ID: 922605797

View in Genome Browser
Species Human (GRCh38)
Location 1:226889108-226889130
Sequence TGCCCTCCTTGTGCAGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922605797_922605802 11 Left 922605797 1:226889108-226889130 CCCAGTGCTGCACAAGGAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 922605802 1:226889142-226889164 GCTTGCATCCCTTTCTGCAGAGG 0: 1
1: 0
2: 3
3: 15
4: 182
922605797_922605808 21 Left 922605797 1:226889108-226889130 CCCAGTGCTGCACAAGGAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 922605808 1:226889152-226889174 CTTTCTGCAGAGGCCTGGGTGGG 0: 1
1: 0
2: 6
3: 41
4: 351
922605797_922605804 17 Left 922605797 1:226889108-226889130 CCCAGTGCTGCACAAGGAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 922605804 1:226889148-226889170 ATCCCTTTCTGCAGAGGCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 230
922605797_922605803 16 Left 922605797 1:226889108-226889130 CCCAGTGCTGCACAAGGAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 922605803 1:226889147-226889169 CATCCCTTTCTGCAGAGGCCTGG 0: 1
1: 0
2: 1
3: 37
4: 272
922605797_922605807 20 Left 922605797 1:226889108-226889130 CCCAGTGCTGCACAAGGAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 922605807 1:226889151-226889173 CCTTTCTGCAGAGGCCTGGGTGG 0: 1
1: 1
2: 5
3: 47
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922605797 Original CRISPR TGCCCTCCTTGTGCAGCACT GGG (reversed) Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
902908800 1:19579838-19579860 TGGCCTCTTTGGGCTGCACTGGG + Intergenic
904612091 1:31731402-31731424 TGACCTCCTTGAACAGCACTGGG + Exonic
906157527 1:43622513-43622535 TGCCTTCCTCGTGCAGAGCTGGG + Exonic
906326392 1:44848741-44848763 TTCCCTCATTGAGCATCACTGGG + Intergenic
907324543 1:53628453-53628475 TGCCCACCTTGTACAGCACTGGG + Intronic
911298997 1:96150597-96150619 TGCCTTCCTTGAGCAGCTATAGG + Intergenic
912565396 1:110584085-110584107 TGCCCCCACTTTGCAGCACTTGG - Intergenic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
913444884 1:118940524-118940546 GGCCCTACTTGTGCAGAATTTGG + Intronic
915230815 1:154444110-154444132 TGACATCCTTGTGCACAACTGGG + Intronic
916083705 1:161253100-161253122 TGCCTTCCTTGAGCAGCTATGGG + Intergenic
918066598 1:181105652-181105674 TGCGCCCCTTCTGCAGCGCTGGG + Intergenic
922057859 1:222058491-222058513 TGTCCTCTGTGTGCAGCTCTGGG - Intergenic
922605797 1:226889108-226889130 TGCCCTCCTTGTGCAGCACTGGG - Intronic
922764910 1:228151679-228151701 TGTCCTGCCTGTGCAGCAGTAGG - Intronic
1062803056 10:394395-394417 TGTCCTCCTGGTTCAGCACACGG - Intronic
1063033689 10:2262938-2262960 TGACCTTCTTCTGCAGCTCTGGG + Intergenic
1063442956 10:6088659-6088681 TGCCATCCTTTTGCAGCATCTGG + Intergenic
1067759900 10:49037000-49037022 TGATCTCCTAGTGTAGCACTTGG - Intronic
1069024357 10:63523266-63523288 TCCCTTCCTTGTCCAACACTGGG - Intronic
1069565037 10:69458190-69458212 TGGCCTCCCAGTGAAGCACTAGG + Intronic
1071770922 10:88728246-88728268 TGCCATCCATGTCCAGGACTCGG - Intronic
