATGCAGGCAGCCTGACTTTGG - Intergenic
913942554 1:125121490-125121512 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
915248611 1:154572815-154572837 GTATGCAGAAAGCCTGAGGAAGG - Intronic
915415655 1:155740666-155740688 GCATGCTGGGAGGCTGAGGTGGG + Intergenic
916887085 1:169080048-169080070 GTAGGCTGGGAGGCTGAGGTGGG - Intergenic
917589520 1:176462140-176462162 GTATACAGGAAGGATGAGGGTGG - Intergenic
920064210 1:203254731-203254753 CTATGGAGGAAGGCTGAGAGAGG + Intronic
921421827 1:214957616-214957638 CTAAGCAGGAAGCCTGGGTTTGG - Intergenic
921550946 1:216535008-216535030 GGATGCATGGAGGCTGAGTGTGG + Intronic
922214862 1:223511885-223511907 GTCTGCAGGTTGGCTGGGTTCGG - Intergenic
922585912 1:226735552-226735574 GTATGCAGGAAGGCTGAGTTGGG + Exonic
923440100 1:234009578-234009600 TTATGCAGCAAAGCTGAGTAGGG - Intronic
923626914 1:235621539-235621561 GTATGCTGGGAGACTGAGGTGGG - Intronic
924580430 1:245318626-245318648 GAAAGCAGCAAGGATGAGTTCGG + Intronic
1063990240 10:11553646-11553668 GTACGTTGGAAGGCTGAGGTGGG + Intronic
1064392251 10:14952139-14952161 GTGTTTAGGATGGCTGAGTTTGG - Intronic
1065220402 10:23490786-23490808 GGAGTCAGCAAGGCTGAGTTTGG + Intergenic
1065307869 10:24385305-24385327 AAATGCAGGAAGGCTGAGCATGG + Intronic
1066781018 10:38944497-38944519 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1066953868 10:42147628-42147650 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1067192116 10:44080354-44080376 GTATAAATAAAGGCTGAGTTGGG - Intergenic
1072187841 10:93059804-93059826 GTACGCTGGAAGGCTGGGTAAGG - Intergenic
1072299829 10:94049008-94049030 GTATTCTGGAAGGCTGAGGCAGG - Intronic
1073784453 10:106873199-106873221 GTACTCAGGAAGGCTGAGGCAGG + Intronic
1074668493 10:115759143-115759165 GGATGCAGGAAGTCTGGGTTAGG + Intronic
1075372571 10:121950367-121950389 AAAGGCAGGAAGGCAGAGTTGGG + Intergenic
1075855525 10:125626291-125626313 GAAGGCAGGAAGGCTGAATGGGG - Intronic
1077296796 11:1830131-1830153 GTATGCATGAAAGGTGAGTGTGG + Intronic
1077835908 11:5928395-5928417 GAATCCAGGAATGCTGAGTCAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078174510 11:8959662-8959684 GAAAGCAGGAAGGTTGATTTTGG + Intronic
1078479466 11:11663462-11663484 CTAGGCAGGAAGGCTGAGGCAGG + Intergenic
1079171030 11:18095996-18096018 TTATGCTGGAAAGATGAGTTAGG + Intronic
1079505083 11:21144205-21144227 GTCTGCAGGAAGCCTCAGGTGGG + Intronic
1080921960 11:36718076-36718098 ATATGCAGGAGGGTTGAGTCTGG + Intergenic
1081200007 11:40204175-40204197 GTATTCTGGGAGGCTGAGGTGGG - Intronic
1082018069 11:47507344-47507366 GTATTCAGGAAGGTTGCTTTGGG - Intronic
1082880215 11:58029818-58029840 GGAGGCAGGAAGGCTGGGTTAGG - Intronic
1083725224 11:64624361-64624383 GGAAGAAGGAAGGCTGAGTGGGG - Intronic
1084326294 11:68402221-68402243 GTTAACAGGAAGGTTGAGTTAGG - Intronic
1084535625 11:69754807-69754829 CTACTCAGGAAGGCTGAGGTGGG - Intergenic
1084612064 11:70209565-70209587 GGTTGCAGGGAGGCTGAATTTGG - Intergenic
