ID: 922607648

View in Genome Browser
Species Human (GRCh38)
Location 1:226900517-226900539
Sequence GGTCACCCGCTGAGAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922607648 Original CRISPR GGTCACCCGCTGAGAAGGAA GGG Intronic
901187858 1:7386649-7386671 GGTCACGTGCTGGGAAGGGAGGG - Intronic
903226215 1:21895402-21895424 GGTCATCGGCTGGGAAGCAAGGG - Intronic
904078366 1:27856724-27856746 GGCCACCTGCTGAGAAGGGAAGG + Intergenic
907124014 1:52033336-52033358 GGCCACGCGCTGAGGAGGACGGG - Exonic
907302763 1:53498804-53498826 GGTCTCCAGCTAGGAAGGAAAGG - Intergenic
908564180 1:65337453-65337475 AGTCACCCTCAGAGAAGGATAGG - Intronic
909629711 1:77759269-77759291 AGTCACCCACTGAGAGGGACTGG + Intronic
911234144 1:95391672-95391694 GATCACTCGGTGAGAAGGAAGGG - Intergenic
915527081 1:156482635-156482657 AGTCACCTGCAGAGAAGGATGGG + Exonic
919853794 1:201692055-201692077 GCTCAACAGCAGAGAAGGAATGG - Intronic
922607648 1:226900517-226900539 GGTCACCCGCTGAGAAGGAAGGG + Intronic
923622316 1:235588749-235588771 GGTCCTCTGCTGAGGAGGAAAGG - Intronic
1065960161 10:30727667-30727689 GGTCACAGGCTGAGTGGGAAAGG - Intergenic
1066981642 10:42422165-42422187 GGTCAGCAGCTTAGCAGGAAAGG - Intergenic
1067290655 10:44937354-44937376 GGTCACAGGCTGAGAATCAATGG - Intergenic
1067450304 10:46377964-46377986 GACCTCCTGCTGAGAAGGAAGGG - Intronic
1067586941 10:47481799-47481821 GACCTCCTGCTGAGAAGGAAGGG + Intronic
1067633998 10:47989566-47989588 GACCTCCTGCTGAGAAGGAAGGG + Intergenic
1068514130 10:58005099-58005121 GGTAATCCACTGAGAAGGAATGG - Intergenic
1069553104 10:69378131-69378153 GGTCAGTGGCTGGGAAGGAAGGG + Intronic
1073206955 10:101774629-101774651 GGTCCCCAGCTCAGAAGGGAAGG - Intronic
1074047966 10:109856552-109856574 GGTCACCAGCTAGGAAGTAATGG + Intergenic
1074777266 10:116775565-116775587 GGGCACCCGATGAGAGGGGATGG + Intergenic
1081689676 11:45069365-45069387 GGTCTCCCACTGAGAAGAGAGGG - Intergenic
1083226175 11:61286292-61286314 GGTGAGCTGCAGAGAAGGAATGG - Exonic
1083259989 11:61517691-61517713 CGGGACCCCCTGAGAAGGAAGGG + Intronic
1083297590 11:61723359-61723381 GCTCACCCGCTCTGAAGAAAGGG - Intronic
1083767425 11:64848488-64848510 GGTACCCTGGTGAGAAGGAAAGG - Intergenic
1084481494 11:69423309-69423331 GGGAACCCACTGAGAGGGAAAGG + Intergenic
1085226117 11:74922683-74922705 GGTTACCCTCAGAGAAGGACTGG + Intronic
1086204672 11:84243684-84243706 GGTCACACTCTGAGCAGCAAAGG + Intronic
1086257885 11:84901292-84901314 GGTCACAGGCTGAGAAGGAAGGG + Intronic
1090788249 11:130069189-130069211 GGGCAACTGCTGGGAAGGAAGGG + Intergenic
1090857473 11:130623053-130623075 GGTCCCCGGCTGGGAAGGATGGG + Intergenic
1091722394 12:2822895-2822917 GGTCACCTGCACAGAAGGCACGG - Exonic
