ID: 922607627

View in Genome Browser
Species Human (GRCh38)
Location 1:226900362-226900384
Sequence AATTGTCCACAGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922607627_922607633 5 Left 922607627 1:226900362-226900384 CCCTGCCCCCTCTGTGGACAATT 0: 1
1: 0
2: 0
3: 18
4: 175
Right 922607633 1:226900390-226900412 GCCTGACAGCACAGTCTATGTGG 0: 1
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922607627 Original CRISPR AATTGTCCACAGAGGGGGCA GGG (reversed) Intronic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
901497909 1:9632702-9632724 ATTTGTCAACAAAGGGGCCAAGG - Intergenic
901702713 1:11054062-11054084 ATTTGTCCACATAGGGGGCGGGG + Intergenic
902765021 1:18608175-18608197 AATTGTCCACTGGGGGGGGCGGG + Intergenic
905585685 1:39115798-39115820 AATTGTCCACAGAAAGGGAGTGG + Intronic
906759368 1:48360717-48360739 AATAGTCTGCAGAGGGGCCAAGG + Intronic
907059379 1:51405794-51405816 AATTGTCCTCAGATGAGGCAAGG + Intronic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
907916559 1:58875105-58875127 AGTTGTCCACAAAGGGGGTGGGG + Intergenic
912540243 1:110409399-110409421 AATGATCCACAGAGGGGGTGAGG - Intergenic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
918413772 1:184286875-184286897 AATTCCCCACAGATGGGGCTGGG - Intergenic
918933390 1:190887103-190887125 AATTGTCAAAAGAGGAGGAAGGG - Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
922192195 1:223329115-223329137 AATTACCCACAGAGAGGTCAGGG - Intronic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
923395446 1:233557543-233557565 AATTCTCCAAAGGGAGGGCAAGG - Intergenic
924171320 1:241344396-241344418 AATTGTCCAGAAAAGGGACATGG - Intronic
924384747 1:243490540-243490562 ACTTGTCCGAAGCGGGGGCAGGG - Intronic
1064951339 10:20854422-20854444 AATAGTCCCCAGAGGGAGCCTGG + Intronic
1065813761 10:29465640-29465662 AACTGACCACAGAGGGGGCTCGG + Exonic
1065957898 10:30709386-30709408 AACTGACCACAGAGGGGGCTCGG - Intergenic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1068583313 10:58767121-58767143 AATTGGCCACAGGAGGGGTAGGG - Intronic
1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG + Exonic
1070496988 10:77033699-77033721 AATTCTCTACAGAAGGGTCAGGG - Intronic
1071801260 10:89064246-89064268 ATTTTTCCAGAGAGGGGTCATGG - Intergenic
1073424240 10:103446660-103446682 AATGGCCCACAGGGGTGGCAGGG - Intergenic
1073817762 10:107225969-107225991 ATTTGACCACAGAGGTGACATGG - Intergenic
1075231545 10:120684278-120684300 AATTGTCCACAGGCTGAGCAGGG - Intergenic
1076508892 10:130998401-130998423 AGTTGTCCACAGAGGGTCAAAGG + Intergenic
1076568767 10:131417435-131417457 CATTGTCCTCAGAGGGGGATCGG + Intergenic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1078104401 11:8349690-8349712 AATTGTCCCGACTGGGGGCAAGG - Intergenic
1079016357 11:16872255-16872277 AATTGTCTACAGGTGGGGCACGG - Intronic
1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG + Intergenic
1081999231 11:47384029-47384051 AATTTTACACAGAGGGGGCCGGG + Intergenic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082634872 11:55583586-55583608 GGTCCTCCACAGAGGGGGCATGG - Intergenic
1083369487 11:62166918-62166940 ATTTCTCCACATAGGCGGCAAGG - Intergenic
1084413912 11:69019504-69019526 AATAATCCACAGAGAAGGCAAGG - Intergenic
