ID: 922608203

View in Genome Browser
Species Human (GRCh38)
Location 1:226904345-226904367
Sequence GTGAGCAGTGCTAAATATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922608203_922608206 -8 Left 922608203 1:226904345-226904367 CCTGCATATTTAGCACTGCTCAC No data
Right 922608206 1:226904360-226904382 CTGCTCACCTCCCAGGGTCCTGG 0: 1
1: 1
2: 1
3: 62
4: 495
922608203_922608209 1 Left 922608203 1:226904345-226904367 CCTGCATATTTAGCACTGCTCAC No data
Right 922608209 1:226904369-226904391 TCCCAGGGTCCTGGGCACTTAGG 0: 1
1: 0
2: 5
3: 33
4: 326
922608203_922608212 6 Left 922608203 1:226904345-226904367 CCTGCATATTTAGCACTGCTCAC No data
Right 922608212 1:226904374-226904396 GGGTCCTGGGCACTTAGGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 254
922608203_922608207 -7 Left 922608203 1:226904345-226904367 CCTGCATATTTAGCACTGCTCAC No data
Right 922608207 1:226904361-226904383 TGCTCACCTCCCAGGGTCCTGGG 0: 1
1: 1
2: 2
3: 43
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922608203 Original CRISPR GTGAGCAGTGCTAAATATGC AGG (reversed) Intronic
No off target data available for this crispr