1087316339 11:96607685-96607707 GGATGCAGGATGCCAGAGTTAGG + Intergenic
1087707369 11:101509342-101509364 GTATGTTGGGAGGCTGAGGTGGG - Intronic
1090457844 11:126865277-126865299 GTCTGCAGGGAGGGTGAGCTTGG - Intronic
1094074037 12:26452697-26452719 TTATGCAGGAAGGCTGCTTCGGG + Intronic
1096439341 12:51626393-51626415 CTATGCAGGAAGGTCGTGTTGGG - Intronic
1096555841 12:52403213-52403235 CTGTGCAGGAAGCCAGAGTTGGG + Intronic
1097478630 12:60091989-60092011 GTGTGCAGGAGGGCTGAGTCAGG + Intergenic
1097615602 12:61880576-61880598 CTACGCAGGAGGGCTGAGCTCGG + Intronic
1098264538 12:68705596-68705618 GAAGGCAGGCAGGCTGAGCTAGG - Intronic
1099050494 12:77776732-77776754 ATATGCAGGGAGGCCGAGGTGGG + Intergenic
1100477647 12:94949014-94949036 GTTTAAAGGAAGGTTGAGTTGGG + Intronic
1102734205 12:115143678-115143700 GTATGCAAGAAAACTGAGTCTGG + Intergenic
1104368579 12:128200506-128200528 GTGTCCATGAAGGCTGAGTGGGG + Intergenic
1104415009 12:128590732-128590754 GCATGCAGGCAGGCTGAGGCTGG + Intronic
1104852190 12:131882292-131882314 GCATGCTGGGAGGCTGAGTTGGG - Intergenic
1106519779 13:30486522-30486544 GTATCCAGGAAGGCTGGGAGTGG + Intronic
1106831862 13:33592915-33592937 GAAGGCAGGAGGGCTGGGTTGGG + Intergenic
1108862762 13:54882432-54882454 GTGTGCAGGAGGGCTGAGTCAGG - Intergenic
1108862771 13:54882473-54882495 GTGTGCAAGAGGGCTGAGTTGGG - Intergenic
1109252719 13:60039592-60039614 AAATGAAGGAAGGCTGAGTACGG - Intronic
1109727039 13:66355095-66355117 GTATGCTGTTAGGCTGAATTGGG - Intronic
1111249891 13:85589248-85589270 GTGTGCAGGAGGGCTGAGTCGGG + Intergenic
1111249902 13:85589289-85589311 GTGTGCAGGAGGGCTGAGTGGGG + Intergenic
1112009785 13:95284296-95284318 TTACTCAGGAAGGCTGAGGTGGG - Intronic
1112009994 13:95285766-95285788 GAATGTAGGAAAGCTAAGTTAGG + Intronic
1112962528 13:105144267-105144289 GAATGAAGGAAGGAGGAGTTGGG - Intergenic
1113002213 13:105654214-105654236 ATATCCAGCCAGGCTGAGTTTGG + Intergenic
1113708822 13:112451051-112451073 TAATGCAGAAAGGCAGAGTTAGG - Intergenic
1113814098 13:113159690-113159712 GTGCGAAGGAAGGCTGAGCTGGG - Intronic
1115137316 14:30126773-30126795 GTCTGCAGGAAGGATGAGGAAGG - Intronic
1115330563 14:32192499-32192521 TTATACAGGAAGGCTGAGTTGGG - Intergenic
1115951658 14:38728285-38728307 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1118602739 14:67481975-67481997 GAATGCAGGAGGACAGAGTTTGG + Intronic
1119816646 14:77574959-77574981 GTGTTCTGGAAGGCTGAGTTAGG + Intronic
1120516839 14:85481043-85481065 TTAGCCAGAAAGGCTGAGTTGGG + Intergenic
1121031163 14:90659763-90659785 GTATGAAGGAAGGATGTGTGGGG + Intronic
1121197836 14:92090352-92090374 GCATGTAGGGAGGCTGAGGTGGG - Intronic
1121515696 14:94548487-94548509 GTAGGCAGGAAGCCTGGGGTGGG + Intergenic
1121676348 14:95756300-95756322 TGAAGCAGGCAGGCTGAGTTTGG - Intergenic
1122097373 14:99381597-99381619 CTCTGCAGGAAGGCTGACCTGGG + Intergenic
1123393569 15:19901234-19901256 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1123571174 15:21611155-21611177 CTACTCAGGAAGGCTGAGTCAGG + Intergenic
