ID: 922603595

View in Genome Browser
Species Human (GRCh38)
Location 1:226875013-226875035
Sequence GAGAACTCTGCCTGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 315}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922603581_922603595 25 Left 922603581 1:226874965-226874987 CCCACTTCCCCACAAACCACCCT 0: 1
1: 0
2: 0
3: 49
4: 385
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603590_922603595 5 Left 922603590 1:226874985-226875007 CCTTTTCCCTGGCTGCTTCAGGA 0: 1
1: 0
2: 1
3: 39
4: 301
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603585_922603595 16 Left 922603585 1:226874974-226874996 CCACAAACCACCCTTTTCCCTGG 0: 1
1: 0
2: 3
3: 26
4: 433
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603584_922603595 17 Left 922603584 1:226874973-226874995 CCCACAAACCACCCTTTTCCCTG 0: 1
1: 0
2: 0
3: 39
4: 293
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603592_922603595 -2 Left 922603592 1:226874992-226875014 CCTGGCTGCTTCAGGAAATGAGA 0: 1
1: 0
2: 2
3: 26
4: 241
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603591_922603595 -1 Left 922603591 1:226874991-226875013 CCCTGGCTGCTTCAGGAAATGAG 0: 1
1: 0
2: 1
3: 17
4: 237
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603587_922603595 9 Left 922603587 1:226874981-226875003 CCACCCTTTTCCCTGGCTGCTTC 0: 1
1: 0
2: 6
3: 56
4: 613
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603588_922603595 6 Left 922603588 1:226874984-226875006 CCCTTTTCCCTGGCTGCTTCAGG No data
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603582_922603595 24 Left 922603582 1:226874966-226874988 CCACTTCCCCACAAACCACCCTT 0: 1
1: 0
2: 6
3: 48
4: 487
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603580_922603595 30 Left 922603580 1:226874960-226874982 CCTCTCCCACTTCCCCACAAACC 0: 1
1: 0
2: 7
3: 79
4: 846
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315
922603583_922603595 18 Left 922603583 1:226874972-226874994 CCCCACAAACCACCCTTTTCCCT 0: 1
1: 0
2: 1
3: 51
4: 325
Right 922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 24
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922603595 Original CRISPR GAGAACTCTGCCTGGGCCCC AGG Intronic
900152005 1:1182848-1182870 GAGAGCGCGGCCTGAGCCCCTGG - Intronic
900245829 1:1635716-1635738 GAGAACTCAGCCGGGACCACAGG - Exonic
900257054 1:1702859-1702881 GAGAACTCAGCCGGGACCACAGG - Exonic
900397772 1:2460238-2460260 GGGAACCCGGCCTGGGACCCCGG - Intronic
900478668 1:2887902-2887924 GAGAGCTCTGCCTGCTCCCTTGG + Intergenic
900689387 1:3971099-3971121 GAGTAGTCTGCTGGGGCCCCAGG + Intergenic
901232976 1:7651506-7651528 CAGAAGTCTGCCTCAGCCCCTGG - Intronic
901784793 1:11617392-11617414 GAGAGCTCTTCCTGGGACACTGG - Intergenic
903072127 1:20731810-20731832 GGGGACTCTGCCGGGGCCCCTGG - Intronic
903361322 1:22779077-22779099 GGGCTCTCTGCCTGGGCCCAGGG - Intronic
903995891 1:27305318-27305340 GAGAACACAGCCTTGGGCCCCGG - Intronic
904279665 1:29409897-29409919 GAGAACTCTGGTTGGGGTCCAGG - Intergenic
904463316 1:30693213-30693235 GAGGGCTGTTCCTGGGCCCCGGG - Intergenic
904469736 1:30728975-30728997 GAGACTTCTTCCTGGGACCCGGG + Intergenic
905314541 1:37073592-37073614 AAGAACACTGCATGGGGCCCTGG + Intergenic
906204190 1:43978646-43978668 GAGACCACTGCCTAGGCTCCAGG - Intergenic