1073573002 10:104596694-104596716 TACCCTCCTTGGACAGAACTGGG + Intergenic
1073704470 10:105967459-105967481 TGCCCTCCCTGTGGGGCTCTAGG - Intergenic
1074101109 10:110355555-110355577 TGCCCTCCCTGAGCTGCACTAGG + Intergenic
1076378968 10:130012075-130012097 TGCACTGCTGGTGCAGCACGGGG - Intergenic
1077366144 11:2162121-2162143 TGCCCTCCTTCTGCCACCCTGGG - Intergenic
1077473588 11:2776196-2776218 TGCCCTCCCTCTGCAGGGCTGGG - Intronic
1080249081 11:30213055-30213077 TGCACTCCTTCTGAAGCATTAGG + Intergenic
1083652099 11:64209687-64209709 TGCCCGGCATGTGCAGCAGTGGG + Intronic
1089146756 11:116335085-116335107 TTCCCTCCTAGGGGAGCACTTGG - Intergenic
1090255580 11:125281402-125281424 AGCCCACCTTGTCTAGCACTGGG - Intronic
1090322314 11:125857859-125857881 AGGCCTCCTTGAGCTGCACTGGG - Intergenic
1094875669 12:34640040-34640062 AGCCCTCCTTGAGCTGCAGTGGG - Intergenic
1096503403 12:52079184-52079206 TGGCCTGCTTGTCCAGCCCTAGG + Intergenic
1098692262 12:73503650-73503672 AGGCCTCCTTGTGCTGCAGTGGG + Intergenic
1101889868 12:108703707-108703729 TACCCTGGTTGTGCAGCCCTGGG - Intronic
1103072642 12:117957507-117957529 TGCCCACCGTGTGCTGCTCTGGG - Intronic
1105072517 12:133243477-133243499 GTCCCTCCTTGTGCAGGCCTAGG + Intergenic
1112481160 13:99776701-99776723 CGGCATGCTTGTGCAGCACTTGG - Intronic
1112907831 13:104446170-104446192 TACCCTCCTTGTCCAGAAGTGGG - Intergenic
1114084469 14:19229366-19229388 AGCCCTCCTTCTGCTGCCCTGGG - Intergenic
1114626922 14:24136225-24136247 TCCACTCCTTGTGCGGCGCTAGG + Exonic
1117710249 14:58521073-58521095 TGCCGACCTTGAGCAGCAGTTGG + Intronic
1120535948 14:85695337-85695359 ATCCCTCCTTGTGCAGCAAGTGG - Intergenic
1120707632 14:87761120-87761142 TGCAGTCCTTGTGCAGCCTTGGG + Intergenic
1121027190 14:90625296-90625318 CCCTCTCCTTGGGCAGCACTGGG - Intronic
1122745433 14:103894715-103894737 TGCCCTCCATGTGGGGCCCTTGG - Intergenic
1122864747 14:104598569-104598591 TGCCCTCTGTGTCCAGCACAGGG - Intronic
1122939591 14:104975282-104975304 TGCCCACCTGGTGCAGCTCAGGG - Intronic
1124995549 15:34720018-34720040 TGCCCTTCTCCAGCAGCACTAGG + Intergenic
1129219392 15:74122759-74122781 TGCCCTCCCTGTGCTGTTCTGGG + Intronic
1129744389 15:78007959-78007981 TGCCCTTCTCCTGCACCACTTGG - Intronic
1130244943 15:82238418-82238440 TGCTCTCCTTGTTCAGAATTTGG + Exonic
1130455685 15:84104686-84104708 TGCTCTCCTTGTTCAGAATTTGG - Intergenic
1131206432 15:90452279-90452301 TTCCCTCATTGTCCTGCACTAGG - Intronic
1131519526 15:93102984-93103006 TGCCCACCTTGTGAATCACCGGG + Intergenic
1132591815 16:729405-729427 GGCCCTCCTTGCGCTGCAGTGGG + Exonic
1132945011 16:2527768-2527790 GGCCCTCCAGGTGCAGCCCTGGG - Exonic
1137511755 16:49106877-49106899 ATCCCACCTTGTTCAGCACTGGG + Intergenic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1137634426 16:49973568-49973590 TGCCTGCCTTTTGCAGCACTTGG - Intergenic
1138520278 16:57567200-57567222 TGCCCTCTTTGTGCAGAAAGGGG - Intronic
1138598676 16:58042586-58042608 TGGCCACCTTGTGCAGCACAGGG + Intronic
1140930657 16:79624761-79624783 TGCTCCCCTTCTGCAGCACATGG + Intergenic
1144512671 17:15890901-15890923 TGCTCTCCATGTGCAGCACGAGG + Intergenic
1146660960 17:34664951-34664973 TGCTCCCCTTCTCCAGCACTTGG + Intergenic
1149695230 17:58611306-58611328 TCACCTCCATGTGCAGCACTGGG + Exonic
1150209947 17:63436394-63436416 TGCCCTCTTTGTGCACAGCTGGG - Intronic
1152189020 17:78876941-78876963 TCCTGTCCTTCTGCAGCACTTGG + Intronic
1153081149 18:1226723-1226745 TGAGCTTCTTTTGCAGCACTTGG - Intergenic
1153739285 18:8106140-8106162 TGCCATTCTTGTGTAGCTCTTGG + Intronic
1157291953 18:46415971-46415993 TGGCCAGCTGGTGCAGCACTGGG - Intronic
1157501821 18:48196148-48196170 TGCCCTCCTTATCCAGACCTAGG + Intronic
1158619775 18:59022887-59022909 TGCTCTCCCTCTGCAGTACTGGG - Intergenic
1162823088 19:13235163-13235185 TGCCCTCCTTGGGAGGCTCTGGG + Intronic
1164599177 19:29549472-29549494 GGACCTCCTGGGGCAGCACTGGG - Intronic
1168685459 19:58346934-58346956 TCCCCTCCTGTTGCAGCACAAGG - Exonic
925559116 2:5168830-5168852 TGCCCTGCTTCTGCTACACTGGG - Intergenic
925858758 2:8154992-8155014 TGCTCTTCTTGTCCTGCACTTGG + Intergenic
925889537 2:8422326-8422348 GACCCTCCCTGTGCAGCAGTGGG + Intergenic
929175215 2:38968966-38968988 TGCCCTTCCTGTGCTACACTGGG - Intronic
929946604 2:46376969-46376991 ACCCCTCCTCGTACAGCACTTGG - Intronic
935432415 2:102990352-102990374 TTCCCTCCTTGCCCATCACTTGG - Intergenic
936009720 2:108917808-108917830 TGCCAACCTTGGGCAGCAATGGG + Intronic
938122072 2:128641080-128641102 TCCCCTCTCTGTCCAGCACTTGG - Intergenic
939644165 2:144675882-144675904 TGCTCTCCTTGATCAGCAATAGG + Intergenic
941274311 2:163471440-163471462 TGCTCTCTTTCTTCAGCACTGGG + Intergenic
941865542 2:170330538-170330560 TGACCTACATGTGAAGCACTTGG + Intronic
942551598 2:177125735-177125757 TGCCGTCTTTGGGCATCACTTGG + Intergenic
942953814 2:181751115-181751137 TGAACTCATTGTTCAGCACTGGG + Intergenic
943064994 2:183076243-183076265 TGCACTCCTGTTTCAGCACTTGG + Intergenic
946034360 2:216730016-216730038 TGCCCTCCTGTTGGAGCACCTGG - Intergenic
946057172 2:216912423-216912445 TAGCCTACCTGTGCAGCACTCGG + Intergenic
948607506 2:239145496-239145518 GGCCCGCCTTGGGAAGCACTAGG + Intronic
1168901967 20:1372380-1372402 CCACCTCCTTGTGCAGGACTTGG + Intronic
1171423310 20:25033268-25033290 TGCCCTCCGTCTGCAGAACAGGG - Intronic
1172180104 20:32997789-32997811 TGCCAGCATTGTGCAACACTGGG + Intronic
1172202486 20:33136281-33136303 TGCCCTCCTTATGCCCCACATGG + Intergenic
1172920115 20:38473692-38473714 TGCCCTAATTGTTAAGCACTTGG - Intronic
1173105745 20:40132412-40132434 TGCCTTTGTTGAGCAGCACTTGG + Intergenic
1174767042 20:53264375-53264397 AGGGCTCCTTATGCAGCACTGGG + Intronic
1175632404 20:60552724-60552746 TGCCCACCCTGTGCAGGATTGGG - Intergenic
1175716970 20:61261614-61261636 TTCCCTCTTTGTGCAGTCCTAGG + Intronic
1175929052 20:62485027-62485049 TGCCCTGCTGGTGCAGGGCTGGG - Intergenic
1176233004 20:64041590-64041612 GCCCCTCCATGTGCCGCACTGGG + Intronic
1177603057 21:23340359-23340381 TGCCCTCCTTGTGTAGGAAAGGG + Intergenic