1123607286 15:22046518-22046540 CTACTCAGGAAGGCTGAGTCAGG + Intergenic
1124824386 15:33079373-33079395 GCACGCAGGAAGGCTGAGGGAGG + Intronic
1125640620 15:41227556-41227578 CTATTCAGGAAGGCTGAGGCAGG + Intronic
1130547003 15:84863988-84864010 GTATGCAGGCAGGGTCAGTGTGG + Intronic
1131192097 15:90325056-90325078 GGATTCTGGGAGGCTGAGTTGGG - Intergenic
1131670911 15:94618789-94618811 GTACTCTGGGAGGCTGAGTTGGG - Intergenic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1131950667 15:97678222-97678244 GTATTCTGTAAGGCAGAGTTGGG + Intergenic
1202979526 15_KI270727v1_random:338285-338307 CTACTCAGGAAGGCTGAGTCAGG + Intergenic
1132814012 16:1817407-1817429 GAATGCAGGGGGGCTGAGTCTGG - Intronic
1133617295 16:7489765-7489787 GTGCTCTGGAAGGCTGAGTTGGG - Intronic
1135052064 16:19201277-19201299 CCATGAAGGAAGCCTGAGTTGGG - Intronic
1136591122 16:31218296-31218318 GCATGCTGGGAGGCTGAGGTGGG + Intronic
1136695992 16:32082584-32082606 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1136771343 16:32844299-32844321 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1136796485 16:33025837-33025859 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1136899235 16:34017154-34017176 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1136902466 16:34053042-34053064 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1137083943 16:36099467-36099489 GTAAGCAGGTAGGCTGACTTCGG + Intergenic
1138139557 16:54556623-54556645 GTATCCAGGAAGGGTGGGTGGGG + Intergenic
1138645598 16:58422076-58422098 CTATTCAGAAAGGCTGAGGTAGG + Intergenic
1139488627 16:67273692-67273714 CTACTCAGGAAGGCTGAGGTGGG + Intergenic
1139488823 16:67275319-67275341 CTACTCAGGAAGGCTGAGGTGGG - Intergenic
1141394789 16:83694958-83694980 GCATTTAGGAAGGCTGAGGTGGG + Intronic
1203073768 16_KI270728v1_random:1106409-1106431 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1142821444 17:2471415-2471437 GCATGCTGGGAGGCTGAGGTGGG - Intronic
1143152038 17:4813298-4813320 ATATGCAGGAAGGCTGGGCAAGG - Intronic
1143239422 17:5431238-5431260 GCATTTAGGAAGGCTGAGGTGGG + Intronic
1144200118 17:12933487-12933509 GTAGGGAGGAAGGCAGGGTTTGG - Intronic
1145241295 17:21242258-21242280 GCACCCAGGAAGGCTGGGTTGGG + Exonic
1147159741 17:38563031-38563053 GTGTGCAGGCAGCCTGAGATGGG - Intronic
1147434334 17:40398348-40398370 GCATTTTGGAAGGCTGAGTTGGG - Intronic
1147754554 17:42760132-42760154 GGAAGCAGCAAGGCTGAGTCTGG - Intronic
1150743413 17:67797685-67797707 CTATTCAGGAAGGCTGAGGCAGG - Intergenic
1151070368 17:71203473-71203495 GTAAGCAGCAAGGCTGAGTTGGG + Intergenic
1151101121 17:71556397-71556419 GTATGTTGGGAGGCTGAGGTGGG + Intergenic
1151164257 17:72190704-72190726 GGAGGCTGGAAGGCTGAGGTGGG - Intergenic
1151461156 17:74254894-74254916 GGATTGAGGAAGGCTGTGTTTGG - Intronic
1153082673 18:1247006-1247028 GTGTGCAGGAGGGCTGAGTCGGG + Intergenic
1153082684 18:1247047-1247069 GTGTGAAGGAGGGCTGAGCTGGG + Intergenic
1154227622 18:12521662-12521684 GTTTGCAGCAACCCTGAGTTCGG + Intronic