1086291547 11:85315986-85316008 AATCGTCCTCAGAGAGGGGAGGG - Intronic
1086827931 11:91522618-91522640 AATTGTCCACACAGGAGCCAAGG - Intergenic
1088014914 11:105046713-105046735 AATTGTACACAGAGGAGCCAGGG + Intronic
1088305543 11:108403770-108403792 AATTTTCAACAGAGGTGCCAAGG - Intronic
1092502889 12:9065305-9065327 AAATGTCCACAGCCGCGGCAAGG - Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1095093967 12:38134901-38134923 AATTGTCAACAGACCAGGCACGG + Intergenic
1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG + Intergenic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1098846991 12:75549942-75549964 ATTTTTCCAGTGAGGGGGCAAGG + Intergenic
1099033834 12:77560714-77560736 CAGTTTCCACAGAGGGGGCCAGG - Intergenic
1099514597 12:83582124-83582146 AATTGTCCAGAAATGGGGCCAGG + Intergenic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1101015614 12:100497143-100497165 AACTGTCAGCAGAGGGGTCAGGG + Intronic
1103588056 12:121970946-121970968 AACTGACCCCAGAGGGGCCAGGG - Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1107914877 13:45139240-45139262 AATTGTGCATGGATGGGGCAGGG + Intronic
1111818019 13:93178975-93178997 AATTGTCCACAGGCCGGGCATGG - Intergenic
1112242096 13:97692487-97692509 AGAAGTCCAGAGAGGGGGCATGG + Intergenic
1113146841 13:107217192-107217214 ATTTGTCAGCAGAGGGGCCAAGG - Intronic
1113359242 13:109613584-109613606 GATTGTCCACAGTGGGGGAGGGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115773544 14:36690623-36690645 AATGGTCCAGAGAGGGGACTGGG + Intronic
1118346244 14:64943160-64943182 AATTGTACAGTGAGAGGGCAGGG + Intronic
1121929113 14:97956258-97956280 TACTGTGCACACAGGGGGCATGG + Intronic
1122872062 14:104643345-104643367 CATTGTGCAGAGAGGTGGCAAGG + Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1129638849 15:77353038-77353060 AATTGGCCTCAGAGGGTTCATGG - Intronic
1131936346 15:97509803-97509825 AATTATCCAAAGAGAGGACATGG - Intergenic
1136182343 16:28562376-28562398 AATAGTCCAAGGAGGGGGAAGGG - Intronic
1136481588 16:30545371-30545393 GGTCCTCCACAGAGGGGGCATGG + Intronic
1137023441 16:35452149-35452171 AGGTGTCCCCAGAGGGGGAAAGG + Intergenic
1137613565 16:49834678-49834700 GTCTGTCCACGGAGGGGGCAGGG + Intronic
1138350807 16:56345360-56345382 CAGTGTCCAGAGTGGGGGCAGGG - Exonic
1139800552 16:69519191-69519213 AATTGCACACAGAGTGGCCAGGG - Intergenic
1139919771 16:70452151-70452173 AATTGGCCACTGACTGGGCACGG + Intergenic
1141797648 16:86285970-86285992 GATTGTCCCCGGAGGGGTCAAGG - Intergenic
1142284954 16:89167884-89167906 AGTTGGGCACAGAGGGGTCAGGG - Intergenic
1145905672 17:28514831-28514853 AGTTGCCCACAGGGGAGGCAGGG + Intronic
1147053116 17:37812894-37812916 GATTTTCAACAGAGAGGGCAAGG - Intergenic
1149478900 17:56985925-56985947 AGTTGACCACAGAGGGGTGAGGG - Intronic
1150004945 17:61463654-61463676 CAGTGTCCACATAGGGGGCCAGG - Intronic
1151219282 17:72600210-72600232 AATTGTCCACTGTGGCTGCAGGG - Intergenic
1153817024 18:8799336-8799358 GATTGTACAGAGAGGGAGCAGGG - Intronic
1157513848 18:48297040-48297062 AATTTTCCACAGACGGGGTGGGG - Intronic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1164973308 19:32550847-32550869 CGTTGTCCACAGAGGGTGCCAGG - Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925967069 2:9075927-9075949 AATTCTGCACAGAGGGGCCACGG + Intergenic
