ID: 922609297

View in Genome Browser
Species Human (GRCh38)
Location 1:226912706-226912728
Sequence CTGGAGACGCGAAAGGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922609297_922609309 28 Left 922609297 1:226912706-226912728 CCACGTCCCTTTCGCGTCTCCAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 922609309 1:226912757-226912779 CTGTTAGCTCCACTCCAGGGTGG 0: 1
1: 0
2: 1
3: 33
4: 216
922609297_922609307 25 Left 922609297 1:226912706-226912728 CCACGTCCCTTTCGCGTCTCCAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 922609307 1:226912754-226912776 CTCCTGTTAGCTCCACTCCAGGG No data
922609297_922609306 24 Left 922609297 1:226912706-226912728 CCACGTCCCTTTCGCGTCTCCAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 922609306 1:226912753-226912775 TCTCCTGTTAGCTCCACTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922609297 Original CRISPR CTGGAGACGCGAAAGGGACG TGG (reversed) Intronic
900792873 1:4691345-4691367 CTGGAGAGGACAAAGGGAGGCGG - Intronic
906642491 1:47449755-47449777 ATGGAGACGCGAAGGGAATGGGG + Intergenic
907213647 1:52843559-52843581 CTGGGGACGGGACGGGGACGGGG - Intronic
913380959 1:118209711-118209733 CTGCAGTTGCGAAAGGGATGTGG - Intergenic
915794314 1:158711450-158711472 CTAGAGACGGGGAAGGGAAGTGG - Intergenic
920440832 1:205979428-205979450 CTGGAGAAGCAAAAGGGCCCGGG - Intronic
922609297 1:226912706-226912728 CTGGAGACGCGAAAGGGACGTGG - Intronic
1063359632 10:5441029-5441051 CTGGAGAAGTGAAAGAGAGGAGG + Intronic
1078469976 11:11578938-11578960 CTGGAAACCCAAAAGGGATGGGG + Intronic
1087138666 11:94744524-94744546 CTGGGGAGGGGAAAGGGACTGGG - Intronic
1088721607 11:112596990-112597012 ATGGAGACGGGAAGGGGACATGG - Intergenic
1094716495 12:33019394-33019416 CTGGACATGCGACAGGGATGTGG - Intergenic
1098905248 12:76155183-76155205 CGGGTGAGGAGAAAGGGACGAGG - Intergenic
1102971521 12:117171416-117171438 CTGGAGAGGAGAAAGGGATGAGG + Intronic
1104626343 12:130358817-130358839 CTGGGGACGCGACAGGAACGAGG - Intronic
1109904385 13:68819405-68819427 CTGGAGACTCCAAAAGGAAGGGG + Intergenic
1112365531 13:98752498-98752520 CGGGAGGCGCGAAGGGTACGCGG - Intronic
1126095781 15:45088939-45088961 CTGGAGACAAGACAGGGAGGTGG + Intergenic
1126302160 15:47209690-47209712 CTGGAGAGGCGACGGGGACCAGG - Intronic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1136004276 16:27317888-27317910 CTGGATACGCAGAAGGGACTCGG - Intronic
1140028254 16:71311641-71311663 CTGGAGGCGAGAAAGGGAAAAGG + Intergenic
1150473382 17:65456400-65456422 CTGGAGAAGGGAAGGGGCCGTGG + Intergenic
1150611814 17:66739459-66739481 CTGGGGTTGCGAAAGGAACGAGG + Intronic
1152082778 17:78198873-78198895 CTGGGCACACGAAAGGGAAGAGG - Intronic
1152597690 17:81245947-81245969 CTGGAGATGAGAAAGGCCCGCGG - Exonic
1155527181 18:26729252-26729274 CTGGAGACAGGAAAGGCACTGGG + Intergenic
1158588189 18:58758770-58758792 CTGGGGACGGGAACGGGGCGTGG - Intergenic
1159847403 18:73479832-73479854 CTGGAGAAGGGAGAGGGATGAGG - Intergenic
1160531327 18:79566582-79566604 CTGTAGATGAGAAAGGGACGGGG - Intergenic
1160745567 19:709449-709471 CTGGAGACGCGGGCGGGGCGCGG - Intronic
1163651789 19:18522074-18522096 CTGGAGCCGGGAAGGGGGCGCGG - Exonic