1154517994 18:15195845-15195867 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1156884351 18:42117333-42117355 GTATTCAAGAAGGCTGTTTTAGG + Intergenic
1158195019 18:54875212-54875234 GCTACCAGGAAGGCTGAGTTGGG + Intronic
1158416660 18:57254877-57254899 GTCTGCAAGAAGGCTGGGGTGGG - Intergenic
1158463631 18:57669887-57669909 GCACGCTGGGAGGCTGAGTTGGG - Intronic
1158978559 18:62736257-62736279 TTATGCAGTAAGTCTGAGGTGGG - Intronic
1159082784 18:63754322-63754344 GAATGAATGAAGGCTGGGTTCGG + Intronic
1159138801 18:64368323-64368345 GTATGGATGAATGATGAGTTTGG + Intergenic
1159877702 18:73830318-73830340 GCATGCTGGAAGTCTGTGTTTGG + Intergenic
1160569487 18:79807134-79807156 AGATGCAGGCAGGCTGAGGTGGG - Intergenic
1161629586 19:5346052-5346074 GCCTGCAGGAAGGCTTAGCTTGG - Intergenic
1162481723 19:10930885-10930907 CTATTCAGGAAGGCTGAGATGGG + Intronic
1162561483 19:11420402-11420424 GTATTTTGGGAGGCTGAGTTGGG - Intergenic
1164976946 19:32580828-32580850 GGGCGCAGGAAGGCTGAGTGGGG - Intergenic
1166160075 19:40946103-40946125 TTATGCAGGGAGGCTGCTTTAGG + Intergenic
1166858934 19:45798426-45798448 GTATGTTGGGAGGCTGAGGTGGG + Intronic
924974666 2:161570-161592 GTGTGCAGGAAAGAGGAGTTGGG + Intergenic
927205742 2:20609283-20609305 GGATGCAGGAAGGCTGCTGTGGG - Intronic
928051234 2:27997906-27997928 GCATGCTGGGAGGCTGAGGTGGG + Intronic
929177609 2:38997273-38997295 GTAAACAGTAAGGCTGATTTTGG + Exonic
930458869 2:51643655-51643677 TTATGTAGGAAGGCTGCCTTAGG + Intergenic
932072561 2:68635790-68635812 GTATGAAGGAAGACTCAGATAGG - Intergenic
932102966 2:68917698-68917720 GAATCCAGGAAGGCTTAGCTGGG + Intergenic
932164392 2:69493045-69493067 GGATGCAGTAAGGCTGAGGCAGG + Intronic
933294203 2:80471195-80471217 GGAAGCAGGAAGACTGAGTAGGG + Intronic
934251281 2:90358113-90358135 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
934258279 2:91445287-91445309 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
934976903 2:98809152-98809174 GAATGCAGGGTGTCTGAGTTGGG + Intronic
935407291 2:102722350-102722372 GTATGGAGGAAGGCAGAGAGAGG + Intronic
937447633 2:121972233-121972255 GCAGGCAGGAAGGTTAAGTTTGG + Intergenic
937562531 2:123243593-123243615 GCATTCTGGAAGGCTGAGATGGG + Intergenic
938000920 2:127736185-127736207 GTCTGCCAGAAGGCTGATTTTGG + Intronic
938421664 2:131151827-131151849 GTGTGCAGGAAGGCCGAGCACGG + Intronic
940717044 2:157237853-157237875 GTATGAAAGTAGGCTGACTTAGG - Intergenic
940779234 2:157915728-157915750 GTTTGTAGGAAGGCTGATTGTGG - Intronic
942613887 2:177769774-177769796 CTATTCAGGGAGGCTGAGATGGG + Intronic
942619217 2:177829804-177829826 ATATGTAGGAAGCCAGAGTTGGG - Intronic
942626211 2:177903322-177903344 GGGTTGAGGAAGGCTGAGTTGGG - Intronic
943009747 2:182432958-182432980 GTAACAAGGAAGGCTGAGATTGG - Intronic
943606506 2:189983370-189983392 CTATGTAGGGAGGGTGAGTTGGG + Intronic
947323089 2:228944594-228944616 GCATTTTGGAAGGCTGAGTTGGG - Intronic
948648612 2:239424848-239424870 CCAGGCAGGAAGGCTGAGGTTGG - Intergenic