926014356 2:9436285-9436307 TATTGTAAACAGAGGAGGCAGGG + Exonic
928700845 2:33897000-33897022 AATTGTGCCCAGCAGGGGCAAGG - Intergenic
929573460 2:43038195-43038217 AAATGTCCAAAAATGGGGCATGG - Intergenic
930031342 2:47059817-47059839 AACTGGGCACAGAGGGGTCAAGG - Intronic
931040618 2:58294955-58294977 TATTGTGCACAGAGTGTGCATGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933237817 2:79884933-79884955 AATTGTCTACTGGGGGAGCACGG + Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
937953009 2:127402593-127402615 AGATGTGCACAGAGTGGGCAGGG - Intergenic
938235739 2:129705283-129705305 AGATGACCAGAGAGGGGGCAGGG + Intergenic
938968410 2:136408405-136408427 AATTGGCCACAAAGGCAGCAAGG - Intergenic
940139458 2:150477498-150477520 CATAGTCCACAAAGGGGGGAGGG - Intronic
942595159 2:177585424-177585446 GACTGTCCCCAGAGAGGGCATGG + Intergenic
942757747 2:179362100-179362122 AATTGTCAACAAAAGGGGGAGGG - Intergenic
948148020 2:235723137-235723159 AATTGTCCTCAGAGGTGTGAAGG - Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1170328341 20:15180586-15180608 AAGTGTTCCCAGAGAGGGCACGG - Intronic
1173458458 20:43222730-43222752 AGTTGTCCACAGAGGTGACCTGG - Intergenic
1174682436 20:52421714-52421736 AACGGGCCAAAGAGGGGGCAGGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1181433972 22:22899676-22899698 AATTGTCCCAAGAGCGGGGAAGG - Intergenic
1181434909 22:22905046-22905068 AATTGTCCCAAGAGCGGGGAAGG - Intergenic
1182547771 22:31085613-31085635 CATTGTCTACCGAGGGGGAAGGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184083798 22:42245744-42245766 AATTGGCCATAGAGAGGGAAAGG - Intronic
1184510152 22:44928738-44928760 AATTGTCTACAGAAGGCGCTGGG + Intronic
950652247 3:14414461-14414483 AGCTGTCCCCAGAAGGGGCATGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956597498 3:70983907-70983929 AATTCTCCACAGAGTAAGCACGG + Intronic
958910085 3:99984653-99984675 AATTGGCCAGAGAGGAGGCTTGG - Intronic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
963007660 3:140741067-140741089 CACTGGCCACAGAGAGGGCAAGG - Intergenic
965872214 3:173276848-173276870 GGTCCTCCACAGAGGGGGCATGG - Intergenic
967156367 3:186696210-186696232 AATGCTGCACAGAGGGGCCATGG - Intergenic
967813636 3:193781102-193781124 AATTTTCCCCAGACGGGGCATGG + Intergenic
971028092 4:22608048-22608070 GACTGTCCACAGAAGGGGTAAGG + Intergenic
976164032 4:82234491-82234513 ACTTTCACACAGAGGGGGCAAGG + Intergenic
979302778 4:119106632-119106654 AGTTGTTCACAGGGGAGGCAGGG - Intergenic
981755923 4:148141879-148141901 AATTTTCCACAGACCTGGCAGGG - Intronic
981968552 4:150636607-150636629 CTTTGTCCACTGAGGGGGCCTGG - Intronic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
983629374 4:169834166-169834188 AATTTTCAGCAGAGGAGGCAGGG - Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991440154 5:66638687-66638709 AACTGTCCACAGAGATGGCTGGG - Intronic
997794327 5:136793191-136793213 AATTGTCCACAGCAGAGGAAGGG - Intergenic
998407828 5:141883778-141883800 AATTGTGCCCAGATAGGGCAGGG - Intergenic
999497652 5:152115855-152115877 TGTGGCCCACAGAGGGGGCAGGG - Intergenic
1001002419 5:168020063-168020085 AATTGTGCTTAGAGGGGCCAGGG + Intronic
1001765850 5:174246370-174246392 AACTTTCCACAGAGGTGTCAAGG + Intergenic
