ID: 922606421

View in Genome Browser
Species Human (GRCh38)
Location 1:226892474-226892496
Sequence CCTGGCACGCAGCAGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922606421_922606428 -5 Left 922606421 1:226892474-226892496 CCAGCCCACTGCTGCGTGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 306
Right 922606428 1:226892492-226892514 CCAGGCAGCACCCTGGAGCAGGG 0: 1
1: 0
2: 0
3: 51
4: 514
922606421_922606426 -6 Left 922606421 1:226892474-226892496 CCAGCCCACTGCTGCGTGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 306
Right 922606426 1:226892491-226892513 GCCAGGCAGCACCCTGGAGCAGG 0: 1
1: 0
2: 2
3: 40
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922606421 Original CRISPR CCTGGCACGCAGCAGTGGGC TGG (reversed) Intronic
900282758 1:1881830-1881852 CCTGGCACACAGTATTGTGCGGG + Intronic
900478689 1:2888012-2888034 TCTGTCACCCAGCACTGGGCTGG - Intergenic
900569306 1:3350568-3350590 GGTGGCAGGCAGCTGTGGGCGGG + Intronic
900992771 1:6105615-6105637 CCCAGGAAGCAGCAGTGGGCAGG + Intronic
901217307 1:7561946-7561968 CCTGGAACACAGGACTGGGCAGG - Intronic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
902328206 1:15716640-15716662 CCTGGGAAGCTGCAGTCGGCTGG - Intronic
902473330 1:16665841-16665863 CCTGACACGCATCAGTGCCCTGG - Intergenic
902485473 1:16741601-16741623 CCTGACACGCATCAGTGCCCTGG + Intronic
902919681 1:19658320-19658342 CCAGGCAGGAGGCAGTGGGCTGG - Intronic
903098388 1:21003136-21003158 ACCGGCACGCAGCACTGTGCCGG + Intronic
903180814 1:21603912-21603934 ACTGGCAAGCAGCAGAGGGCGGG + Intronic
903576669 1:24343603-24343625 CCTGGCAGCCAGGAGTGGGCTGG + Intronic
904828143 1:33288997-33289019 CATGGCACCCAGCATGGGGCTGG - Intronic
905060864 1:35137793-35137815 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
905112771 1:35609184-35609206 CCTGGGAAGCAGCTGAGGGCAGG + Intronic
906244124 1:44261256-44261278 CGTGGCACGCCCCAGCGGGCAGG + Intronic
906478499 1:46185588-46185610 CCTGGCAAGCAGCAGTGATTGGG + Exonic
906546672 1:46624308-46624330 CCAGGCAGGCAGCAGTGGCAGGG - Intergenic
906783010 1:48589374-48589396 CCTGGCTTGAAGCAATGGGCAGG + Intronic
906818038 1:48899174-48899196 CCTGGCGTGTAGCCGTGGGCAGG + Intronic
906951005 1:50334464-50334486 CCTGGGATACAGCAGTGAGCAGG + Intergenic
907258303 1:53196951-53196973 CCAGGCGCGCAGCAGCAGGCGGG - Exonic
907427602 1:54390759-54390781 CCTGGCCCGCAGCTCCGGGCAGG - Intronic
908108922 1:60875241-60875263 CATGGCAGGCAGCAGTTTGCTGG - Intronic
908179035 1:61585901-61585923 CCTGGCAAGCAATACTGGGCGGG - Intergenic
915633852 1:157172975-157172997 CCTGGTGGGCAGCAGTGAGCAGG - Intergenic
918091164 1:181296292-181296314 CCTGGGACGGATCAGTGGGTGGG + Intergenic
920112548 1:203597532-203597554 CCTGGCACACAGCAGTTGCTTGG + Intergenic
920815441 1:209327127-209327149 CCTGCCACGCCCCTGTGGGCTGG + Intergenic
921193181 1:212727339-212727361 CCTGGCACTCAGCACATGGCAGG + Intronic
922043112 1:221916395-221916417 GCTGGCACACAGCAGCTGGCTGG + Intergenic
922474777 1:225899335-225899357 CCTGGAGGGCAGCAGGGGGCAGG - Intronic
922606421 1:226892474-226892496 CCTGGCACGCAGCAGTGGGCTGG - Intronic
922671046 1:227508955-227508977 TCTGGCAGGGAGTAGTGGGCAGG + Intergenic
1063367145 10:5498542-5498564 CCTGACGCGGAGCAGAGGGCAGG - Intergenic
1065958191 10:30711251-30711273 CCTGTGACACAGCAGTGGGGAGG + Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1067082310 10:43218595-43218617 CCAGGCAGGCATCAGAGGGCAGG + Intronic
1070584205 10:77748785-77748807 CCTGAAACCCAGCAGTGGGATGG - Intergenic
1070982375 10:80659971-80659993 CCCGGCACCCAGCACTGGGCAGG - Intergenic
1071085709 10:81866737-81866759 CCTGGAACACAGAAGTGGGAAGG - Intergenic
1071532658 10:86401302-86401324 CCTGGCACGGAGCAGCGGGAAGG - Intergenic
1071571254 10:86698689-86698711 CCTGGCGAGCAGGGGTGGGCAGG + Intronic
1073059483 10:100724735-100724757 CCAGGCCCGCAGCTGTAGGCCGG + Intergenic
1074157082 10:110808510-110808532 CCAGGAACTCAGCACTGGGCAGG - Intronic
1074903599 10:117840569-117840591 CCTGGCAGCCAGGAGTGGCCAGG - Intergenic
1075781869 10:125022419-125022441 CCTGGCACATAGCAGGGGACAGG + Intronic
1075912126 10:126133638-126133660 CCTGGCACCCATCACTGGGGGGG + Intronic
1078594520 11:12674751-12674773 CCGGGCACCGAGCAGAGGGCGGG + Exonic
1078663339 11:13304604-13304626 CCTGGCACACAGCAGAGGTGAGG + Intronic
1078744291 11:14096555-14096577 ACTGGCAGGGAGCAGTGGGTGGG - Intronic
1080434892 11:32230742-32230764 CCTGGAAAGCTGCAGTGAGCCGG - Intergenic
1081441920 11:43090152-43090174 CCTGTCACGCATCTGTGGTCTGG - Intergenic
1082789905 11:57339906-57339928 CCTGGTAGGCTTCAGTGGGCAGG + Intronic
1083048412 11:59755951-59755973 AGTGCCAGGCAGCAGTGGGCAGG - Intronic
1083298922 11:61730193-61730215 CCTGGCAAGCAGAAATGGGCTGG - Intronic
1083632630 11:64103719-64103741 CCTGGCACCCAGCCCTGAGCAGG - Exonic
1083889895 11:65590443-65590465 CCTGACACGGGGCAGGGGGCAGG + Intronic
1084296590 11:68216259-68216281 CCTGACACACAGGACTGGGCAGG - Intergenic
1088693774 11:112349171-112349193 CCTGGCAGGCAGCAATGGCCTGG + Intergenic
1089620909 11:119721680-119721702 CCTGGCCCGGAGCAGAGAGCAGG - Intronic
1089641012 11:119847202-119847224 CCTGCCATGCTGCATTGGGCTGG - Intergenic
1095810958 12:46372810-46372832 CCGGGGACGCGTCAGTGGGCGGG + Exonic
1095812179 12:46383239-46383261 CCTGGGGCGCTGCAGCGGGCGGG + Intergenic
1096122017 12:49094436-49094458 CCCGGCCCGCAGCTCTGGGCTGG + Exonic
1096444331 12:51675199-51675221 CCTGGGAAGCAGCATTGTGCTGG + Intronic
1097704821 12:62857175-62857197 CCTAGCACCCAGCAAAGGGCTGG + Intronic
1097927683 12:65147959-65147981 CCTGGGATGCTGGAGTGGGCGGG + Intergenic
1101989297 12:109471332-109471354 CATGGCACCCAACAGTGGCCTGG + Intronic
1102259482 12:111435647-111435669 CCTGGCTCCCTGCAGTGGGTGGG - Intronic
1102550091 12:113685388-113685410 CCTGCCACGCAGCATTAGGCCGG + Intergenic
1103146340 12:118598340-118598362 CCTGGATCTCAGCTGTGGGCAGG - Intergenic
1104000713 12:124858054-124858076 CCTGGCATGCAGCTGTGCTCAGG - Intronic