1169673397 20:8129568-8129590 GTCTGCAGGTTGGCTGAGTCTGG + Intergenic
1170008824 20:11698105-11698127 CTACTCAGGAAGGCTGAGGTAGG + Intergenic
1170706585 20:18749378-18749400 GTGTGGAGGAAAGCTGTGTTGGG + Intronic
1170746375 20:19102768-19102790 GTGTGCAGGTTGGCTGAGATGGG + Intergenic
1173696319 20:45017446-45017468 ATATGCAGGAAGGCTGGGGAAGG + Intronic
1173799474 20:45886102-45886124 CTACTCAGGAAGGCTGAGGTAGG + Intergenic
1175357905 20:58383443-58383465 GCATGCTGGGAGGCTGAGTCAGG + Intergenic
1176583620 21:8552422-8552444 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1176964682 21:15198702-15198724 CTGTTCAGGAAGGCTGAGTGAGG + Intergenic
1177052250 21:16250888-16250910 GTTTGCAGGAAGGTACAGTTGGG + Intergenic
1177311459 21:19400120-19400142 CTACTCAGGAAGGCTGAGGTAGG + Intergenic
1178085033 21:29103785-29103807 CTACTCAGGGAGGCTGAGTTGGG + Intronic
1180266430 22:10529355-10529377 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1180713743 22:17857713-17857735 GTCTGCAGCAAGGCGGAGCTGGG + Intronic
1181015173 22:20064442-20064464 GAATGCAGGCAGGTAGAGTTAGG - Intronic
1182242171 22:28924769-28924791 GTAGGCAAGAGGGCTGACTTTGG + Intronic
1182403794 22:30106255-30106277 GCATGTTGGGAGGCTGAGTTGGG - Intronic
1182593625 22:31400864-31400886 GCATGCTGGGAGGCTGAGATAGG + Intronic
1183261269 22:36797408-36797430 GTAGGCAGGAACTCTGTGTTTGG + Intergenic
1183838233 22:40475289-40475311 GCATGCTGGGAGGCTGAGGTGGG + Intronic
1184483509 22:44762189-44762211 GTGAGCCGGAAGGCTGAGATGGG + Intronic
1184516612 22:44966198-44966220 TTATGCTGGAAAGCTGGGTTGGG - Intronic
1203324710 22_KI270738v1_random:2999-3021 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
949869992 3:8580283-8580305 GTGTGCAGAAAGGCTGGGCTGGG - Intergenic
952342836 3:32459794-32459816 GTAGGGAGGAAGGCTGAGGGGGG + Intronic
952753161 3:36842017-36842039 ATGTGCAGGAATGCTGACTTTGG + Intronic
954370276 3:50166526-50166548 GGATGCAGTGAGGCTGGGTTAGG - Intronic
954837093 3:53479431-53479453 GGATGCTGGAAGGCTAGGTTAGG + Intergenic
955001954 3:54935309-54935331 GAATGCTGGAAGGCTGACATTGG - Intronic
955236001 3:57139757-57139779 TTTTGGAGGAAGGCTGAGGTGGG - Intronic
958784197 3:98579330-98579352 GCATGCAGTAAGGAGGAGTTGGG + Intronic
959696142 3:109250809-109250831 GTAGGCAGGAAGGCTAATGTCGG - Intergenic
960624171 3:119664271-119664293 GTATTCTGGGAGGCTGAGATGGG + Intronic
961138250 3:124532557-124532579 GCATGCTGGGAGGCTGAGGTGGG + Intronic
961365430 3:126396418-126396440 ATGGGCAGGAAGGCTGAGATGGG - Intronic
962272543 3:133988643-133988665 GGATGCAGGGAGGGAGAGTTCGG + Intronic
962411992 3:135149157-135149179 GTAAGCAGAAAGACTTAGTTTGG - Intronic
964467513 3:157012494-157012516 GTATGCTGGATGGCAGAGTGAGG - Intronic
965607105 3:170508466-170508488 GTAGGCAGGAAGGTTGGGGTGGG + Intronic
965824107 3:172713409-172713431 GGAAGAGGGAAGGCTGAGTTAGG - Intergenic
967093826 3:186160197-186160219 GTATGGAGGAAGGGTGGGTGTGG + Intronic
967997201 3:195175631-195175653 GGATCCAGGAAGGCAGAGTGCGG - Intronic
968773448 4:2523904-2523926 CTACTCAGGAAGGCTGAGGTGGG + Intronic
972291959 4:37697867-37697889 GTAAGCTGGGAGGCTGAGGTAGG - Intergenic
972477472 4:39464606-39464628 GTATTTAGGGAGGCTGAGATAGG - Intronic
974911968 4:68133308-68133330 GGTTCCAGGAAGGCTGATTTTGG - Intergenic
975582858 4:75922264-75922286 CTATGCAGGGAGGCTGAGGTGGG + Intronic
977106155 4:92887265-92887287 GTAATCAGGTACGCTGAGTTGGG - Intronic
977673357 4:99720952-99720974 GTATGAAAGAAGTCTGTGTTTGG - Intergenic
978412627 4:108441833-108441855 GTATGCTGGGAGGCTGAGGCAGG + Intergenic
979172853 4:117623658-117623680 GATTGCAGGATGGCTGAGTGAGG - Intergenic
981059478 4:140406168-140406190 TTATCCAGGAAGCCTGACTTGGG + Intronic
981701226 4:147609332-147609354 GTATGCTGGAAGGCAGAATGAGG - Intergenic
985043444 4:185916176-185916198 GGATGCAAGAAGACTGAATTAGG + Intronic
987604153 5:20111299-20111321 GTATGAAGAAAGGCTCAGTAGGG + Intronic
988420076 5:30994883-30994905 ATATGCAGGCATGCTTAGTTGGG + Intergenic
989134844 5:38143581-38143603 GTATGGAGGAATGATGAGTAGGG - Intergenic
990018863 5:51100954-51100976 GTGTGCAGGAGGGCTGAGTCGGG - Intergenic
991554724 5:67882660-67882682 GTATTCAGGGAGGCTGAAGTGGG + Intergenic
992205883 5:74429947-74429969 GCATTCTGGAAGGCCGAGTTGGG - Intergenic
994571479 5:101520391-101520413 GTATCAGGGAAGGCTGAGGTTGG - Intergenic
995042339 5:107603174-107603196 GTGTCCAGGAAGGAGGAGTTCGG - Intronic
995183912 5:109252510-109252532 GTGTGCAGCAAGGCAGAGCTGGG - Intergenic
995235168 5:109820692-109820714 TTACTCAGGAAGGCTGAGGTGGG + Intronic
996869539 5:128172712-128172734 GCATGCTGGGAGGCTGAGGTGGG + Intronic
997158467 5:131582088-131582110 GGATGCAGGTAGGCTGAGTCTGG - Intronic
998248566 5:140532848-140532870 CTGTGCTGGGAGGCTGAGTTGGG + Intronic
998703986 5:144737911-144737933 GTGTCCAGGAAGGGTGAGGTTGG + Intergenic
1000150527 5:158496274-158496296 GAATGCAGGAAAGCACAGTTTGG - Intergenic
1002318688 5:178362247-178362269 GAATGGAGGGAGGCTGAGTTTGG + Intronic
1003520961 6:6857711-6857733 GTATGAAGGCAGGGTGAGGTTGG + Intergenic
1003566051 6:7223143-7223165 CTATGAAGGGAGGCTGAGGTGGG + Intronic
1004023039 6:11791515-11791537 GTGTGCAGAAGGGCTGAGTCGGG - Intronic
1004317042 6:14598721-14598743 GAATGCAGGAAGCCTGAATAAGG - Intergenic
1004980525 6:21018313-21018335 GTATGCAGTCAGGCTTTGTTTGG + Intronic
1006431326 6:33998737-33998759 GCATGTTGGGAGGCTGAGTTAGG - Intergenic
1007720422 6:43882011-43882033 GTATCTAGGAAGGGTGAGCTGGG - Intergenic
1010428630 6:75753184-75753206 CAAGGTAGGAAGGCTGAGTTGGG + Intronic
1010554487 6:77262198-77262220 GCATTCTGGGAGGCTGAGTTGGG - Intergenic
1010860153 6:80900234-80900256 TTATGGAGGAAAACTGAGTTTGG - Intergenic
1011644774 6:89447141-89447163 CTATTCGGGAAGGCTGAGGTGGG + Intronic
1012615713 6:101277377-101277399 GTATTTAGGGAAGCTGAGTTTGG + Intergenic
1013521568 6:110938366-110938388 GTATGTTGGGAGGCTGAGGTGGG - Intergenic
1017616301 6:156250189-156250211 GAATCCAGCAAGGCGGAGTTGGG - Intergenic