906549985 1:46656785-46656807 GAGAACTCTGGCTGTGCCTTTGG - Intronic
906692330 1:47800722-47800744 GAGAAACCTTCCTGAGCCCCTGG - Intronic
907464402 1:54625163-54625185 GAGAATTGAGCCTGGGCTCCAGG - Intronic
909455667 1:75845867-75845889 TAAGTCTCTGCCTGGGCCCCAGG + Intronic
909463261 1:75943503-75943525 GAGTACTCTGCCAGGGGCCTGGG + Intergenic
910384234 1:86664425-86664447 CAGAACTCTGCCAGAGCCCATGG + Intergenic
910384421 1:86665495-86665517 CAGAACTCTGCCAGAGCCCATGG - Intergenic
912746418 1:112249099-112249121 CAGAACTCTGGCTGGACCCAGGG + Intergenic
912975874 1:114329830-114329852 AAGGACTCAGCCTGGGCCCCTGG + Intergenic
915930475 1:160057759-160057781 GAGAACCCTGTCTTGGCCCTGGG - Intronic
916179434 1:162070600-162070622 GTGAGCTCAGCCTGGGCACCTGG + Intronic
916875420 1:168963551-168963573 GAGAACACTGTCTGTGTCCCTGG - Intergenic
919118789 1:193313851-193313873 GAGAACTCTGTGAGGGCTCCAGG + Intergenic
919806944 1:201385986-201386008 GAAAGCTCTGCCTGGTGCCCTGG - Intronic
920312823 1:205058532-205058554 GAGGACAGTGCCTGAGCCCCTGG + Intronic
922320587 1:224482970-224482992 CAGAACTCAGCCAGGGCCCAAGG - Intronic
922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG + Intronic
923486944 1:234442169-234442191 GAGAACTCTGCCTTAGCCCCAGG - Intronic
1062768997 10:85182-85204 GAGAACACTCGCTGGGCCACAGG + Intergenic
1063033129 10:2256182-2256204 GAGAACTTTGCCTGGGAGCATGG + Intergenic
1063131936 10:3185727-3185749 CAGAACTCTGTGTGGGCCCACGG - Intergenic
1065961150 10:30735264-30735286 GAAAACGCTGTCTGGGACCCAGG + Intergenic
1066642861 10:37573898-37573920 CAGTTCTCTGCCTGGGCCCAAGG - Intergenic
1068774455 10:60855579-60855601 GAGACCTGGGCCTGGGGCCCTGG + Intergenic
1069749398 10:70735859-70735881 GACAGCTCAGCCTGGGCCCTGGG - Intronic
1070284493 10:75073101-75073123 GAGAATTCTCCCTGTGTCCCAGG - Intergenic
1070481549 10:76887717-76887739 CACATCTCTGCCTGGGCTCCTGG - Intronic
1073523865 10:104161424-104161446 GAGAACTACCCCTGAGCCCCAGG + Intronic
1074769711 10:116725307-116725329 GAGCACTCTGCTAGGGTCCCAGG + Intronic
1074777030 10:116774339-116774361 GAGCACTCTGCGAGGGTCCCAGG + Intergenic
1074834345 10:117274782-117274804 GAGCACTCCACCTGGGACCCTGG + Intronic
1075115929 10:119627262-119627284 GAGACTTCTCCATGGGCCCCAGG - Intergenic
1075461404 10:122618875-122618897 CAGAGCACTGCCTGTGCCCCAGG + Intronic
1075608639 10:123834363-123834385 GACAACCCTGCCTGCTCCCCAGG + Intronic
1075668072 10:124244796-124244818 GAGCCCCCTGCCTGGACCCCTGG + Intergenic
1075712021 10:124535973-124535995 GGGAATCCTGCCTGGGACCCCGG - Intronic
1076565792 10:131398242-131398264 GAGATTTCTGCCTGGGGACCAGG - Intergenic
1076644249 10:131941470-131941492 GGAAACTCTGCCTGGTCCCAAGG + Intronic
1076714143 10:132354757-132354779 GAAAACCCGGCCTGGGGCCCAGG + Intronic
1076730697 10:132437480-132437502 GAGACGTCTGGCTGGGCCCAAGG + Intergenic
1076787107 10:132756000-132756022 GTCGCCTCTGCCTGGGCCCCAGG + Intronic
1076848656 10:133082339-133082361 GTGCTCTCTGCCTGGGTCCCGGG + Intronic
1077044623 11:539050-539072 CAGACATCTGCCTCGGCCCCAGG - Intronic
1077396650 11:2327123-2327145 CAGTTCTCGGCCTGGGCCCCAGG + Intergenic
1078518279 11:12043530-12043552 CAGTACTCTTCCTGTGCCCCGGG + Intergenic
1078546888 11:12253277-12253299 GGCAGCTCTGCCTGGGCCCTGGG - Intronic
1080174826 11:29350478-29350500 GAGAACTCAGACTGAGCCCTAGG + Intergenic
1081941638 11:46947791-46947813 CAGAAATCTGCTTGTGCCCCAGG + Intronic
1083324455 11:61866319-61866341 GAGGACTCTTCCAGGGCCCAAGG - Exonic
1084728586 11:71058813-71058835 GAGACCCCAGCCCGGGCCCCGGG + Intronic
1084861459 11:72021281-72021303 GCCAACTCAGCCTGGGCCACAGG + Exonic
1085236251 11:75017700-75017722 GAGAACTCAGCCTGGCTCACAGG - Intronic
1085738626 11:79060948-79060970 GAGAGGTCTGGCTGGGGCCCAGG + Intronic
1087032130 11:93716224-93716246 TAGAACTCTGCCAGTGCCCTTGG - Intronic
1087059868 11:93966981-93967003 GGGAACTCAGACTGGACCCCAGG - Intergenic
1088543764 11:110939635-110939657 GAGAGCTCTGCCTGGCCTCCAGG - Intergenic
1090611230 11:128472727-128472749 GAAAACTTTGGCTGGGCCCAGGG - Intronic
1092094086 12:5827607-5827629 GAGAAGCCTGCCTTGGCCCCAGG - Intronic
1096500788 12:52062886-52062908 CAGGCCTCTTCCTGGGCCCCAGG + Intergenic
1099815398 12:87640265-87640287 GAGTACTCTCCCTCAGCCCCAGG - Intergenic
1100656402 12:96650500-96650522 GAGAACCCTGCCCTTGCCCCCGG + Intronic
1105590922 13:21792131-21792153 GAGAACTCTCCAAGTGCCCCGGG + Intergenic
1107425304 13:40287330-40287352 GACCACTCAGCCAGGGCCCCTGG + Intergenic
1107767097 13:43747611-43747633 GAGGATTCTGCCTGGGCCTGAGG - Intronic
1107972277 13:45654964-45654986 CAGGCTTCTGCCTGGGCCCCAGG + Intergenic
1111866470 13:93774914-93774936 GAGAGCTCAGCCAAGGCCCCTGG + Intronic
1112315409 13:98357959-98357981 CAGCACTCTGCCAAGGCCCCAGG + Intronic
1113095037 13:106654292-106654314 AGGAACTGTGCCTGGTCCCCTGG + Intergenic
1113801360 13:113088108-113088130 AAGAACTGTGCCTGGCACCCAGG - Intronic
1114189304 14:20428938-20428960 GGGAACTCTGCCAAGGCCTCGGG - Exonic
1114353259 14:21878187-21878209 GAGGACTCTGGCTGGGGCCTGGG - Intergenic
1120072881 14:80123229-80123251 CAGATTTCTGCCTGGGCGCCTGG - Intergenic
1120241352 14:81953219-81953241 CAGTTCTCTGCCTGGGCCCTGGG + Intergenic
1120997706 14:90428899-90428921 CAGTTCTCAGCCTGGGCCCCAGG + Intergenic
1121611726 14:95285485-95285507 GTGAACGCTGTCTGGGCCTCTGG + Intronic
1122070085 14:99200551-99200573 AAAATCTCTGCCTGGGCCCAGGG + Intronic
1122265743 14:100546136-100546158 GGGAACCATGGCTGGGCCCCGGG + Intronic
1124149678 15:27166520-27166542 GAGGCCACTGCCTGCGCCCCTGG + Intronic
1124156127 15:27226475-27226497 CAGGACACTGGCTGGGCCCCAGG + Intronic
1127798442 15:62457570-62457592 AAGAACTCTCCCTGGGTCACTGG - Intronic
1128390563 15:67179893-67179915 GAGATGTCAGCCTGGGCCCTGGG + Intronic
1128809777 15:70562290-70562312 GAGAACTGGGACTGGACCCCAGG - Intergenic
1129890529 15:79068903-79068925 ATGACCTCTCCCTGGGCCCCAGG + Intronic
1130219769 15:82009641-82009663 GAGGAGACTGCCTGGGCCTCAGG - Intergenic
1131131678 15:89904474-89904496 GAGAACCCTGCCTGGCCACCGGG - Intronic
1131909896 15:97187045-97187067 AAGAGATCTGCCTCGGCCCCCGG + Intergenic
1132458097 16:35424-35446 GAGAACACTCACTGGGCCTCAGG + Intergenic
1132575469 16:661831-661853 GTGGAATCTGCCTGGGCCCCGGG + Intronic
1133233427 16:4376916-4376938 CAGAACTCTGCCTGCCCCCTGGG - Intronic
1133760608 16:8795832-8795854 GGAGACTTTGCCTGGGCCCCTGG - Exonic
1134018796 16:10907452-10907474 GCCAGCTCTGCCAGGGCCCCGGG - Exonic
1134615690 16:15649967-15649989 CAGAACGCTGCCTGGACACCCGG - Intronic
1135973273 16:27087795-27087817 GTGAACTCTGCCTTGGCCACTGG - Intergenic
1136183320 16:28570005-28570027 CAGTTCTCTGCCTGGGCCCAAGG - Intronic
1136227033 16:28866266-28866288 GAGAAGGCAGCCTCGGCCCCGGG - Exonic
1139749717 16:69102158-69102180 GAGAACACTGCTTTGGCACCTGG - Intergenic
1140376289 16:74447934-74447956 GAGAAATCTCCCTGGGCCAGGGG - Intergenic
1141517322 16:84554243-84554265 AAGAACTCAGACTGGGGCCCAGG + Intergenic
1141721173 16:85756130-85756152 GAGCCCTATGCCCGGGCCCCTGG + Intergenic
1142696301 17:1635587-1635609 GACGACCCTGCCTGGGCCACAGG + Exonic
1142741112 17:1932515-1932537 TGGAAGTCTGCCTGGGCCACAGG - Intergenic
1143019390 17:3908969-3908991 ACAAACTCAGCCTGGGCCCCAGG + Intronic
1143104131 17:4519942-4519964 GAGGACCCCGCCTGGCCCCCTGG - Intronic
1143253949 17:5542122-5542144 TAGACCTCTGCCTGGCCCACAGG - Intronic
1144662774 17:17081953-17081975 GAGAGATTTGGCTGGGCCCCTGG + Intronic
1144671772 17:17136842-17136864 CCGCATTCTGCCTGGGCCCCTGG + Intronic
1144679225 17:17181880-17181902 GAGCAGACTGTCTGGGCCCCAGG + Intronic
1146005125 17:29156002-29156024 GGGAGCTGAGCCTGGGCCCCAGG + Intronic
1146492641 17:33293192-33293214 GAGAACCCTCTTTGGGCCCCAGG + Intronic
1147326219 17:39670988-39671010 GAGGTCTCTGCCTGGGCACGTGG - Intergenic
1147937382 17:44020294-44020316 GAGAACTCTTCCTGTTCCCTGGG - Intronic
1147948108 17:44091896-44091918 GAGACCTTGGCCTTGGCCCCAGG - Intronic
1148073692 17:44923160-44923182 GAGAATTTTGCCTGGGCCGGGGG - Intergenic
1148090501 17:45020156-45020178 CAGAACTGTTCCTGTGCCCCAGG - Intergenic
1148644803 17:49213540-49213562 GAGAACTCTGCAGGTGACCCTGG - Intronic
1149249339 17:54749958-54749980 GAGAACTCAGCCAGTGCCCATGG - Intergenic
1149658759 17:58323912-58323934 TAGGAGGCTGCCTGGGCCCCCGG + Intronic
1151335117 17:73435190-73435212 GTGAACGCAACCTGGGCCCCAGG + Intronic
1151359794 17:73581940-73581962 GAGAACTCTGTCTGGAGCCTGGG + Intronic
1151665116 17:75541300-75541322 GTGACCTTGGCCTGGGCCCCGGG + Intronic
1151940207 17:77287330-77287352 GACAGTTGTGCCTGGGCCCCGGG + Intronic
1152065335 17:78109473-78109495 GTGTAGTATGCCTGGGCCCCAGG + Intergenic
1152149323 17:78589122-78589144 GTGACCACTGCCTGTGCCCCAGG - Intergenic
1152563849 17:81091480-81091502 GAGATCCCTGCCTCGGTCCCTGG + Intronic
1152614905 17:81333592-81333614 GAGAACTCTCCCTGGGCGTCTGG + Intergenic
1152962060 18:85996-86018 GAGAACACTTACTGGGCCACAGG + Intergenic
1154491451 18:14925329-14925351 GGGAAGTGTGCCAGGGCCCCTGG - Intergenic
1155807682 18:30192510-30192532 GAGTACTCTGCCTGAGGCCTGGG - Intergenic
1157150628 18:45213862-45213884 CAGATCTCTGCCAGGGCCCAGGG + Intronic
1157596483 18:48867116-48867138 CAGGACTCTGCCTGGGAGCCAGG - Intergenic
1158627583 18:59084909-59084931 GATATCTCTGGCTGGCCCCCAGG - Intergenic
1158714082 18:59862605-59862627 GAGAAGTCTGAATGTGCCCCAGG - Intergenic
1158944525 18:62437024-62437046 GACAACTCTGGCTCGGCCCAAGG + Intergenic
1160862733 19:1244568-1244590 CAGGCTTCTGCCTGGGCCCCAGG + Exonic
1160980647 19:1815192-1815214 GAGGCCTCTGCATGTGCCCCGGG - Intergenic
1161064702 19:2231901-2231923 GAGACTTCTGCCTGGGCCAGTGG - Exonic
1161294253 19:3511728-3511750 GAGGCCGGTGCCTGGGCCCCGGG - Intronic
1161296324 19:3522379-3522401 GTGGGCTCTGCATGGGCCCCTGG + Intronic
1161471080 19:4457164-4457186 GAGAGCTCTGTCTGGGGACCCGG - Intronic
1161793901 19:6375740-6375762 GAGAACTCTCCATCGGCCACGGG + Exonic
1164711655 19:30361234-30361256 GAGAACTCTCCCTGTGTGCCTGG + Intronic
1164982686 19:32626191-32626213 GAGAACTCAGCCTGTCTCCCAGG + Intronic
1165158718 19:33803520-33803542 GAGAACTCTGCCTGAGCCTCTGG + Intronic
1165744871 19:38224598-38224620 GAGAAGTCTGTGTGGGCACCTGG - Intronic
1166060385 19:40321971-40321993 GAGGACTCTGGTGGGGCCCCGGG - Exonic
1166202280 19:41245812-41245834 GAGAAAGCCGCCAGGGCCCCAGG + Intronic
1166306758 19:41939935-41939957 GAAAACCCTGCCTGGTCCTCCGG + Intergenic
1166733050 19:45069362-45069384 GAGATCCCTGCCTGGCCCTCGGG + Intronic
1167941127 19:52946587-52946609 GAGAAGGCTGCCTGGGGGCCGGG - Intronic
1168486633 19:56768114-56768136 GAGAAGTCAGCCTGGGACCCTGG - Intergenic
925918827 2:8625666-8625688 GAGGACTCTGCCCGTGCTCCAGG - Intergenic
926048600 2:9728473-9728495 GAGTACACTGCCTGGGTCCCCGG + Intergenic
926750569 2:16195742-16195764 GAGAACTCCAACTGGGGCCCAGG - Intergenic
927430608 2:23023471-23023493 CAGGACTCTCCCTGGGCCTCTGG + Intergenic
928411517 2:31057983-31058005 GGGACCTCTGCCAGGGCTCCAGG + Intronic
928693453 2:33824480-33824502 GTGATCTCTGCCTGAGCGCCAGG + Intergenic
930239514 2:48921651-48921673 AAGTTCTCTGCCTGGGCCCCAGG + Intergenic
930533254 2:52615730-52615752 TAGAACTCTGCATGGCCCCGTGG - Intergenic
931140428 2:59452097-59452119 TAGTACTCTGCCTGGGCCCCAGG - Intergenic
932618268 2:73249922-73249944 GTGAGCTCGGCCTGGGCCCACGG - Intronic
932621389 2:73266454-73266476 CACCATTCTGCCTGGGCCCCGGG + Exonic
935725539 2:106020890-106020912 GGGACCTCTGCCAGGCCCCCTGG + Intergenic
936392530 2:112088026-112088048 GAGGCCTGAGCCTGGGCCCCCGG - Intronic
936531000 2:113277246-113277268 GAGAAATCTTCCGGCGCCCCAGG + Intronic
936662809 2:114560723-114560745 CAGAACTCTGCCCGGGCTCCTGG + Intronic
936818103 2:116484826-116484848 GAGCACTCTTCCTGGGGCTCAGG + Intergenic
937319878 2:120954795-120954817 GAGATCGCTGCCGGGGCGCCAGG - Intronic
937930743 2:127203270-127203292 TAGCACACTGCCTGGGACCCAGG + Intronic
937976710 2:127586889-127586911 GGGAGCTCTGCCTGAGCCTCAGG + Intronic
939692666 2:145284797-145284819 TAGAACTCTGCCTGTGGCACTGG - Intergenic
939839018 2:147164917-147164939 GAGACCATTCCCTGGGCCCCTGG + Intergenic
940159318 2:150694084-150694106 GAGGACTGTTCATGGGCCCCCGG - Intergenic
940786672 2:157988978-157989000 GGAAACTCTGCCTGGAACCCAGG - Intronic
941740227 2:169028168-169028190 GAGATTTCTTCCTGGGCCTCAGG - Intronic
942658634 2:178240868-178240890 GAGAACTATGAATAGGCCCCTGG - Intronic
942784846 2:179688982-179689004 GAGAACTCTTCCTGGGCTTTTGG + Intronic
945836508 2:214840891-214840913 CAGACTTCTGCCTGGGCACCTGG + Intergenic
948129332 2:235588917-235588939 GAGAATTTTGCCTGGCCCCTAGG + Intronic
948742517 2:240057093-240057115 GGGAATTGTGCCTGTGCCCCTGG + Intergenic
948747351 2:240106280-240106302 CAGAGCACTGCCTGGGCTCCAGG + Intergenic
948757683 2:240168857-240168879 GAGAGCCCTGCTTGGGCCCCTGG - Intergenic
948827141 2:240578265-240578287 GACAGCACAGCCTGGGCCCCCGG - Exonic
1169000147 20:2162657-2162679 GAGAACTCTGCCTGCACCCCAGG - Intronic
1169089646 20:2851021-2851043 GGGTACTCTTCCTTGGCCCCAGG - Intronic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1169688560 20:8304727-8304749 TAGAACACTGCCTGGCCCACTGG - Intronic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1172505745 20:35461240-35461262 GAGAACTCTTCCTCTGGCCCAGG + Intronic