1092224081 12:6735162-6735184 GGTCACCGTCTGAGAGAGAAGGG + Intergenic
1101877690 12:108606507-108606529 GGTCACTCCCTCAGAAAGAAAGG - Intergenic
1103859424 12:124000275-124000297 GGCCATCTGCTGAGAAGGAGAGG - Intronic
1106719491 13:32424072-32424094 GCTCATCTGCTGAGAATGAAAGG + Intronic
1110764487 13:79267223-79267245 GGTTACCCAGTGATAAGGAATGG + Intergenic
1113953082 13:114082633-114082655 GGGCAGCCCCAGAGAAGGAATGG + Intronic
1114083765 14:19221736-19221758 GGGTCCCCGCTGAGATGGAAAGG - Intergenic
1114634338 14:24178864-24178886 AGGCAGCCGCTGAGGAGGAAAGG + Exonic
1117294162 14:54363893-54363915 GATCACCAGCTGAGAAAGCAGGG + Intergenic
1120441420 14:84545717-84545739 GGTCACACTTTGAGAAGGAAGGG - Intergenic
1121898407 14:97670504-97670526 GGACACTAGCTGAGAAGTAATGG + Intergenic
1123205508 14:106708935-106708957 GGTCACACAGTGAGGAGGAATGG - Intergenic
1123210555 14:106756202-106756224 GGTCACACAGTGAGGAGGAATGG - Intergenic
1123947636 15:25246486-25246508 GGTGACCTCCTGAGAAGGGAAGG + Intergenic
1126369105 15:47926984-47927006 GGTCACCAGCATAGAAAGAATGG + Intergenic
1130532662 15:84759308-84759330 GGTCACCCTCTGAGATGGCTGGG + Intronic
1133047528 16:3097259-3097281 GCTTAGCCGCTGAGAAGGAGGGG + Intronic
1133340565 16:5033259-5033281 GGTCACCGGGTGAGGAGGCAGGG - Exonic
1134624343 16:15713359-15713381 GGTCCCCAGCTGAGAGAGAATGG + Intronic
1137315219 16:47312329-47312351 AGTCACCTGCTTAGAAGGAAAGG - Intronic
1142029110 16:87829660-87829682 GGTCACCCGCTGAGAGGATGCGG - Intergenic
1142401108 16:89859206-89859228 GGTCATGCTCTGAGAAGGAGCGG - Exonic
1142890218 17:2938360-2938382 GGTCCCCAGCTTGGAAGGAAAGG - Intronic
1143104527 17:4522321-4522343 GGTCACCGGCTGGGAAGGAGCGG + Intronic
1143684663 17:8504248-8504270 GGTAACCAGCTGAAAAGGGAAGG - Intronic
1144266210 17:13572361-13572383 GGTCACCCCCTAGGATGGAAAGG - Intronic
1149666354 17:58367441-58367463 GGTCACCAACTGAGAAGCAGTGG + Intronic
1156108700 18:33697062-33697084 CCTCACCCTCTTAGAAGGAAAGG + Intronic
1157306155 18:46519152-46519174 GGGCACTTGGTGAGAAGGAAGGG - Intronic
1157777482 18:50407006-50407028 GGTCACCCGGTGGGAACGAGTGG - Intergenic
1163051196 19:14685397-14685419 AGTCAACAGCAGAGAAGGAAGGG + Intronic
1164785421 19:30926630-30926652 GATCATCTCCTGAGAAGGAAGGG - Intergenic
1166538891 19:43592959-43592981 GGGCCCCCACTGAGAAGGACTGG - Exonic
933616563 2:84487779-84487801 GGTCTCCCGCTGACCTGGAAAGG - Intergenic
935447759 2:103174806-103174828 GGTCATAGGCTTAGAAGGAAAGG - Intergenic
937507929 2:122557886-122557908 GGTCACCAGCTGAAAATGAGGGG + Intergenic
938251611 2:129820110-129820132 GGTCACCCCTTGACAAGGAGGGG - Intergenic
940988616 2:160075173-160075195 GTTCATCAGCTGAGAATGAAGGG + Intergenic
941697984 2:168573731-168573753 AGCCACCCACAGAGAAGGAAAGG - Intronic
944038167 2:195322678-195322700 GGTCACTTTCTGAGTAGGAAAGG + Intergenic
946372956 2:219291554-219291576 GGGCACCAGCAGAGAGGGAAAGG + Intronic
946865833 2:224039921-224039943 GGTTACCGGCTGAGAAGGGCTGG - Intergenic
948193296 2:236076512-236076534 GGTCACACACTGAGAAGGTCAGG - Intronic
1169187710 20:3632587-3632609 TGTCACCTTCTGAGAAAGAAAGG + Intronic
1172170699 20:32930237-32930259 TGTCACCAGCTGGGGAGGAAGGG + Intronic
1174059001 20:47819250-47819272 GGTCACCTGCTGGGAGGGAGGGG - Intergenic
1175892251 20:62321096-62321118 GGTCACCCAGGGAGAAGGTAGGG + Intronic
1176215040 20:63944013-63944035 GGTGACCCCCTGAGAAAGAGAGG + Intronic
1178778746 21:35578717-35578739 GGTCAACCGCAAAGAAGGGAAGG + Intronic
1180294210 22:10871531-10871553 GGGTCCCCGCTGAGATGGAAAGG + Intergenic
1180497016 22:15900945-15900967 GGGTCCCCGCTGAGATGGAAAGG + Intergenic
1181766077 22:25092972-25092994 GGTCACCAGCTGAGTATGGATGG + Intronic
1182025054 22:27111357-27111379 GGTCACAGGCTGAGCAGGATGGG - Intergenic
1182423903 22:30262014-30262036 GGTCACCCAGAGAGATGGAACGG + Intergenic
1183479950 22:38057931-38057953 GATCCACCGCTGAGAAGCAAGGG - Intronic
1183654013 22:39174852-39174874 CGTCACCGGGTGAGAAGGCAAGG + Intergenic
1184476019 22:44721877-44721899 GGGCACCAGGTGAGAAGGGAGGG - Intronic
955932701 3:64073600-64073622 GGTCTCCCTTGGAGAAGGAAAGG - Intergenic
956134345 3:66084133-66084155 TGTCAACAACTGAGAAGGAAAGG + Intergenic
960972752 3:123151230-123151252 AGTCCCACTCTGAGAAGGAAAGG - Intronic
965936943 3:174126047-174126069 GGTCACACATTGAGAAGGAGTGG + Intronic
966409158 3:179630901-179630923 GGTCATCTGCTGAGAGGGTAAGG + Intergenic
966880841 3:184349868-184349890 GGCCACCCACGGAGAAGCAATGG - Intronic
968829555 4:2925901-2925923 GGCCGCCCTCTGAGAAGGCAGGG - Intronic
969629007 4:8324479-8324501 GCTCACCTGCCCAGAAGGAAGGG - Intergenic
969706441 4:8794711-8794733 GGTCACCCGCTGCGCACTAAGGG + Intergenic
970569963 4:17370153-17370175 GCTCAGCCTCTGAGAAGGAAAGG + Intergenic
981660260 4:147158294-147158316 GGGGGCCCTCTGAGAAGGAAGGG - Intergenic
986357427 5:6942526-6942548 GGGCACCATCTTAGAAGGAATGG + Intergenic
987289246 5:16492568-16492590 AGTCACTAGCTGAGAATGAAAGG - Intronic
992488914 5:77222084-77222106 GGTAACCTGGTGTGAAGGAAAGG + Intronic
993421013 5:87700921-87700943 CTTCACCCAGTGAGAAGGAATGG + Intergenic
995929877 5:117427647-117427669 GGTCATCTGCTGATAAGAAAGGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1003662364 6:8074608-8074630 GGTTACCAAGTGAGAAGGAAAGG + Intronic
1004745414 6:18504091-18504113 GCTGACTCCCTGAGAAGGAAGGG + Intergenic