1104760953 12:131297336-131297358 CCAGGCTCCCAGCAGTGAGCTGG + Intergenic
1104818825 12:131663456-131663478 CCAGGCTCCCAGCAGTGAGCTGG - Intergenic
1104984407 12:132588527-132588549 CCTGGCACGCAACAGGGGCCAGG + Intergenic
1105957818 13:25300979-25301001 CCTGGCGCCCAGAAGTGGCCAGG - Intergenic
1109353457 13:61211087-61211109 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1111642380 13:90984868-90984890 GCTCGCACTCAGCAGTAGGCAGG + Intergenic
1113385013 13:109840707-109840729 CCTGCCACTCAGAAGTGGCCTGG - Intergenic
1116185827 14:41599848-41599870 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1117191592 14:53297774-53297796 GCTGGAAGGCAGCATTGGGCAGG + Intergenic
1117360181 14:54965190-54965212 CCTGGCATACAGCAGTGAGCAGG + Intronic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122884107 14:104702958-104702980 TGTGGCCCACAGCAGTGGGCTGG - Intronic
1123021742 14:105401113-105401135 CCTGGCAGGCGGAAGTGTGCAGG - Intronic
1123134849 14:106018177-106018199 ATTGGCAGGTAGCAGTGGGCAGG + Intergenic
1123165364 14:106320446-106320468 GTTGGCAGGTAGCAGTGGGCAGG + Intergenic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1124018855 15:25902078-25902100 CCTGCCAAGCACCAGTGAGCTGG + Intergenic
1125679698 15:41523095-41523117 CCTAGCAGGCAGCAGTGGGGTGG - Intronic
1125754937 15:42057166-42057188 CCTGTCACGCAGCACTGGTGAGG - Intergenic
1128391860 15:67187651-67187673 CCTGGCAGGCAGGAGGGGCCGGG + Intronic
1129678755 15:77646286-77646308 CCTGCCACAGAGCAGTGGGCGGG + Intronic
1129736751 15:77970762-77970784 CCTGCCACCCAGCAGAGGGCCGG - Intergenic
1129849324 15:78782871-78782893 CCTGCCACCCAGCAGAGGGCCGG + Intronic
1132542046 16:514746-514768 CCTGGCAGGCTGCAGAGAGCTGG + Intronic
1132546519 16:535796-535818 CCTGGCCCACAGCAGAGGCCCGG + Intronic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1132951372 16:2564221-2564243 CCTGGCAAACAGAAGTGAGCAGG + Intronic
1132962978 16:2635949-2635971 CCTGGCAAACAGAAGTGAGCAGG - Intergenic
1133238552 16:4401452-4401474 CCTGGCACGCAGCAGGTGCTTGG - Intronic
1134219420 16:12341944-12341966 CCTGGCACGAAGCACTGTGCTGG - Intronic
1134259101 16:12636550-12636572 CCTGGCAGGCTGCAGTGCGATGG + Intergenic
1134443109 16:14311000-14311022 CCTGGCAGGCTGCAGGGGGTGGG - Intergenic
1134521527 16:14921132-14921154 ACAGGGACGCAGCACTGGGCTGG + Intronic
1134709198 16:16319783-16319805 ACAGGGACGCAGCACTGGGCTGG + Intergenic
1134716407 16:16359812-16359834 ACAGGGACGCAGCACTGGGCTGG + Intergenic
1134950407 16:18348862-18348884 ACAGGGACGCAGCACTGGGCTGG - Intergenic
1134958343 16:18392347-18392369 ACAGGGACGCAGCACTGGGCTGG - Intergenic
1136247785 16:28985307-28985329 CCCGGCAGGGAGCAGGGGGCAGG - Intronic
1136278177 16:29191777-29191799 CATGGCACCCAGCAGTGGCGAGG - Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1137567863 16:49544734-49544756 GCTGGCATGCAGCAGTGACCTGG + Intronic
1138441214 16:57036193-57036215 CCTGGTACCCAGCGGTGGGGTGG - Intronic
1138510097 16:57503769-57503791 CCTGGCACCCATGAGTGTGCAGG - Intergenic
1139550330 16:67669261-67669283 CCTGGCAGGCAGGGGTGGACAGG + Intergenic
1139588876 16:67922085-67922107 CCTGGGACTCGGCAGAGGGCGGG - Intronic
1139604660 16:68009536-68009558 CATGGCACGCAGCAGTCAGACGG + Intronic
1142032095 16:87843714-87843736 ACTGGCACGGAGCAGGAGGCCGG + Intronic
1142082555 16:88157817-88157839 CATGGCACCCAGCAGTGGCGAGG - Intergenic
1142207804 16:88792256-88792278 CATGGCAGGCGGCAGGGGGCCGG - Intergenic
1142519030 17:492206-492228 CCTGGCACGCGCCTGTGTGCTGG + Intergenic
1142716264 17:1748576-1748598 CCTGAAACCCAGCAGAGGGCAGG - Exonic
1142752292 17:1996232-1996254 CCTGGAAAGCAGCAGTGACCTGG - Intronic
1142933416 17:3307839-3307861 CCTGGCCTGCAGCATGGGGCTGG - Intergenic
1143098070 17:4489071-4489093 CCAGGCGGGCAGCAGTGGGGAGG + Intergenic
1144583010 17:16470577-16470599 CCTGGCACCCAGCTGAGGCCTGG - Intronic
1145891642 17:28420504-28420526 CCTGGGAGGCAGCAGAGGGCAGG - Intergenic
1146696027 17:34909653-34909675 CCTGGCTCTCAGCAATGGGATGG - Intergenic
1148165535 17:45481807-45481829 GCTGGGAAGCAGCAGTGGGGAGG + Intronic
1148223695 17:45883162-45883184 CCTGGCACGCTGCTGTGCCCTGG - Intergenic
1148743705 17:49907172-49907194 CCTGGCATGCTGCAGGGTGCTGG - Intergenic
1149590297 17:57824246-57824268 CCTGGCACTCAGCATTGTGAAGG - Intergenic
1150396762 17:64828525-64828547 GCTGGGAAGCAGCAGTGGGGAGG + Intergenic
1150417246 17:64997443-64997465 ACTGGCTCCCTGCAGTGGGCTGG + Intergenic
1150659032 17:67059558-67059580 TCTGGCAAGCAGCATTTGGCGGG - Intergenic
1150794418 17:68226479-68226501 ACTGGCTCCCTGCAGTGGGCTGG - Intergenic
1151449726 17:74191076-74191098 GCTGGCACACAGGGGTGGGCTGG + Intergenic
1151765839 17:76132743-76132765 CCCGGCAGGGGGCAGTGGGCTGG - Intergenic
1151931934 17:77237908-77237930 CGTGGCAGCCAGCAATGGGCTGG + Intergenic
1152205883 17:78974125-78974147 CCTGGCAAAGGGCAGTGGGCAGG + Intronic
1152386438 17:79977518-79977540 CCTGGCACGCAGCAGGATGGGGG + Intronic
1152579186 17:81158581-81158603 CCAGGCTCGGGGCAGTGGGCAGG - Intronic
1152697849 17:81805414-81805436 CCCGGCAGGCAGCTGTGGGAGGG + Intronic
1152911455 17:83007595-83007617 CCAGGCTCTCAGGAGTGGGCTGG - Intronic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1155343026 18:24831764-24831786 CTTGGCACGCAGGAGGGGGTTGG + Intergenic
1155574774 18:27232504-27232526 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1156812895 18:41274009-41274031 CCAGGCACGCAGCAGGTGGATGG + Intergenic
1159348275 18:67236001-67236023 CCTGCCAGGCAGCATTGGGACGG + Intergenic
1160566866 18:79791359-79791381 CCTGGCACACGGCACTGGGTAGG + Intergenic
1160941519 19:1622312-1622334 CCTGCCACGTAGAAGGGGGCGGG + Exonic
1161024955 19:2032503-2032525 CCTGGCAGGCGGCCGGGGGCAGG + Intronic
1161151333 19:2711601-2711623 CCTGGGACGGAGCACTGGACAGG - Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162509895 19:11111678-11111700 CCTTGCAGGCAGCAGTGGTGGGG + Intronic
1162894793 19:13758846-13758868 CCTGGGAGGGAGCGGTGGGCAGG - Exonic
1163405862 19:17121842-17121864 ACAGGCACGCAGCACTGTGCCGG - Intronic
1163625805 19:18388816-18388838 GCGGGCACGCAGCAGGGCGCTGG - Exonic
1163769518 19:19182366-19182388 CCAGGCACACAGCAGAGCGCAGG + Intronic
1164158036 19:22608222-22608244 CCTGCCCCGCAGGAGGGGGCTGG - Intergenic
1164442429 19:28289495-28289517 CCTGGCCTGCAGCTGAGGGCTGG - Intergenic
1165105102 19:33464522-33464544 CCTGTCACCCACCCGTGGGCAGG - Intronic
1166661457 19:44649914-44649936 CCTGGCACTCAGACCTGGGCGGG + Exonic
1167342289 19:48922937-48922959 CCTGGCACCCAGCTGTGGAGGGG - Exonic
1167449349 19:49557789-49557811 CCTGGCGCACAGCAGTTGCCTGG + Intronic
1167674731 19:50877275-50877297 CCTGGGAAGCAGCAGTGAACAGG + Intronic
925462266 2:4073761-4073783 CGTGGCACATAGCAGTGGCCAGG - Intergenic
925901724 2:8513825-8513847 CTGGGCACGAAGCAGGGGGCCGG + Intergenic
926174158 2:10574174-10574196 CCTAGCATGCAGCACAGGGCAGG + Intronic
927216666 2:20671303-20671325 GCTGGCACACAGCAGGAGGCCGG - Exonic
927494189 2:23541512-23541534 CCAGGCACTCAGCACTGTGCTGG - Intronic
927869329 2:26613745-26613767 CCTGGCACACAGAAGGGGCCTGG + Intronic
929893614 2:45939042-45939064 CCTGGCAGGGTGCTGTGGGCTGG - Intronic
933313644 2:80690326-80690348 CCTGGGACACAGCAGAGGGAAGG + Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
935507579 2:103925353-103925375 CCTGGCCTGCAGCATGGGGCTGG + Intergenic
937228467 2:120383311-120383333 CCTGCTATGCAGCATTGGGCAGG + Intergenic
937304402 2:120862346-120862368 CCTGGCACACAGCAGGAGCCTGG - Intronic
938383263 2:130848370-130848392 CCTGGCACCCAGCACGGGCCTGG - Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
942729807 2:179051758-179051780 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
944615215 2:201452176-201452198 CCCGGCAGGCACCACTGGGCGGG - Intronic
946330292 2:219005266-219005288 TTTGGGAGGCAGCAGTGGGCGGG - Intronic
946746714 2:222853720-222853742 ACTGGCAAGGATCAGTGGGCAGG - Intergenic
947248884 2:228079387-228079409 CCTGGCCCACAGCACTAGGCTGG + Intronic
948619713 2:239226804-239226826 GCTGGCAGGCAGCAGTGTCCTGG + Intronic
948864902 2:240770289-240770311 CCTGGTGCCCAGCAATGGGCCGG - Intronic
1168949050 20:1783968-1783990 ACTTGGAGGCAGCAGTGGGCTGG + Intergenic
1169483271 20:6004898-6004920 CCTGGCAAGAGGGAGTGGGCAGG - Intergenic
1170075402 20:12413240-12413262 CTTGGCAAGCAACAGTGGGTCGG + Intergenic
1170572093 20:17638177-17638199 CCTGTCTGCCAGCAGTGGGCCGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171444224 20:25192307-25192329 CCAGACATGCAGCAGTGAGCAGG + Intergenic
1174222866 20:48971495-48971517 CCTGGAACTCAGAAGTGGGCAGG + Intronic
1174368273 20:50069383-50069405 GCAGGCAGGCAGCAGTGGGCAGG - Intergenic
1175575134 20:60055380-60055402 CCTGGGACGCAGCAGTGAGAGGG - Intergenic
1175766537 20:61596437-61596459 CCATGCACCCAGCAGTGTGCAGG - Intronic
1175867105 20:62184703-62184725 CCTGACACACAGCACAGGGCAGG + Intronic
1176271378 20:64236670-64236692 CCTGGCACCCAGCCATGAGCAGG - Intronic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1177187990 21:17819190-17819212 CCTGGCGCGCAGCAGCGCGAGGG + Intronic
1178269036 21:31172582-31172604 CCAGGCATGCAGCAGGGGACCGG + Intronic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1180716064 22:17873248-17873270 CCATGCACGCAGCAGTGCCCAGG + Intronic
1180926158 22:19556378-19556400 CCTGGCACTCAGCAGGTGCCAGG - Intergenic
1180993664 22:19953801-19953823 CCCGGCTCCCAGCAGAGGGCAGG - Intronic
1181163794 22:20973119-20973141 CCTGGCACGAAGCAGCGGAGGGG - Intronic
1181591070 22:23884887-23884909 CCTGGCAGGAAGCAGAGGACAGG - Exonic
1182423024 22:30257677-30257699 CTCGCCACGCAGCACTGGGCAGG - Intergenic
1183452648 22:37905545-37905567 CCCGGCAGGCCGCAGTGGGGAGG + Intergenic
1183471142 22:38007361-38007383 CCAGGCAGGCAGCAGTAGGGTGG + Intronic
1183648180 22:39138777-39138799 CCTGACAGACAGCAGAGGGCGGG - Intronic
1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG + Intronic
1184369407 22:44073041-44073063 CCTGGCACGGGGCACTGGGTGGG - Intronic
1184481821 22:44752589-44752611 CCCGGCACGCAGGTGGGGGCCGG + Exonic
1185344413 22:50305133-50305155 CCTGGGACGCGGGCGTGGGCAGG - Intronic
949262225 3:2116054-2116076 CCTGGCACTCATCATTGGGTTGG + Intronic
950131439 3:10549724-10549746 CCTGGCAGGGAGCACAGGGCAGG - Intronic
950443580 3:13023476-13023498 CCTGGCACCCAGCAGGGCCCTGG + Intronic
950562793 3:13744841-13744863 CCTGGTTCTCAGCAGGGGGCAGG - Intergenic
950685909 3:14618577-14618599 CCTGGCACACAGCATGGAGCTGG - Intergenic
951315834 3:21189191-21189213 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
951720202 3:25689707-25689729 CCTGGGAGGCAGCAGGGGCCAGG + Intergenic
951826345 3:26873448-26873470 CTTGGCACTCAGGAGTGGGTGGG - Intergenic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
952979747 3:38725113-38725135 CCAGACACTGAGCAGTGGGCTGG - Intronic
954361025 3:50122920-50122942 CCTGGCTCTCAGCTCTGGGCGGG + Intergenic
955782544 3:62500743-62500765 TCTGGCAGGCAGCAGTGGGTGGG + Intronic
956420914 3:69085509-69085531 CCTGGCACGCGGGCGGGGGCAGG - Intronic
956858530 3:73299863-73299885 CCTGGCACAGTGCAGTGGGAGGG - Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
961512167 3:127409693-127409715 CCTTCCATGCAGCTGTGGGCTGG - Intergenic
961863099 3:129933717-129933739 CCTGACCCCCAGGAGTGGGCTGG - Intergenic
962273073 3:133992467-133992489 CCAGGCAGGCAGAAGAGGGCAGG + Intronic
964501721 3:157355278-157355300 CCAGGCACGCTGCTGTAGGCAGG - Intronic
967258101 3:187613699-187613721 CCTGGCATGCAGCAGCAGGGAGG + Intergenic
968647371 4:1747478-1747500 CTGGGCACGCAGCCGTGGCCTGG + Intergenic
968661623 4:1801069-1801091 CCTGGCACGCCTCTCTGGGCAGG + Intronic
968727574 4:2255472-2255494 CCTGGAGAGCAGCAGTGGCCTGG + Intronic
968909261 4:3469327-3469349 TCTGGCAGGCAGCACTGGGCTGG - Intronic
968937943 4:3623274-3623296 CCTGGCATGCAGGAGTAGCCTGG - Intergenic
969314150 4:6371450-6371472 CTGGGCACCCAGCAGTGGTCAGG - Intronic
969318645 4:6397017-6397039 GCTGGCTCGCATCAGTGCGCGGG - Intronic
969460637 4:7326995-7327017 CTTGCCAAGCAGCTGTGGGCAGG - Intronic