1017992102 6:159499670-159499692 GCATTTTGGAAGGCTGAGTTGGG - Intergenic
1018845444 6:167552229-167552251 GTGTGCATGAAGGCTGAGAAAGG - Intergenic
1019447470 7:1078878-1078900 GTTTGGGGGAAGGCTGAGCTGGG - Intronic
1019533748 7:1516924-1516946 TTAAGCAGGAAGGCTGAGGCGGG - Intergenic
1019683237 7:2365061-2365083 CTACTCAGGAAGGCTGAGGTGGG - Intronic
1019765548 7:2847268-2847290 GTATGGTGGGAGGCTGAGGTGGG + Intergenic
1019986153 7:4657369-4657391 CTACTCAGGGAGGCTGAGTTAGG - Intergenic
1021037626 7:15820035-15820057 GTCTGGAGGCAGGCTGACTTAGG - Intergenic
1021669470 7:23020809-23020831 GGATGAAGGGAGGGTGAGTTTGG + Intergenic
1022724026 7:32964821-32964843 GAAAGCAGGGAGGCAGAGTTTGG - Intronic
1022834287 7:34098854-34098876 GACTGCAGGACAGCTGAGTTTGG + Intronic
1022921470 7:35020019-35020041 CTACTCAGGAAGGCTGAGCTGGG + Intronic
1023111222 7:36812809-36812831 GTATAGAGAAAGGCTGAGGTTGG - Intergenic
1025049586 7:55723094-55723116 GAAAGCAGGGAGGCAGAGTTTGG + Intergenic
1025478965 7:60958942-60958964 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1025482180 7:60994589-60994611 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1025553091 7:62273757-62273779 GCAAGCAGGTAGGCTGACTTCGG + Intergenic
1025562303 7:62382682-62382704 GGAAGCAGGTAGGCTGACTTCGG - Intergenic
1025840691 7:65143098-65143120 GCAAGCAGGCAGGCTGACTTCGG - Intergenic
1025875294 7:65476031-65476053 GTGTGCAGGAGGGCTGAGTTGGG - Intergenic
1025878020 7:65507065-65507087 GCAAGCAGGCAGGCTGACTTCGG + Intergenic
1025882357 7:65552859-65552881 GCAAGCAGGCAGGCTGACTTCGG + Intergenic
1025891085 7:65649743-65649765 GCAAGCAGGCAGGCTGACTTCGG - Intergenic
1031517533 7:122719320-122719342 GCAGGGAGGAAGGCTGTGTTGGG - Intronic
1032077168 7:128841425-128841447 GGAGGGAAGAAGGCTGAGTTGGG - Intronic
1032250136 7:130249199-130249221 CTACTCAGGAAGGCTGAGGTAGG - Intergenic
1032535223 7:132657415-132657437 GCATGGAGGAGGGCTGAGTCAGG + Intronic
1032743703 7:134765068-134765090 GTATTTTGGAAGGCTGAGGTGGG + Intronic
1033172149 7:139093726-139093748 GGATGCAGGCGGGCTGAGTCCGG - Intronic
1035045159 7:155960738-155960760 GTATGCAGGAATTCATAGTTGGG + Intergenic
1035633247 8:1124825-1124847 GTCTGCAGGATGGCTGAGTGGGG + Intergenic
1036246228 8:7119366-7119388 CTACTCAGGAAGGCTGAGGTGGG - Intergenic
1036254571 8:7195051-7195073 CTATTCAGGAGGGCTGAGGTGGG + Intergenic
1036362922 8:8092437-8092459 CTATTCAGGAGGGCTGAGGTGGG - Intergenic
1036752726 8:11453608-11453630 GGAGCCAGGAAGGCTGAGCTGGG + Intronic
1037226327 8:16595717-16595739 GTTACCAGGAAGGCTGAGGTGGG + Intergenic
1037298237 8:17423800-17423822 GTATTTTGGAAGGCTGAGGTGGG + Intergenic
1038409107 8:27344406-27344428 GCATGCAGGAAAGCTGAGGATGG - Intronic
1039107185 8:34002781-34002803 GTATTCAGGAAGGCTGAGGCAGG - Intergenic
1039416840 8:37402394-37402416 GAATGCAGCAAGGCTGTGGTAGG - Intergenic
1039842355 8:41303187-41303209 GCATGCAGGGAGGCTGATTTGGG - Intronic
1041103728 8:54421353-54421375 CTATTCAGGAAGGCTGAGGAAGG + Intergenic