1006437296 6:34032736-34032758 GGTCACCTGCAGAGATTGAAAGG + Intronic
1006822445 6:36908249-36908271 GGTGGCCCGCAAAGAAGGAAGGG - Intronic
1007462174 6:42026757-42026779 GGTCATGCTCTGAAAAGGAAGGG + Intronic
1012315061 6:97775228-97775250 CTCCACCCGGTGAGAAGGAATGG - Intergenic
1012346875 6:98199089-98199111 GCTCACTCCCTGAGAAAGAAAGG - Intergenic
1014588707 6:123234232-123234254 GGTCACATGCTGAAATGGAATGG - Intronic
1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG + Intronic
1016863366 6:148743820-148743842 GGTCATCCCCTGAGACTGAAGGG + Intergenic
1018719759 6:166563529-166563551 GGTCAGCCGCTCAGATGGAGTGG - Intronic
1019135780 6:169906823-169906845 GCTCACCCGCAGAGATGGTATGG - Intergenic
1021357807 7:19675007-19675029 GGCCATCCGATGAGCAGGAAAGG - Intergenic
1022699664 7:32747462-32747484 GGTCATTCGCTGAGCATGAAAGG + Intergenic
1024770781 7:52720412-52720434 GGTGATCCTCTCAGAAGGAAGGG + Intergenic
1025235911 7:57234778-57234800 GGTCACCTGCTGGGAGGGAGGGG + Intergenic
1031454739 7:121965177-121965199 GGTCAGGAGCTGAGGAGGAAGGG + Intronic
1031457901 7:122007045-122007067 GGCCACCCGCCTAGAATGAATGG + Intronic
1032868692 7:135956543-135956565 GCTCATCTGCTGAGAATGAAGGG - Intronic
1036287621 8:7458578-7458600 AGTCACACGTTGAGAAAGAAAGG + Intronic
1036333859 8:7852947-7852969 AGTCACACGTTGAGAAAGAAAGG - Intronic
1036703717 8:11031064-11031086 GGTTCCCCTCTGTGAAGGAAGGG - Intronic
1041249378 8:55919709-55919731 GGCCTCCCGCTGAGAAGGGAAGG - Intronic
1044344942 8:91094530-91094552 GGACACCAGCTGAAAATGAAAGG - Intergenic
1049522505 8:143101066-143101088 GTTCACCAGCAGAGCAGGAATGG - Intergenic
1053647102 9:40130076-40130098 GGGGTCCCGCTGAGATGGAAAGG + Intergenic
1053758622 9:41333767-41333789 GGGGTCCCGCTGAGATGGAAAGG - Intergenic
1054328106 9:63728033-63728055 GGGGTCCCGCTGAGATGGAAAGG + Intergenic
1054537477 9:66246094-66246116 GGGGTCCCGCTGAGATGGAAAGG - Intergenic
1055511949 9:77003880-77003902 GGACAACCACTGGGAAGGAAGGG - Intergenic
1058896036 9:109401421-109401443 GGTCACCCTCTGAGAAACACAGG + Intronic
1061534631 9:131239877-131239899 GGTCTCTCCCTGAGAAGGCAGGG - Intergenic
1061606978 9:131718127-131718149 GGGCACCTGCTGAGAAGCCATGG - Intronic
1062249831 9:135588522-135588544 GGTCACCCCCTGTGTAGGCAGGG - Intergenic
1062620067 9:137416659-137416681 GGCCACCCTCTGAGGAGGATGGG + Intronic
1187580118 X:20598314-20598336 GATCACACTCTGAGAAAGAATGG + Intergenic
1191921585 X:66262423-66262445 AGTCATCTGCTGAGAATGAAAGG + Intronic
1194763517 X:97822087-97822109 GGTCTCCCACTGTGAAAGAAAGG - Intergenic
1198419020 X:136450249-136450271 GGTCATCAGCTGAGAATGAGGGG + Intergenic
1201935983 Y:19411454-19411476 TGTCACCCAGTGAGGAGGAATGG - Intergenic