ID: 922596237

View in Genome Browser
Species Human (GRCh38)
Location 1:226815635-226815657
Sequence CAGAGGAAGGAGAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922596237_922596244 24 Left 922596237 1:226815635-226815657 CCCACCTCTTTCTCCTTCCTCTG No data
Right 922596244 1:226815682-226815704 ACTCATCTCAATGCATGCACAGG No data
922596237_922596243 -1 Left 922596237 1:226815635-226815657 CCCACCTCTTTCTCCTTCCTCTG No data
Right 922596243 1:226815657-226815679 GCTTTCTGCAGGTGACACTAAGG No data
922596237_922596245 25 Left 922596237 1:226815635-226815657 CCCACCTCTTTCTCCTTCCTCTG No data
Right 922596245 1:226815683-226815705 CTCATCTCAATGCATGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922596237 Original CRISPR CAGAGGAAGGAGAAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr