ID: 922605119

View in Genome Browser
Species Human (GRCh38)
Location 1:226885401-226885423
Sequence CATGCTGCCCTGATGGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922605119_922605126 15 Left 922605119 1:226885401-226885423 CCGCACTCCATCAGGGCAGCATG 0: 1
1: 0
2: 2
3: 16
4: 171
Right 922605126 1:226885439-226885461 TCCCAGGCACCTCCCCTAGCAGG 0: 1
1: 1
2: 2
3: 16
4: 221
922605119_922605125 -1 Left 922605119 1:226885401-226885423 CCGCACTCCATCAGGGCAGCATG 0: 1
1: 0
2: 2
3: 16
4: 171
Right 922605125 1:226885423-226885445 GTGGGCAGCATGGGCATCCCAGG 0: 1
1: 0
2: 1
3: 34
4: 278
922605119_922605124 -10 Left 922605119 1:226885401-226885423 CCGCACTCCATCAGGGCAGCATG 0: 1
1: 0
2: 2
3: 16
4: 171
Right 922605124 1:226885414-226885436 GGGCAGCATGTGGGCAGCATGGG 0: 1
1: 0
2: 3
3: 24
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922605119 Original CRISPR CATGCTGCCCTGATGGAGTG CGG (reversed) Intronic
900308462 1:2022271-2022293 CATCCTGACCTGAGGAAGTGAGG + Intronic
901448642 1:9323143-9323165 CCTGCTGCCATGTTGGAGGGGGG + Intronic
902377543 1:16036888-16036910 CATGGTGCACTGAGGGAATGTGG - Intergenic
902382717 1:16060146-16060168 CATGGTGCACTGAGGGAATGTGG - Intronic
902466170 1:16620079-16620101 CTTGCTGCCCTGATGTTTTGGGG - Intergenic
902508520 1:16953224-16953246 CTTGCTGCCCTGATGTTTTGGGG + Intronic
902579897 1:17401777-17401799 CATGCTGGCCTGCTTGTGTGGGG + Intergenic
902818111 1:18927486-18927508 CATCCAGCCCTGCTGCAGTGGGG - Intronic
905415928 1:37804190-37804212 TATGTTGCCCTGAAGGAGTGTGG - Intronic
905474494 1:38216545-38216567 CATTCTGCCCTGAAGGAGAGCGG + Intergenic
905509269 1:38505708-38505730 ATGGCTGCCCAGATGGAGTGGGG + Intergenic
905973239 1:42156336-42156358 CAGGCTGCCAGGATGGAGAGAGG - Intergenic
906556934 1:46721608-46721630 AATGCTTCCCTGAAGGACTGGGG + Intergenic
908483484 1:64567292-64567314 GGTGATGCCCTGATGGACTGTGG + Intronic
910678065 1:89834855-89834877 AATGCTGCTGGGATGGAGTGAGG + Intronic
913122778 1:115756908-115756930 CAGGCTCCCCGGCTGGAGTGCGG - Intronic
913187279 1:116380417-116380439 CATCCTGCCCTGTTGGAGGCTGG + Intronic
915086568 1:153393244-153393266 AATTCTGCCTTGATGGGGTGAGG - Intergenic
915818135 1:158992078-158992100 CCTATTGCCCTAATGGAGTGAGG - Intergenic
916562389 1:165944248-165944270 CAGGCTGCCCTGATGGACACAGG + Intergenic
921426680 1:215010809-215010831 AATCCTACCCTGAGGGAGTGAGG - Intronic
922605119 1:226885401-226885423 CATGCTGCCCTGATGGAGTGCGG - Intronic
1062917955 10:1256338-1256360 CCTCCTGCCCTGATGGGGTCTGG + Intronic
1064229787 10:13520047-13520069 CATGCTGCCTTGGAGGAGTGAGG - Intronic
1066586530 10:36942767-36942789 CTCGCTGCCCTGTTTGAGTGAGG - Intergenic
1069620197 10:69832769-69832791 CATGGTGGCTGGATGGAGTGGGG - Intronic
1070287177 10:75092645-75092667 CAGGCTGCCCTGGGTGAGTGTGG + Intergenic
1070385026 10:75916550-75916572 CAGGCAGCCCTGGTGGGGTGGGG - Intronic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1073033741 10:100548603-100548625 CCTGCAGCCCAGATGCAGTGGGG - Exonic
1073188478 10:101632245-101632267 CATCCTGCCCTGATGCACTTGGG - Intronic
1073357790 10:102870712-102870734 CAGGCAGTGCTGATGGAGTGAGG - Intronic
1073425253 10:103452072-103452094 CACGCTGCCCAGAGGGAGAGAGG - Intronic
1073449245 10:103600049-103600071 CATGCTGCCCTGCCTGGGTGGGG + Exonic
1073591671 10:104763589-104763611 TGTTCTGCCCTGATGGAGAGTGG - Intronic
1073773531 10:106761440-106761462 CATCCTGCCCTGAGGGGATGTGG + Intronic
1076597778 10:131636409-131636431 CATGAGGCCCTTCTGGAGTGAGG - Intergenic
1076818507 10:132926346-132926368 CACGCCGCCCTGGTGGGGTGGGG - Intronic
1077030905 11:466749-466771 CATGCTGTTCTCATGTAGTGAGG - Intronic
1077155576 11:1089455-1089477 CGTGCTGCCCTCATGGAGCCAGG - Intergenic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1077464330 11:2726445-2726467 GATGCTGCCCTGTCAGAGTGGGG + Intronic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1077924890 11:6671710-6671732 CATGCTGGGCTAATGGAGTTTGG - Intergenic
1081894523 11:46573457-46573479 TATTCTGCCCTTAGGGAGTGTGG - Intronic
1082190967 11:49244458-49244480 AAGGCTTCCCTGAAGGAGTGAGG + Intergenic
1084170455 11:67398462-67398484 CATGCTGCCATGCTGGGGGGGGG - Exonic
1085263006 11:75219065-75219087 CAGGCTGCCCTGGTTGAGAGAGG + Intergenic
1085644294 11:78213210-78213232 CATGCTGTCCAGATGGAGGCAGG + Intronic
1086757920 11:90588057-90588079 CAGGCTGCCAGGCTGGAGTGAGG - Intergenic
1086820156 11:91425770-91425792 CATGCTGTCATGGTGCAGTGGGG + Intergenic
1087561153 11:99792620-99792642 GATGCTGGCCTCATGGAATGAGG + Intronic
1088539095 11:110894430-110894452 TATGCTGCCCTGAAGGGATGAGG - Intergenic
1091064101 11:132492329-132492351 GATGCTGCACTGATGTGGTGGGG + Intronic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1091384622 12:85228-85250 CATGCTGCCCTGGCGCTGTGAGG + Intronic
1094672812 12:32587425-32587447 CAGGCTGCCAGGCTGGAGTGCGG + Intronic
1095976997 12:47946716-47946738 CATGCTGCCCTTGTGCAGTCTGG - Intergenic
1099615316 12:84927029-84927051 GCTTCTGTCCTGATGGAGTGGGG - Intergenic
1100004793 12:89881725-89881747 CATCCTGCCCTTGTGCAGTGGGG + Intergenic
1106675347 13:31952686-31952708 CATGCTGGCCTCCTGGAGGGAGG - Intergenic
1111531284 13:89541106-89541128 CAAGCTGCCCCTATGGAATGGGG - Intergenic
1120453028 14:84695303-84695325 CATGCTTTCCTGGTGGAGAGTGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1122068420 14:99189678-99189700 TATCCTGCCCTCATGGGGTGGGG - Intronic
1123019294 14:105390160-105390182 CTTCCTTCCCTGCTGGAGTGGGG + Intronic
1123699409 15:22903393-22903415 CGTGCTGGCATGTTGGAGTGTGG - Intronic
1124157008 15:27234850-27234872 CCTGCTGCCCAGATGGTGAGAGG + Intronic
1124239189 15:28015993-28016015 CATGCTGACCTGGTGCTGTGTGG + Intronic
1124950808 15:34318833-34318855 CCTACAGCCCTGAGGGAGTGGGG + Intronic
1124990652 15:34670199-34670221 GATGCTGCCCTGACTGATTGGGG - Intergenic
1129880700 15:79004414-79004436 GCTGCTGCCCTGAGGGGGTGGGG - Intronic
1132841978 16:1982517-1982539 CATGCAGGGCTGATGGGGTGTGG - Exonic
1135293776 16:21262056-21262078 GAGGCTGCCCTGAAGGAGTCTGG - Exonic
1140761585 16:78113690-78113712 CATGCTGCCAAGGTGAAGTGAGG + Intronic
1142794730 17:2299090-2299112 CATACTGTCCTGACGGAGTCGGG + Exonic
1146430895 17:32793673-32793695 TATGCTGCACTGATGGGCTGTGG - Intronic
1146935668 17:36811195-36811217 CCAGCCACCCTGATGGAGTGTGG - Intergenic
1147459606 17:40559855-40559877 GATGCTGTCCTGTTGCAGTGTGG + Intronic
1148621423 17:49037603-49037625 AATCCTGCCCTAATGAAGTGTGG - Intronic
1149937298 17:60820692-60820714 AAAGATGCCCTGATGGAATGGGG + Intronic
1150218702 17:63484043-63484065 CTGGCTGCTCTGATGGGGTGGGG + Intergenic
1150936714 17:69643592-69643614 CAAGCTGCCCTGCTGGAATAAGG + Intergenic
1150957563 17:69877273-69877295 CCTTCTGCCATGATGGTGTGAGG - Intergenic
1151768332 17:76143618-76143640 CATCCTGCCCTGATGGAGAGGGG - Exonic
1151804219 17:76395749-76395771 CATGATGCCCTCAGGCAGTGAGG + Exonic
1151884667 17:76916458-76916480 CATGCACCCCAGGTGGAGTGGGG + Intronic
1152919726 17:83060031-83060053 CATGCTGTCCTGAAAGGGTGGGG - Intergenic
1154299929 18:13184148-13184170 CATGCGGCCCTGAGGACGTGCGG + Intergenic
1155423291 18:25679168-25679190 CATGAAGCCCTGATGGCCTGTGG - Intergenic
1159802638 18:72920037-72920059 CATGCTGCACTGACGGGTTGGGG + Intergenic
1160806820 19:995632-995654 CCAGCTGCCCTGATGCAGTGTGG - Intronic
1160939541 19:1613929-1613951 CATGCTGCTCGGCTGGAGAGGGG - Intronic
1165319803 19:35078070-35078092 CAGGCTGCCATGATGGAGGGTGG + Intergenic
1165412868 19:35673163-35673185 GATGCTTCCCTGACGGGGTGTGG + Intronic
1166804089 19:45474456-45474478 CATGCAGCACGGATGGAGGGCGG - Exonic
926169075 2:10539708-10539730 CGTGCTGCCCTGTTGGCGTGCGG - Intergenic
927272611 2:21229254-21229276 CCTGCTGCCTGGCTGGAGTGAGG - Intergenic
929568761 2:43006691-43006713 CCTGCTGCCCTCAAGGAGTATGG + Intergenic
930386834 2:50707584-50707606 CCTGCTGCCCTGATGAAGCCTGG + Intronic
930553177 2:52861465-52861487 CATGCTGGCCTGAGGTGGTGAGG - Intergenic
932116996 2:69060377-69060399 CATGCTTCTTTGATGGAGTTTGG + Intronic
936902030 2:117492062-117492084 CATGCTGTCCTCAAGGAATGTGG + Intergenic
937312558 2:120911038-120911060 CAGGCTGCCCTGAGGGGGAGTGG + Intronic
938298186 2:130191641-130191663 CAGCCTGCCCTGCTGGCGTGGGG - Intergenic
939435868 2:142177019-142177041 GATGCTGCCCTGAGGGATGGGGG - Intergenic
941003128 2:160221871-160221893 GAGGCTGCCCTGGTGGAATGTGG + Intronic
941759254 2:169223200-169223222 AATTATGCCCTGATGCAGTGTGG - Intronic
945213882 2:207412906-207412928 GGTGCTGCCCTGATTGAATGGGG - Intergenic
945818006 2:214629408-214629430 CATGCTGTCCTTAGGGAGTATGG + Intergenic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
1171038751 20:21740030-21740052 CATGCTGCTCTGTCTGAGTGGGG + Intergenic
1171171461 20:23019270-23019292 CATGCTGTCGTCATGCAGTGGGG - Intergenic
1172009281 20:31837056-31837078 GGAGCTGCCCTGATGGAGGGCGG + Intergenic
1173760176 20:45553061-45553083 CATGCTGTCTCCATGGAGTGGGG - Intronic
1179214055 21:39350539-39350561 CATGCTGACTTGCTAGAGTGTGG + Intergenic
1180082343 21:45492738-45492760 CATGCTGCCCGGCTGGGGAGGGG + Intronic
1180593133 22:16957404-16957426 CATGCTGCCCAGATGCAGTGAGG - Intergenic
1181041023 22:20192695-20192717 CCTGCTGCCCTGGTGGGGTTGGG - Intergenic
1182774409 22:32820185-32820207 GATCATGCCCTGAGGGAGTGAGG - Intronic
1183395735 22:37569662-37569684 CATGCTGCCCTGTGGGATTATGG - Intergenic
1183723619 22:39576519-39576541 CTCTCTGCCCTGGTGGAGTGTGG - Intronic
1184148499 22:42625038-42625060 CTTTCTGCCCTAATGGGGTGAGG + Intronic
1184839486 22:47044106-47044128 TACTCTGCCCTGATGGAATGTGG - Intronic
1184981607 22:48099597-48099619 CATGCTGCCCTGTGGGTCTGGGG + Intergenic
1185067680 22:48640246-48640268 CATGCAGCTCTGCTGGAGGGTGG + Intronic
1185292687 22:50035099-50035121 CCTGCTGCCCGGATGGATTGGGG + Intronic
949522563 3:4870022-4870044 GAAGCTGTCCTGATGGAGTGTGG + Intronic
950767451 3:15283813-15283835 TCTACTGCCCTGATGGAGGGAGG + Intronic
952892769 3:38054311-38054333 CACGCTGCCCTCATGGAGGCAGG - Intronic
955075509 3:55609482-55609504 CATGCTCCACTGAGGAAGTGAGG + Intronic
959610638 3:108290918-108290940 AATGCTGGCCTCATAGAGTGAGG - Intergenic
960038852 3:113128882-113128904 CATGATCCCTTCATGGAGTGCGG - Intergenic
966293559 3:178389415-178389437 CATGGTGCCCAGCTGGAATGTGG + Intergenic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
975429901 4:74277049-74277071 CATGCTGTCCTCATGGTGTTTGG - Intronic
975846590 4:78531651-78531673 CTTTCTGTCCTGTTGGAGTGAGG + Intronic
976112546 4:81691436-81691458 CGTGCTTCCCTGATGGAGTCTGG + Intronic
976375190 4:84338477-84338499 ACTGCTGCCCTGCTGGAGCGTGG - Intergenic
976496895 4:85740262-85740284 CAGGCTGCAGTGCTGGAGTGCGG + Intronic
981742059 4:148013121-148013143 CAGGCTGCCCTGAAGGTGGGGGG - Intronic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
990937649 5:61167172-61167194 CAGGCTGCCAGGCTGGAGTGCGG - Intergenic
996401663 5:123069465-123069487 GATGCTGCCCTGCTGGCTTGAGG + Intergenic
997439383 5:133898679-133898701 CATGAGGCCCTGGTGGAGGGAGG - Intergenic
999380677 5:151119044-151119066 CATTCTGGCCTGCTGGAGAGAGG - Intronic
999726758 5:154444945-154444967 CATGCTGCGCAGTTGGAGAGTGG + Intergenic
1003874233 6:10422476-10422498 CAGGCTTCCCTCATTGAGTGGGG - Intergenic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1009330471 6:62413315-62413337 GATGCTGCCCTCATAGAATGAGG - Intergenic
1014193033 6:118519817-118519839 CATGCTGGCCTCATAGAGTTGGG - Intronic
1014498467 6:122156985-122157007 CATGATGCTCTGTTAGAGTGGGG - Intergenic
1015952848 6:138571440-138571462 CATGTGGCTCTGATGGAGGGAGG + Intronic
1016374798 6:143409458-143409480 CATGCTGCCCTGCTGATGAGTGG - Intergenic
1018291744 6:162298630-162298652 CATGCTGACCTCATGGGGTTGGG - Intronic
1018424548 6:163668599-163668621 CATACTGCCCAGATGGAAAGGGG - Intergenic
1019064851 6:169288226-169288248 AATGCTACCCTGCTGGACTGGGG - Intergenic
1019161704 6:170073051-170073073 CATGCTGCCCTCATAGAATGAGG + Intergenic
1019364731 7:627558-627580 CTTGCAGTCCTGATGGATTGGGG - Intronic
1021577844 7:22120648-22120670 CATGCTGCCGTCATGGAATGTGG - Exonic
1021976587 7:26017364-26017386 GATGCTGGCCTCATAGAGTGAGG + Intergenic
1023017272 7:35980917-35980939 CAAGCAGCCCTGGTGGAGAGAGG - Intergenic
1023870678 7:44261490-44261512 CATGCAGGCCTGGTGGGGTGGGG + Intronic
1024683835 7:51723089-51723111 CATGCTGGCCTCATGGAGTTAGG + Intergenic
1028471680 7:91212927-91212949 CATGCTGCACAGATGGCGTAAGG + Intergenic
1033773905 7:144585046-144585068 CATGCTGCCTGTGTGGAGTGCGG - Intronic
1035205709 7:157292807-157292829 CTCGCTGCCCTGATAGGGTGAGG - Intergenic
1035771197 8:2148237-2148259 CATTCTGCCCTGAGGGAGTAGGG - Intronic
1035771310 8:2148944-2148966 CGTGCAGCCCCGATGGAGTCAGG - Intronic
1040532350 8:48276112-48276134 CATGCAGCCCTGATGGTGCAGGG - Intergenic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1044981073 8:97717431-97717453 CTTGCTGCCCTGATGTCCTGTGG + Intronic
1048971520 8:139647592-139647614 CATGCTGGCCAGATGGAGGAGGG + Intronic
1049295064 8:141828572-141828594 CAGGCTGCCCTTCTGGAGGGAGG - Intergenic
1049315942 8:141967592-141967614 CCTGCTGCCCTGATGCCCTGTGG - Intergenic
1051502501 9:17793246-17793268 CATGCTACCATGATGAAGTGTGG - Intronic
1053101689 9:35376800-35376822 TGTCCTGCCATGATGGAGTGGGG + Intronic
1053412367 9:37923934-37923956 CATGCTGCCTTGAAGAAGGGTGG - Intronic
1059428538 9:114236328-114236350 CAGACTGCCCTGATGGAGCTCGG + Intronic
1062149439 9:135009960-135009982 CCTCCTGCCCTGAAGGTGTGGGG + Intergenic
1062655897 9:137604726-137604748 CTTGCTGGCCTGATGGGGTGTGG - Intergenic
1185451232 X:281373-281395 CCTGCTGCCCGGAAGGAGGGAGG - Exonic
1186339601 X:8630043-8630065 CATTCTGCCCTGAGGGAGCATGG + Intronic
1186754435 X:12655502-12655524 CATGCTGCCATGATACAGTATGG + Intronic
1187742648 X:22373151-22373173 CTTGCTGCACGGATGAAGTGTGG + Intergenic
1188814740 X:34698629-34698651 CTTCCTGCCATGATGGATTGTGG - Intergenic
1192257933 X:69480955-69480977 CATTCTGCCCTCAAGGAGGGGGG + Intergenic
1199784029 X:151088293-151088315 CATGCTGGGATGAGGGAGTGTGG - Intergenic
1200210388 X:154344441-154344463 CATGCAGCCCTGAAGGGGAGGGG + Intergenic
1200220464 X:154387651-154387673 CATGCAGCCCTGAAGGGGAGGGG - Intergenic