1172668149 20:36614941-36614963 GAGAACTCTGCCTGCTGCCAGGG + Intronic
1172848647 20:37944951-37944973 CAAAACTCTGCCTGGGGCCATGG - Exonic
1172936353 20:38623257-38623279 CAGAAATCAGCCTGGGCCCCTGG - Intronic
1173595532 20:44256712-44256734 GAGCACTCAGCCTGGCCCCTAGG - Intronic
1173809886 20:45949285-45949307 GAGAAACCTGCCTGTGCCCCAGG + Intronic
1174208838 20:48861027-48861049 GAGATCTCTTTCTGGGCCCCAGG - Intergenic
1174494496 20:50930531-50930553 CAGCACTCTGCCTGGCCGCCCGG - Intronic
1175191145 20:57212861-57212883 GAGGACTCAGCCCGGGCCCCAGG + Intronic
1175244302 20:57572409-57572431 GAGCACTCTGCCTTGGTCCCTGG + Intergenic
1176219603 20:63963730-63963752 GAGAAGCCTGCCTGGGGCCAGGG + Intronic
1178190099 21:30270310-30270332 GTAAAATCTGCCTGGACCCCGGG - Intergenic
1178578042 21:33812830-33812852 TAGAACTGTCCCTGGGACCCAGG + Intronic
1179344766 21:40546338-40546360 GACATCTCTGCCAGGGCCTCAGG + Intronic
1179657287 21:42853196-42853218 GAGGACTCAGCCAGTGCCCCAGG + Intronic
1179804008 21:43825918-43825940 GAAATCTCTGTCTGGGGCCCTGG + Intergenic
1180066696 21:45415943-45415965 CAGAACACTGCGTGGGCCCTCGG + Intronic
1181134188 22:20752578-20752600 GGGACCTCTGGCTGGGCCCTGGG + Intronic
1181671505 22:24427598-24427620 GGAAGCTCTGCCTGGGCCTCAGG + Intronic
1182318977 22:29466108-29466130 GAGATCTGGCCCTGGGCCCCAGG - Intergenic
1182756821 22:32687082-32687104 GAACACTCAGCCTGGGCACCTGG - Intronic
1183091685 22:35526533-35526555 GAGAACTGTTCATAGGCCCCTGG + Intergenic
1183360509 22:37380708-37380730 GAGAGATCTGGCTGGGCCCCAGG - Intronic
1183904696 22:41031699-41031721 GAGAACTTTGCATGGTCTCCAGG + Intergenic
1183958864 22:41398836-41398858 CAGCCCTCTACCTGGGCCCCGGG + Exonic
1184797274 22:46739448-46739470 TAGGACTCTGACTGGGCCCACGG - Intergenic
1184809783 22:46823480-46823502 GAGAACTCACCCAGGGCCCTGGG - Intronic
1185050939 22:48553619-48553641 CAGAACACTGTCTGGGCCCCGGG - Intronic
1185100557 22:48838758-48838780 CAGACCCCTGCCTGGGTCCCTGG + Intronic
1185222963 22:49638141-49638163 GGGAACCCTGTCTGGGCACCTGG + Intronic
1185284990 22:49996154-49996176 GAGACCCCTGCCTGGCCCACTGG + Exonic
950046066 3:9949298-9949320 GCCAAGTCTGGCTGGGCCCCTGG + Exonic
950414512 3:12861128-12861150 CAGAAGTCTTCCTGGGCCCGGGG + Intronic
950482178 3:13250976-13250998 GAGGACTCTGCCTTTACCCCCGG - Intergenic
952315873 3:32231853-32231875 GAGGAAACTGCCTGAGCCCCAGG + Intergenic
953210438 3:40870458-40870480 GAAAACTCTGTCCGGGACCCTGG + Intergenic
953235711 3:41104255-41104277 GGGACCCCTGCCTGAGCCCCCGG - Intergenic
953487478 3:43315744-43315766 GGTGACTATGCCTGGGCCCCAGG - Intronic
954070638 3:48140428-48140450 GAGAAGTTTGCCTGGACCCGAGG + Intergenic
954291854 3:49654048-49654070 GAGAACTCTGCTGTGGCCCTTGG - Exonic
961568607 3:127782526-127782548 CAGCACTCTGCCTGGGCCATTGG - Intronic
961714423 3:128848900-128848922 CAGAACTCTTCCTGGGCCAGGGG - Intergenic
961780491 3:129317598-129317620 GAGAAGCCTGCTTGGGCCCAAGG - Intergenic
962118752 3:132540291-132540313 GAGAACCCAGCCTGAGACCCAGG + Intergenic
962459280 3:135593859-135593881 GAAAACTCTGCCTGAGCTTCAGG + Intergenic
963824145 3:149932943-149932965 CAGACTTCTGCCTGGGACCCAGG + Intronic
963937318 3:151067683-151067705 GAGCACTCTCCCTAGGCCCTAGG + Intergenic
966050788 3:175616624-175616646 GTGACCTCTGCCTGGGGCCTGGG + Intronic