1178901840 21:36604979-36605001 TTCCCTCCTGGTCCAGCAATTGG - Intergenic
1179999797 21:44990324-44990346 TGGCCTCTCTGTGCAGCACCTGG + Intergenic
1180085773 21:45507288-45507310 TGCCCTCCCTGCCCAGCACCCGG - Intronic
1180085790 21:45507332-45507354 TGCCCTCCCTGCCCAGCACCCGG - Intronic
1180293503 22:10863836-10863858 AGCCCTCCTTCTGCTGCCCTGGG + Intergenic
1180496308 22:15893251-15893273 AGCCCTCCTTCTGCTGCCCTGGG + Intergenic
1181150833 22:20882128-20882150 TGCACTCCTTCTGGAGCTCTTGG - Intronic
1181330472 22:22086941-22086963 TGGCCTCCCTGGGCACCACTGGG + Intergenic
1183965134 22:41436958-41436980 TGATCTCCTTGTCCAGCTCTGGG + Exonic
1184771881 22:46601947-46601969 AGCCCTTCTTGGGCAGCTCTTGG + Intronic
1185417788 22:50719835-50719857 AGCCCTCCCCGTGCAGCCCTGGG + Intergenic
949110157 3:250539-250561 TGTCCTCCTGGTACAGCAGTGGG + Intronic
954459804 3:50619861-50619883 TGCTCTCCTTGTTCTGGACTGGG + Intronic
954537061 3:51368576-51368598 AGCCCTCCTTGAGCTGCAGTGGG - Intronic
958440204 3:94147185-94147207 TGCCTACCTTGTGCACCCCTGGG + Intergenic
959946665 3:112132736-112132758 TGACCTCCTTGTGGAGCATGAGG + Intronic
960297476 3:115961542-115961564 TGCCCTTCATTGGCAGCACTGGG - Intronic
961372760 3:126441389-126441411 TGCCCTTCTTCTGCAGGGCTGGG - Intronic
961764190 3:129195578-129195600 TGCCCACCTTGTGGAGCTTTGGG + Intergenic
965875508 3:173313394-173313416 TGCTCTTCTTCTGCTGCACTTGG - Intergenic
968506146 4:972328-972350 AGGCCACCTTGTGCAGCCCTGGG + Intronic
968602734 4:1518023-1518045 TGGCCTCCTGGGGCAGCACCAGG + Intergenic
968750899 4:2388465-2388487 TTCCCTTCTTGTGCAGCAGTGGG - Intronic
976549829 4:86381417-86381439 TGCTCTCCTTGTGCAGGTCCCGG + Intronic
977002029 4:91516975-91516997 TGCCCTCCTTGTTTGGCTCTTGG + Intronic
977971318 4:103217561-103217583 GGCCCTGCTTCTACAGCACTTGG + Intergenic
983364628 4:166769807-166769829 AGGCCTCCTTGAGCAGCAGTGGG + Intronic
986717039 5:10532393-10532415 TGTGCTCCTTGTGCAAAACTAGG - Intergenic
988279103 5:29122572-29122594 TGATCTCCCTGTGCAGCATTTGG + Intergenic
989674075 5:43953394-43953416 TGGCCTCCTTGAGCTGCTCTGGG - Intergenic
992049377 5:72928985-72929007 TGCCTTCCTTGAGCAGCTATGGG + Intergenic
993746942 5:91611959-91611981 TGCCCTCGTTCAGCAGCTCTGGG - Intergenic
997021082 5:130002396-130002418 TGCCCCAGTTGCGCAGCACTTGG + Intronic
997658152 5:135570284-135570306 TGCCGTCCTTATGCAGCCCCAGG + Intergenic
998241734 5:140452242-140452264 AGGCCTCCTTGAGCAGCAGTGGG - Intronic
1001480492 5:172085946-172085968 ACCCCTCCTTGTGCTGCTCTTGG - Intronic
1002807205 6:588735-588757 TGCGCACCTTGTTCATCACTTGG - Intronic
1002871098 6:1167837-1167859 GGCCCTCCTTCTGCAGGGCTTGG - Intergenic
1002879143 6:1236105-1236127 TCCCTGCCTTGTCCAGCACTGGG + Intergenic
1003641391 6:7878408-7878430 TACCCACCCTGTGCAGCACAGGG - Intronic
1004866305 6:19856648-19856670 TGCCCAGCTGGTGCAGGACTCGG - Intergenic
1005221611 6:23594523-23594545 TGCCCTCATTGTGCAGCAGCAGG + Intergenic
1010035574 6:71321731-71321753 GGGCCTCTTTGTGCAGCAGTTGG + Intergenic
1011751847 6:90461798-90461820 TGCCTTCTTTGTGAAGAACTGGG - Intergenic