969620701 4:8277389-8277411 CCTGGCCCGCTGCAGTGGGCAGG - Intronic
969669885 4:8583765-8583787 CCTGGCAGGCAGGAGAGAGCTGG - Intronic
971876715 4:32318118-32318140 CCTGGCAGGCTGCACTTGGCTGG + Intergenic
972072431 4:35038436-35038458 CCTGGCACTCAGCGGTGACCCGG - Intergenic
973130057 4:46638795-46638817 TTTGGCACTCAGCAGTGGCCAGG + Intergenic
973336790 4:48964710-48964732 CTTGGGAAGCTGCAGTGGGCAGG + Intergenic
980197403 4:129608448-129608470 CCTTCCACCCAGTAGTGGGCTGG - Intergenic
982611198 4:157575626-157575648 CCTGGCAGGCTGCAATCGGCTGG - Intergenic
985551877 5:537903-537925 CCTCCCCGGCAGCAGTGGGCTGG - Intergenic
985662544 5:1164317-1164339 CCTGGTAAGCGGCAGTGGGTGGG + Intergenic
985832845 5:2248613-2248635 CCAGGCACACATCAGTGAGCAGG - Intergenic
986249613 5:6044411-6044433 CAAGGCAGGTAGCAGTGGGCAGG + Intergenic
987030875 5:13975438-13975460 CCTGGCACAGAGCTATGGGCTGG - Intergenic
987088824 5:14492839-14492861 CCTGGCAGGCAGCAGAGGGAGGG + Intronic
991087737 5:62663789-62663811 CCTGGGAGACAGCAGTGAGCTGG - Intergenic
995858237 5:116615757-116615779 TCTGGCGGGCAGCAGTGGGGTGG + Intergenic
997255928 5:132427955-132427977 CCTGGCACCCAGCAGGAGGCAGG - Intronic
998152344 5:139764611-139764633 CCCGGCGCCCCGCAGTGGGCAGG + Intergenic
1000120936 5:158197220-158197242 CCTGCCCAGCAGCAGCGGGCTGG - Intergenic
1001002798 5:168023428-168023450 GCTGGCAGGCAGCCGTCGGCGGG - Intronic
1001939944 5:175733233-175733255 CCCGGCTCGCAGCTGTCGGCTGG - Intergenic
1002102492 5:176864301-176864323 CGGGGCAGGCAGCAGTGGCCAGG + Intronic
1002529268 5:179834221-179834243 TGTGGCAGGCAGCAGTGGGGGGG + Intronic
1003616556 6:7659959-7659981 CCTGGCTCGCAGTAGTGCACTGG - Intergenic
1006456095 6:34132904-34132926 CCTGGCACCCTGAAGTGGGGCGG + Intronic
1006670916 6:35729119-35729141 CCTGGCAGGCAGCATAGGCCTGG + Intergenic
1006898150 6:37483762-37483784 CCAGGCACCCGGCAGAGGGCAGG - Intronic
1007136917 6:39531439-39531461 CCTGGCACACAACAAGGGGCTGG + Intronic
1007752421 6:44078432-44078454 CCTGGCAGGGAGCAGAGGTCAGG + Intergenic
1007923769 6:45634528-45634550 CCTGGGAAGCAGCAGCGTGCTGG + Intronic
1008815141 6:55556136-55556158 CCTGGCAGACAGCAGTGAACAGG + Intronic
1010519840 6:76818771-76818793 CCTGGCAGGCTGCACTAGGCTGG - Intergenic
1015879023 6:137852330-137852352 CCTGGGAAGCAGCACTGGGTGGG - Intergenic
1017542106 6:155413450-155413472 CATGGCCCGCAGCAGGTGGCAGG + Intronic
1017872042 6:158494559-158494581 CCAGGCACGCAGCAGTGAGTGGG - Intronic
1017891119 6:158640122-158640144 CGTGGAACACAGCAGGGGGCAGG - Intronic
1018042497 6:159937326-159937348 CCTGGCACTGGGCAATGGGCAGG - Intergenic
1018956012 6:168410975-168410997 GCTGCCTCCCAGCAGTGGGCAGG - Intergenic
1019128065 6:169854440-169854462 CCAGGGAGGCAGCTGTGGGCTGG - Intergenic
1019158822 6:170056308-170056330 TCTGGAAAGCAGCAGTGGGAGGG - Intergenic
1019571633 7:1715538-1715560 TCTGGGAGGCAGAAGTGGGCAGG - Intronic
1022480415 7:30739894-30739916 CCTGGCAGGCAGTAGGGGCCTGG - Intronic
1024279621 7:47708870-47708892 CCTGGCATGCAGGAGTGCCCTGG + Intronic