1002438027 5:179245115-179245137 AAGGGTCCATAGAGGGGGAAGGG + Intronic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1005003312 6:21264065-21264087 AAAAGTCCTCAGAGGAGGCAGGG + Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1012132643 6:95516858-95516880 AATTGTCCACAGATGGGTTGTGG - Intergenic
1012474401 6:99604371-99604393 AATTGTCCACAAAGGAGAAAAGG - Intergenic
1012724884 6:102798668-102798690 AATTGACACCGGAGGGGGCAGGG + Intergenic
1013223662 6:108103212-108103234 TATTGTCCACAGAGGTAGCTTGG - Intronic
1014177396 6:118345716-118345738 AATTGTCCCCAACTGGGGCAAGG + Intergenic
1015282673 6:131450597-131450619 AATTGTCCACAGGGGAGCAAGGG - Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1023057095 7:36299340-36299362 AATGGTCCACAGAGAAGGCGTGG - Exonic
1023764726 7:43499974-43499996 CATTGGGCACAGAGGGGGCCCGG - Intronic
1023783699 7:43684127-43684149 TTTTTTCCACAGAGGAGGCAGGG + Intronic
1027467103 7:78529279-78529301 AATTGTCCACAGACTGGCTAGGG + Intronic
1027494760 7:78873700-78873722 ACTTTTCCACAGACAGGGCAAGG - Intronic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1029004874 7:97198749-97198771 AATTGTTCAAAGTGTGGGCATGG + Intergenic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1030323434 7:108194115-108194137 AGTTGTGCAAAGAGGGAGCATGG - Exonic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1032450462 7:132026018-132026040 AATTTTCAGCAGAGGGGGCTGGG + Intergenic
1035922614 8:3694186-3694208 ATGTGTCCATAGATGGGGCAGGG + Intronic
1037814645 8:22105577-22105599 ATTTGTCCTCAGAGGGTACAAGG + Intergenic
1039172546 8:34764384-34764406 AAGTGTCCAGTGAGGAGGCAAGG - Intergenic
1040072060 8:43196473-43196495 AATTCTCCACAAAGGTGACAAGG - Intronic
1040410077 8:47145098-47145120 AATATCCCACAGAGTGGGCAGGG + Intergenic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042799517 8:72703461-72703483 AATTGTCAGCAGTTGGGGCAAGG + Intronic
1043652854 8:82620347-82620369 AAATGTCCACAGAGAAGGAATGG + Intergenic
1047223666 8:122938959-122938981 AATTGTCAACAGAGCTGGGAGGG + Intronic
1049043392 8:140129560-140129582 GGATGTCCACACAGGGGGCAGGG + Intronic
1053510936 9:38687206-38687228 AACAGTCCTCAGACGGGGCAAGG + Intergenic
1056350744 9:85746234-85746256 AGATGTCCACAGAGGGGGTGAGG - Intergenic
1057279915 9:93701938-93701960 AATTGTCTGCAGAGGCGGCCTGG - Intergenic
1057335600 9:94152556-94152578 AATTGTCAACTTAGGGGGCCGGG - Intergenic
1057553153 9:96066839-96066861 AGCTGTCCCCAAAGGGGGCATGG - Intergenic
1057755904 9:97835299-97835321 GATTGTCCACATGGGGGGCTGGG - Intergenic
1058906194 9:109484455-109484477 AAGTTTCCACAGAGGTGGCTCGG - Intronic
1059063607 9:111059337-111059359 AATTCTCCCCAAAGGGGCCAGGG - Intergenic
1062662828 9:137647890-137647912 AAGTGTCCACAGATGCGGCCGGG - Intronic
1186703345 X:12115562-12115584 AAGAGCCAACAGAGGGGGCAGGG - Intergenic
1187990577 X:24867797-24867819 AATTGTACACACAGAGGGAAAGG + Intronic
1188897951 X:35693652-35693674 AATTGTGCACTTAGGGGGCTCGG + Intergenic
1189168969 X:38890663-38890685 AGTTGTCCTCAGTTGGGGCAAGG - Intergenic
1190027221 X:46935673-46935695 AATTTTCCACGGACGGGGGAAGG - Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1193310064 X:79996636-79996658 AATTTTCCACAGAAGTGACAAGG + Intergenic