ID: 922592827

View in Genome Browser
Species Human (GRCh38)
Location 1:226791369-226791391
Sequence CTCCATGGTGTCAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922592815_922592827 29 Left 922592815 1:226791317-226791339 CCTTCTCAGATTTAAGTAATCTG No data
Right 922592827 1:226791369-226791391 CTCCATGGTGTCAGGGAACCAGG No data
922592821_922592827 -1 Left 922592821 1:226791347-226791369 CCAGCTCAGGGCTGGTGCAGCCC No data
Right 922592827 1:226791369-226791391 CTCCATGGTGTCAGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922592827 Original CRISPR CTCCATGGTGTCAGGGAACC AGG Intergenic
No off target data available for this crispr