ID: 922597055

View in Genome Browser
Species Human (GRCh38)
Location 1:226822194-226822216
Sequence CTGCACTCAGCAGTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922597055_922597061 3 Left 922597055 1:226822194-226822216 CCTCCCACCACTGCTGAGTGCAG No data
Right 922597061 1:226822220-226822242 CACACTTTAGATACTGAGATGGG No data
922597055_922597062 17 Left 922597055 1:226822194-226822216 CCTCCCACCACTGCTGAGTGCAG No data
Right 922597062 1:226822234-226822256 TGAGATGGGACACCACAGCCAGG No data
922597055_922597060 2 Left 922597055 1:226822194-226822216 CCTCCCACCACTGCTGAGTGCAG No data
Right 922597060 1:226822219-226822241 GCACACTTTAGATACTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922597055 Original CRISPR CTGCACTCAGCAGTGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr