ID: 922602210

View in Genome Browser
Species Human (GRCh38)
Location 1:226865004-226865026
Sequence CTGGAGCAAGGGACAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922602202_922602210 22 Left 922602202 1:226864959-226864981 CCAGCCTGTTGAAAACATTTAAA No data
Right 922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG No data
922602203_922602210 18 Left 922602203 1:226864963-226864985 CCTGTTGAAAACATTTAAAGACA No data
Right 922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG No data
922602201_922602210 23 Left 922602201 1:226864958-226864980 CCCAGCCTGTTGAAAACATTTAA No data
Right 922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG No data
922602200_922602210 28 Left 922602200 1:226864953-226864975 CCGTGCCCAGCCTGTTGAAAACA No data
Right 922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922602210 Original CRISPR CTGGAGCAAGGGACAGCAGA TGG Intergenic
No off target data available for this crispr