1043560846 8:81491516-81491538 CTATTCAGGGAGGCTGAGATGGG - Intergenic
1043766392 8:84138971-84138993 AGATGTAGGAAGTCTGAGTTGGG + Intergenic
1044887915 8:96799271-96799293 GTATGCAGGAAGGCTATTTTAGG - Intronic
1046562836 8:115861655-115861677 GTATGCAGGACAGCTGAGAGAGG + Intergenic
1048722086 8:137336816-137336838 CTACTCAGGAAGGCTGAGTCAGG + Intergenic
1049140765 8:140951634-140951656 GCATTCTGGAAGGCTGAGGTGGG + Intronic
1050063793 9:1737740-1737762 GAATGCAGGAAGGCAGGGCTGGG + Intergenic
1050515124 9:6435370-6435392 GCACTCAGGAAGGCTGAGGTGGG - Intronic
1053087071 9:35234364-35234386 GTATGTTGGGAGGCTGAGGTGGG - Intronic
1053130317 9:35610840-35610862 TTAGGCAGGCAGGGTGAGTTAGG - Intronic
1053309583 9:37008342-37008364 GTATACATGGAGGCTGAGTGCGG - Intronic
1055988148 9:82074772-82074794 GTATGCGGGAAGACTGTGTAAGG + Intergenic
1056216923 9:84414075-84414097 GCATTCTGGAAGGCTGAGGTGGG - Intergenic
1056486907 9:87067918-87067940 GTAAGCAGGAAGTCTGAGTAAGG + Intergenic
1057943693 9:99306413-99306435 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1058040905 9:100300679-100300701 CTATGGAGGAAGACTGTGTTCGG + Exonic
1059216799 9:112572159-112572181 GTATACAGGGTGGCTGGGTTTGG + Intronic
1059508937 9:114825955-114825977 GCATGTAGGATTGCTGAGTTTGG + Intergenic
1059672155 9:116501912-116501934 GTATGGAGGAGAACTGAGTTTGG - Intronic
1060188122 9:121576133-121576155 CTGTGCACGAAGGATGAGTTGGG - Intronic
1060362883 9:122977413-122977435 GGATGCAGGAGGGCTGGGTTCGG + Intronic
1061564469 9:131428773-131428795 CTACTCAGGAAGGCTGAGGTGGG - Intronic
1061683180 9:132254037-132254059 GTGTGCAGGAAGGCTTATGTTGG + Intergenic
1062211932 9:135369597-135369619 GTATGCATGAATGCTGACTCAGG - Intergenic
1203613578 Un_KI270749v1:30194-30216 GCAAGCAGGTAGGCTGACTTCGG - Intergenic
1186491953 X:9980587-9980609 GTTTTCAGTAAGTCTGAGTTGGG + Intergenic
1188217200 X:27493127-27493149 GTACTCAGGGAGGCTGAGGTGGG + Intergenic
1189405473 X:40718725-40718747 GTACTCAGGGAGGCTGAGGTGGG + Intronic
1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG + Intergenic
1192358831 X:70425883-70425905 GCAGGAAGGAAGGCTGAGGTGGG - Intronic
1192555659 X:72087011-72087033 CTATGAAGGAAGGCTGGGCTGGG + Intergenic
1193222455 X:78942608-78942630 CTGTGGAGGAAGGCTGAGTTTGG - Intergenic
1193963364 X:87952322-87952344 CTCTGCAGGAAGGTGGAGTTGGG - Intergenic
1194983273 X:100462089-100462111 GTTTGGATGAAGGATGAGTTGGG - Intergenic
1196355023 X:114781238-114781260 GCATGTTGGAAGGCTGAGGTGGG + Intronic
1196866623 X:120076826-120076848 GTTTGCAGGGAGGCGGCGTTTGG - Intronic
1196876476 X:120159455-120159477 GTTTGCAGGGAGGCGGCGTTTGG + Intronic
1196947161 X:120838879-120838901 GAATATAGGCAGGCTGAGTTTGG + Intergenic
1197618230 X:128718244-128718266 GTCTGAAGGAAGGCTTAGTTAGG + Intergenic
1198117999 X:133563083-133563105 GTATTCTGCAAGGCTGGGTTTGG + Intronic
1199430698 X:147756673-147756695 GTATGCAAGAAGGCTGGGCATGG - Intergenic
1201145238 Y:11061122-11061144 GTGTGCAGGAACGCAGAGTTTGG + Intergenic