1012441544 6:99266134-99266156 TGCCTTCCTTGAGCAGCTATGGG - Intergenic
1012827382 6:104163117-104163139 TGCCATGCTTGAGTAGCACTGGG - Intergenic
1017405830 6:154117134-154117156 TGCCCACCTTCTGCACCATTTGG + Intronic
1017719051 6:157232391-157232413 TGCCCTGCTTCTGCAGGACTGGG - Intergenic
1019712720 7:2524840-2524862 TGCCCTCCCTGTCCTGCCCTTGG - Intronic
1024134224 7:46390207-46390229 TGCCATCCTTGGCCAGCAATGGG - Intergenic
1024791024 7:52964892-52964914 TGCCCTCCTCGTGGAGCCTTGGG - Intergenic
1032264076 7:130358582-130358604 TGCCCTTTGTTTGCAGCACTGGG - Intronic
1032594425 7:133225245-133225267 TGCCCTCTTTCAGAAGCACTGGG + Intergenic
1033174821 7:139114234-139114256 TGGCCTCTTTGAGCAGCAGTGGG + Intergenic
1033310728 7:140260047-140260069 TTCCCTCCTTGTGCACTGCTTGG - Intergenic
1034429468 7:151033960-151033982 TGCCATCCCTTTGCAGCTCTGGG - Intronic
1034672746 7:152870522-152870544 TGCCTTCCATGTCCAGCCCTGGG - Intergenic
1035727875 8:1835650-1835672 TGACCTCCTTTTGCAGGCCTGGG + Intronic
1037070963 8:14648555-14648577 TGAATTCCTTATGCAGCACTGGG + Intronic
1037753960 8:21699702-21699724 TGCCCTCTGTGCGCAGGACTGGG - Intronic
1040286435 8:46102888-46102910 CGCCCTCCTGGAACAGCACTCGG + Intergenic
1040302221 8:46194023-46194045 TGCCGGCCTGGGGCAGCACTGGG - Intergenic
1041834241 8:62194065-62194087 TGCACTGCCTGTGCCGCACTTGG + Intergenic
1042683923 8:71416659-71416681 TGCCCTCCAAGTGTAGCCCTTGG + Intronic
1043655074 8:82653822-82653844 TGCCCTGTTTGTGCAGCATTAGG - Intergenic
1047597382 8:126392571-126392593 TGCCCTCCATCTCCAGCTCTTGG + Intergenic
1048924369 8:139258212-139258234 TTCCCTCCCTGTGCCTCACTTGG + Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053493875 9:38534204-38534226 TTCCCTTCTTGTGCAGAGCTAGG - Intergenic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1055442900 9:76354122-76354144 TGTCGTCCATGTGCAGCACCAGG - Exonic
1057090111 9:92250399-92250421 GGCCCTCCTGGTGAAGCACTGGG + Intronic
1057324692 9:94050832-94050854 AGGCCTCCTTGAGCTGCACTGGG + Intronic
1057674619 9:97129049-97129071 TTCCCTTCTTGTGCAGAACTAGG - Intergenic
1060339323 9:122759528-122759550 AGCCCTCCTTGAGCTGCAGTGGG - Intergenic
1061952180 9:133942796-133942818 AGTCCTCCTGGTGCAGCTCTGGG + Intronic
1062033349 9:134371953-134371975 TGCCAGCCTGGTGCAGGACTGGG + Intronic
1062187547 9:135226824-135226846 TACCATCCTTGTGCAGCCCCTGG + Intergenic
1186505933 X:10092192-10092214 AGGCCACCATGTGCAGCACTAGG - Intronic
1186976818 X:14916470-14916492 TGACCTCCTTGAGCAACACCAGG - Intronic
1187486076 X:19705607-19705629 TGCCCTCCCAGTGCCACACTGGG + Intronic
1189200017 X:39185981-39186003 AGGCCTCCTTGAGCAGCAGTGGG + Intergenic
1195340566 X:103902739-103902761 TGGCCTCCTTGAGCTGCAGTGGG + Intergenic
1198813208 X:140557828-140557850 TGCACTCCTTCTGGAGCCCTTGG - Intergenic
1199616622 X:149660873-149660895 TGCCATCATTGTGCAGTGCTGGG + Intergenic
1199626019 X:149742375-149742397 TGCCATCATTGTGCAGTGCTGGG - Intergenic
1202020784 Y:20462880-20462902 TGGCCTCCTTGAGCTGCAGTGGG + Intergenic