1027880837 7:83833856-83833878 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1029513149 7:101009357-101009379 CCCAGCACCCAGCAGGGGGCTGG - Intronic
1032087790 7:128892857-128892879 CCAGGCACTCACCAGGGGGCTGG + Exonic
1032222611 7:130006128-130006150 CCTGGCACTCAGCAGGTGCCTGG - Intergenic
1032563604 7:132917566-132917588 CCTGGCACCCAGCCTAGGGCAGG - Intronic
1034285489 7:149880871-149880893 CCGGGCAGTCAGCAGGGGGCCGG - Intergenic
1035064497 7:156095159-156095181 CCTGGCTGGAAGCAGAGGGCTGG - Intergenic
1035278808 7:157764773-157764795 CCTGGCATACAGCAGGGGACAGG + Intronic
1035560705 8:601727-601749 CCTGGCCAGGAGCAGGGGGCAGG + Intergenic
1035680944 8:1487723-1487745 CTTGGGACGCAGCAGTGCACAGG - Intergenic
1036258758 8:7224484-7224506 ACTGGCTCTCAGCAGTGGGTGGG - Intergenic
1036310817 8:7683080-7683102 ACTGGCTCTCAGCAGTGGGTGGG - Intergenic
1039577051 8:38632124-38632146 CCTGGCACACAGCAGAGCCCTGG - Intergenic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1045387955 8:101689463-101689485 CCCAGCACGCAGTAGTGGGAAGG - Intronic
1048978953 8:139692801-139692823 CCTGGCACCCATGAGTGGCCTGG + Intronic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049357157 8:142194599-142194621 CCCGTCACACAGCAGTGGCCCGG - Intergenic
1049420018 8:142512301-142512323 CCTGGCAGGCAGCAGTCTGAAGG + Intronic
1049566024 8:143339635-143339657 CCTGGCAACCTACAGTGGGCAGG + Intronic
1049568482 8:143356206-143356228 AATGGCAAGCAGCCGTGGGCCGG - Intronic
1051917801 9:22229267-22229289 GCTGGCCAGCAGCAGTAGGCTGG + Intergenic
1052192484 9:25676183-25676205 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1053200515 9:36148845-36148867 CCTGGCACCCAGCACAGGCCTGG - Intronic
1054453225 9:65414433-65414455 CCTGGCATGCAGGAGTAGCCTGG + Intergenic
1056535719 9:87525748-87525770 CCTCGCACCCAGCATGGGGCAGG + Intronic
1057228688 9:93305825-93305847 CCTGGCAAGGGGCCGTGGGCTGG + Intronic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058835635 9:108856514-108856536 ACTGGCAGGCTGCACTGGGCGGG - Exonic
1059863012 9:118485814-118485836 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1059956659 9:119523124-119523146 CCTGGCACACAGTAGGGGTCTGG - Exonic
1061027005 9:128056279-128056301 CCTGGCAGGCCTCAGTGGGGTGG + Intergenic
1061550019 9:131329009-131329031 CCTGGCAGGTATCAGTGGGCTGG - Intergenic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1185461389 X:334178-334200 CCTGGCACAGAGCTCTGGGCAGG + Exonic
1189286836 X:39857817-39857839 CCCTGCACCCAGGAGTGGGCTGG + Intergenic
1190127744 X:47721749-47721771 CCAGGCGCGCAGGAGTGGGTAGG + Intergenic
1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG + Intronic
1191867949 X:65720720-65720742 CCTGGAACGCAGCAGTCATCTGG + Intronic
1196525839 X:116726480-116726502 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1196816545 X:119669537-119669559 CCTGGCAGGCAGTGGTGTGCTGG + Intronic
1199897279 X:152137334-152137356 CCCGGCAGGCAGAAGTGGGGAGG + Intronic