966569427 3:181424466-181424488 AAGAACTCTGCCTGAGCCCCTGG + Intergenic
969097220 4:4742820-4742842 GAGAATTGAGCCTGGGCCTCAGG + Intergenic
969418604 4:7076854-7076876 GAGGACTGTGCCTGGGACCCAGG + Intergenic
969677557 4:8622562-8622584 GAAAACGCTGCCTGTGCACCAGG + Intergenic
969678512 4:8628203-8628225 GAAAACGCTGCCTGTGCACCAGG + Intergenic
969679468 4:8633837-8633859 GAAAACGCTGCCTGTGCACCAGG + Intergenic
969757785 4:9161368-9161390 CAGAGCTCTGCCTGTGGCCCTGG + Intergenic
974817300 4:67021831-67021853 TAGAACTATTCCTGTGCCCCTGG + Intergenic
981413302 4:144458563-144458585 GTGAACTCTCACTGGTCCCCAGG + Intergenic
984417262 4:179477472-179477494 CAGAACTCTGTGTGGGCCCATGG - Intergenic
984943774 4:184955403-184955425 GGGAACTCAGCCTTGGCCCCGGG + Intergenic
985119861 4:186629645-186629667 GACCGCTCTGCCTGGGACCCTGG - Intronic
985490700 5:176856-176878 CAGGACTCTGCCTGGGCCTGGGG + Intronic
985611388 5:891557-891579 GCGCACTCTGCCTGGGTCCTGGG + Intronic
986191420 5:5499623-5499645 GAGCACTGTGCCTGGTGCCCAGG - Intergenic
987370207 5:17186340-17186362 AGGAGCTCTGCCTGGCCCCCTGG - Intronic
989626334 5:43432584-43432606 GAGAAGTTGGCTTGGGCCCCAGG - Intergenic
990348281 5:54890495-54890517 GAAAACTCTGCCTAGCCCCAAGG + Intergenic
993022273 5:82605776-82605798 GAGCACTCTGCCAAGGCCCTGGG + Intergenic
993138260 5:83997903-83997925 CAGAACTCAGCCTGCGCCCATGG + Intronic
996345888 5:122487912-122487934 TACAACTTTGCCTGGGGCCCTGG + Intergenic
999024454 5:148211135-148211157 GACCACTCTCTCTGGGCCCCAGG - Intronic
1002415680 5:179119715-179119737 GAGAACTGTGCCTGGAGCCAGGG + Intronic
1002443175 5:179274773-179274795 GCGCACTCAGCCTGGGCCCTCGG + Intronic
1003425438 6:5995530-5995552 CAGAGCCCTGCCTGGGCCCGAGG - Intergenic
1003635950 6:7831786-7831808 GAGAACTGTTCCTGGGTCCTGGG + Intronic
1005445360 6:25916927-25916949 GAGACCTCTGCATGGGCCACAGG + Intronic
1005947474 6:30604797-30604819 GGGGACTGTGCCTGGGACCCTGG - Intronic
1007473536 6:42105364-42105386 GAGCCCTCTGCCTGGCCGCCAGG + Exonic
1008088568 6:47269821-47269843 AAGAGCGCTGCCTGGGCCCCTGG + Intronic
1011684660 6:89814784-89814806 GAGATCTCCGCCAGGGCCCTGGG + Intronic
1012950612 6:105513960-105513982 GAAAACTCTGCCTTGGCTACAGG - Intergenic
1014430540 6:121365454-121365476 CAGAACTCAGCCTGTGCCCATGG + Intergenic
1014698260 6:124651440-124651462 CAGGTTTCTGCCTGGGCCCCAGG + Intronic
1016758411 6:147711893-147711915 CAGACCTCTGAGTGGGCCCCTGG - Intronic
1017392733 6:153958781-153958803 CAGACCTCTGCCTGGACACCTGG + Intergenic
1017572590 6:155763108-155763130 CAAATCTCTGCCTGAGCCCCAGG - Intergenic
1017724167 6:157265414-157265436 CAGATCTTTCCCTGGGCCCCAGG + Intergenic
1017810866 6:157982266-157982288 GAGCACTCTGGCTGGGCCGGTGG + Intronic
1019119650 6:169792794-169792816 GAGAGTTCAGCCTGAGCCCCCGG - Intergenic
1019475622 7:1242765-1242787 GAGAGCTCGGCCTGGGGCCACGG + Intergenic
1021757928 7:23873469-23873491 GAGAATGCTGCCTGGGCAGCTGG + Intergenic
1022338547 7:29446551-29446573 GAGAACTCAGGCAGGGCCCAGGG + Intronic
1022738994 7:33103300-33103322 GAGTCCTCTGCCTGGGGGCCAGG - Intronic
1023009064 7:35909029-35909051 GAGCACTCTGGCATGGCCCCTGG + Intergenic
1024044415 7:45577030-45577052 GGGAACTCTGCCTCTCCCCCTGG + Intronic
1026930495 7:74220667-74220689 GAGAATTGGGCCTGAGCCCCTGG - Intronic