1163754689 19:19099652-19099674 CTGGAGATGGGGAAGGGATGTGG - Intronic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165767692 19:38361336-38361358 CTGGAGTCGGGACAGGGAAGGGG + Intronic
1167121705 19:47521160-47521182 CTGGAGAGGCCGAAGGGAGGAGG + Exonic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
928328510 2:30338969-30338991 CTGGAGAGAGGAAAGGGAGGAGG + Intergenic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929611659 2:43275330-43275352 ATGGAGACGGGAATGGGAGGAGG + Intronic
931881615 2:66576037-66576059 TGGGAGACGCGAGAGGGAGGGGG - Intergenic
932089463 2:68792052-68792074 CTGGAGACGGGACAGGGACCAGG - Intronic
938296525 2:130182548-130182570 CTGAAGACCCGACAAGGACGGGG - Exonic
1169233780 20:3912133-3912155 TTGGAGAAGGGAAAGGGAGGAGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173993350 20:47319708-47319730 CTGGGGAGGAGAAAGGGCCGCGG - Intronic
1178896568 21:36563724-36563746 GTGGAGATGCGAAAGACACGTGG + Intronic
949614308 3:5737093-5737115 CTGGAGGCAAGAAAGGGACATGG + Intergenic
950435846 3:12979545-12979567 CTGGGGAGGGGAATGGGACGTGG + Intronic
952301290 3:32106598-32106620 GCGGAGAGGCGAAAGGGGCGGGG + Exonic
953075990 3:39570778-39570800 CTGGAGAAGTGAAGGGGAAGTGG - Intergenic
959858513 3:111189928-111189950 CTGGAGAGGGGACAGGGAGGGGG + Intronic
968700918 4:2058210-2058232 CTGGAGAGGGGCAGGGGACGGGG - Intergenic
969156315 4:5213460-5213482 CTGGAGAAGCTAAAAGGAAGTGG - Intronic
969258998 4:6021957-6021979 CTGGAGACCTGGAAGGGAAGTGG + Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
986519128 5:8594935-8594957 CTGAAGAAGAGAAAGGGACCTGG - Intergenic
986690183 5:10307695-10307717 GCGGGGACGCGAGAGGGACGTGG + Exonic
987349448 5:17008810-17008832 CTGGAGACGCGTAAATGACGAGG + Intergenic
996738430 5:126777579-126777601 CTGGAGCCGCGACAGGCGCGTGG - Exonic
999699733 5:154217523-154217545 CTTGAGACGAGACAGGGACGCGG - Intronic
1000228252 5:159290688-159290710 CTGGAGAGGAGAAATGGAAGGGG - Intergenic
1001161277 5:169317352-169317374 CTGGAGACTCGGAAGGGTCCAGG + Intergenic
1011275260 6:85625119-85625141 CTGGAGATGGGGAAGGGACAGGG - Intronic
1018050836 6:160006272-160006294 CTGGAGACGCGGAAGGCGCATGG - Intronic
1018386609 6:163310196-163310218 CTAGAGACGCGAAAAGCAGGAGG - Intronic
1019390467 7:783903-783925 CTGGGGAGGCGAGAGGGCCGGGG - Intronic
1020022178 7:4875746-4875768 CAGGAAACCCGAAAGGGAGGAGG - Intronic
1032441633 7:131946630-131946652 CTGGAGAAGGGAAACGGAGGAGG + Intergenic
1035837256 8:2767695-2767717 CTGGAAACGTGAAAGGGGCAAGG - Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1049215903 8:141408087-141408109 CAGGAGAAGCGAAAGGAACCAGG + Intronic
1052940187 9:34126617-34126639 CTTGAGCCGGGAAAGGGAAGGGG + Exonic
1053512972 9:38705174-38705196 CTGGAGACTGGAAAGAGACCTGG + Intergenic
1057904063 9:98971085-98971107 CTGGGGATGAGAAAGGGAGGAGG - Intronic
1062401181 9:136373379-136373401 CAGGGGCCGTGAAAGGGACGGGG + Intronic
1187236853 X:17475836-17475858 CTGGAGATAGGAAAAGGACGAGG - Intronic
1192624599 X:72714286-72714308 CGGGAGACGCGAGCGGGAGGCGG + Intronic
1197339405 X:125247355-125247377 CTGGAGACTTGAAAGGGGGGTGG + Intergenic