1029733077 7:102450484-102450506 AAGAGCTCTGCCTGGGGACCAGG - Exonic
1030612635 7:111706063-111706085 GAGAAGTCTACCTGGGACACTGG - Intergenic
1031150251 7:118045895-118045917 CAGAACTCTCCCTGTGCCTCTGG - Intergenic
1032012811 7:128357871-128357893 GAAACCTCAGCCTTGGCCCCAGG - Intronic
1034347676 7:150397268-150397290 GAGACCGCGGCCCGGGCCCCGGG - Exonic
1035707169 8:1685273-1685295 GAGAACTGTGCCTGTGTCCATGG + Intronic
1038038018 8:23702685-23702707 GCAAGCCCTGCCTGGGCCCCGGG - Exonic
1038498664 8:28025142-28025164 CAGAACACTGCCTGGCACCCAGG + Intronic
1039887068 8:41660826-41660848 GAGAACTGTAGCTGGGCTCCAGG + Intronic
1040481753 8:47833184-47833206 GAGAACTGTGTGTGGGCCACAGG + Intronic
1043876376 8:85491373-85491395 GAGGACTCTGCGAGGGTCCCTGG + Intergenic
1046355470 8:113078878-113078900 GAGAACGCAGCCAGGGCTCCTGG + Intronic
1048558184 8:135503258-135503280 GAGAACTGTGCATGTGCCCAAGG - Intronic
1049036101 8:140077503-140077525 GAGATCCCAGCCTGAGCCCCAGG + Intronic
1049303472 8:141884162-141884184 GAGAACATTGCCTGAGACCCAGG + Intergenic
1049395406 8:142397942-142397964 CAAACCTCAGCCTGGGCCCCGGG + Intronic
1049414396 8:142488683-142488705 GACCCCTCTGCCTGGGCCTCAGG - Intronic
1049818074 8:144617543-144617565 GAGAGCCCAGCCTTGGCCCCAGG + Intergenic
1050155704 9:2664440-2664462 TAGAACTCTGGCTGGGACACTGG + Intergenic
1050189586 9:3010659-3010681 GAGAACTCTGCCCAGGTGCCAGG + Intergenic
1052515363 9:29472775-29472797 AATAACTCTGCCTGGCTCCCTGG + Intergenic
1053532991 9:38900168-38900190 TAGAACAGTGCCTGGCCCCCAGG - Intergenic
1054205218 9:62124597-62124619 TAGAACAGTGCCTGGCCCCCAGG - Intergenic
1054633144 9:67463773-67463795 TAGAACAGTGCCTGGCCCCCAGG + Intergenic
1057733442 9:97632067-97632089 CAGAACTCTGCCTGGCACCTAGG + Intronic
1058426894 9:104883240-104883262 TAGAACTCAGCCTGGCTCCCAGG + Intronic
1058786719 9:108394982-108395004 CAGATCTCTGCCTGTGCCTCAGG - Intergenic
1058996055 9:110299751-110299773 GAGAACTGTGCTTGGGAGCCAGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061216350 9:129224147-129224169 CAGCACCCTGCCTGGGCCCAGGG - Intergenic
1061383764 9:130276229-130276251 CAGCACCCTGCCTGGCCCCCAGG - Intergenic
1061466876 9:130787501-130787523 CAGATCTTTGCCTGGGTCCCGGG + Intronic
1061498125 9:130987183-130987205 GAGGACTCTGCCTAGGTCCACGG - Intergenic
1061615256 9:131774935-131774957 CAGCAAACTGCCTGGGCCCCAGG - Intergenic
1061864822 9:133486755-133486777 GAGAATGCTGCCTGTGGCCCTGG + Intergenic
1062001124 9:134216287-134216309 GAGAGCCCTTCCTGGGCTCCAGG - Intergenic
1062133830 9:134914353-134914375 GAGACAACTGCCTGGGCCCACGG + Intronic
1062270729 9:135707212-135707234 GAGAACTGTGCCAGGTCCCTGGG - Intronic
1062736081 9:138138121-138138143 GAGAACACTTACTGGGCCACGGG - Intergenic
1186510293 X:10125401-10125423 GAGACCTCTGGCTGGGACCAGGG + Intronic
1189166552 X:38866621-38866643 GGGACCTCTGCCTGGGGCCTGGG + Intergenic
1189974578 X:46448319-46448341 CAGATCTCTGCCTGTGACCCAGG - Intronic
1189984794 X:46544470-46544492 TAGATCTCTGCCTGTGACCCAGG + Intronic
1192181398 X:68917977-68917999 GCAAACTCTGCCTGGCCCCAGGG - Intergenic
1196290119 X:113929994-113930016 GAGAATTCTGCCAGTGCCCGTGG - Intergenic
1199787419 X:151117525-151117547 GAGAACTGTGCCTGCACCCAGGG + Intergenic
1199976018 X:152895355-152895377 GAGAACTCTGCCAGAGCCAGGGG + Intergenic