ID: 922610481

View in Genome Browser
Species Human (GRCh38)
Location 1:226923490-226923512
Sequence CCCTTGGCTTTCTGCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 2, 2: 3, 3: 39, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922610481_922610488 0 Left 922610481 1:226923490-226923512 CCCCAGAGGCAGAAAGCCAAGGG 0: 1
1: 2
2: 3
3: 39
4: 410
Right 922610488 1:226923513-226923535 AAGAGTTGGAGAAATGGCCCAGG 0: 1
1: 1
2: 2
3: 23
4: 271
922610481_922610489 8 Left 922610481 1:226923490-226923512 CCCCAGAGGCAGAAAGCCAAGGG 0: 1
1: 2
2: 3
3: 39
4: 410
Right 922610489 1:226923521-226923543 GAGAAATGGCCCAGGTAAGTTGG 0: 1
1: 0
2: 0
3: 11
4: 190
922610481_922610487 -6 Left 922610481 1:226923490-226923512 CCCCAGAGGCAGAAAGCCAAGGG 0: 1
1: 2
2: 3
3: 39
4: 410
Right 922610487 1:226923507-226923529 CAAGGGAAGAGTTGGAGAAATGG 0: 1
1: 1
2: 3
3: 67
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922610481 Original CRISPR CCCTTGGCTTTCTGCCTCTG GGG (reversed) Intronic
900309414 1:2026180-2026202 CCGCTTGCTTTCTGTCTCTGTGG + Intronic
900502981 1:3015738-3015760 CCCTTCCCTCTCTGCCACTGAGG + Intergenic
900530143 1:3149049-3149071 TCCTTGGTTCTCTGCCTCTGTGG + Intronic
901057799 1:6456877-6456899 CCATTGGCCACCTGCCTCTGCGG + Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
901288847 1:8105814-8105836 CACTTGTCTTTCTGGCTCTCAGG + Intergenic
901515166 1:9740420-9740442 CACCTGGCTTGCTGCTTCTGTGG + Intronic
902057806 1:13616920-13616942 ACATTCACTTTCTGCCTCTGAGG + Exonic
902080701 1:13818721-13818743 GGCTTGGCTTTATTCCTCTGGGG + Intronic
902094760 1:13933865-13933887 CCCAGGGCTGTCTGCCTCTAAGG + Intergenic
903362868 1:22787980-22788002 CTCTTGGCTCTCTCACTCTGGGG - Intronic
903366171 1:22806683-22806705 CCCTCGGCTTTGTCCCTGTGGGG - Intronic
903562391 1:24237479-24237501 GACTTGGCTTCCTGCCCCTGGGG - Intergenic
904285374 1:29450280-29450302 CCCTTGGAATGCTCCCTCTGGGG + Intergenic
904496187 1:30888173-30888195 GCCTGGGCTTTCTGCCTCTGTGG - Intronic
904881378 1:33699862-33699884 CCCTTTACTTTCTGGCTCTATGG + Intronic
905245926 1:36613258-36613280 CCTGTGCCTTTCTGCCTCTGTGG + Intergenic
905305507 1:37015230-37015252 CCCTTTGCTGTCTGCCCCTTGGG - Intronic
906010703 1:42522250-42522272 CAGTTGGCTCTCTGCATCTGTGG - Intronic
906480157 1:46194385-46194407 CCAGTGGCACTCTGCCTCTGAGG + Exonic
907446520 1:54511490-54511512 TCCTTGGCTCTCTTGCTCTGGGG + Intergenic
907542879 1:55232693-55232715 CCCTCTGCTGTCTGTCTCTGTGG + Intergenic
907557748 1:55359392-55359414 CTCATGGCCTTCTCCCTCTGTGG - Intergenic
910814994 1:91282514-91282536 CCCTTGGTTGTCTGCCTATAAGG + Intronic
912349650 1:108999589-108999611 GCCTCGACCTTCTGCCTCTGGGG - Intronic
912810469 1:112790330-112790352 CACTTGCCATTTTGCCTCTGGGG + Intergenic
913703461 1:121396529-121396551 GCCTTGGCTTTTTGCCGCCGCGG + Intergenic
913979837 1:143498360-143498382 GCCTTGGCTTTTTGCCGCCGCGG + Intergenic
914074186 1:144323844-144323866 GCCTTGGCTTTTTGCCGCCGCGG + Intergenic
914104990 1:144642602-144642624 GCCTTGGCTTTTTGCCGCCGCGG - Intergenic
914879401 1:151535951-151535973 CTCTTGGCTTTTCTCCTCTGTGG + Intronic
916094377 1:161335968-161335990 CTCTTGGGTTTCTGCCAGTGAGG + Intronic
918147933 1:181774368-181774390 GGCCTGTCTTTCTGCCTCTGAGG - Intronic
918638006 1:186802944-186802966 TCCTTAGCTCTCTGCCTGTGAGG + Intergenic
919169140 1:193931559-193931581 AGCTTGACTTTCTGACTCTGTGG + Intergenic
920097498 1:203496124-203496146 CCTTTGAAGTTCTGCCTCTGCGG + Exonic
920220688 1:204398119-204398141 CTCTTTCCTTTCTTCCTCTGTGG - Intergenic
920684949 1:208102211-208102233 CTCTTGGCTTCCAGCCTCTGCGG - Intronic
921619025 1:217306170-217306192 CCATTGGCTTCCTGGTTCTGAGG + Intergenic
922324598 1:224516572-224516594 TCATGGGCTTTCTGCCTTTGGGG + Intronic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
924175788 1:241389970-241389992 CCATTGGCTTTCTGGTTCTCAGG - Intergenic
924491901 1:244546039-244546061 CCCTTAGCATTCTGCTTCAGGGG - Intronic
1062945097 10:1454633-1454655 CCCTCTGCTTCCTGTCTCTGTGG - Intronic
1063415815 10:5871756-5871778 CCGCTGGCTTCCTCCCTCTGTGG + Intronic
1063539451 10:6917654-6917676 TCTTTTGCTATCTGCCTCTGGGG + Intergenic
1063835716 10:10009440-10009462 CACCTGGCTTACTGCTTCTGAGG - Intergenic
1063849065 10:10163756-10163778 CCCTTGGCTTTATGAGTTTGGGG - Intergenic
1064846907 10:19665822-19665844 CCCTTGGATCTCCGGCTCTGTGG + Intronic
1065453974 10:25887368-25887390 CCTTGGGCTTTTTGTCTCTGGGG + Intergenic
1067395692 10:45914828-45914850 CCCTTGGATTGCTTGCTCTGGGG + Intergenic
1067740896 10:48895439-48895461 CCCTTGGCTCTCTGGGCCTGTGG + Intronic
1067864013 10:49883951-49883973 CCCTTGGATTGCTTGCTCTGGGG + Intronic
1068117573 10:52751482-52751504 CCCATGCCTTTTTGCCACTGAGG - Intergenic
1069721235 10:70550658-70550680 CACTGATCTTTCTGCCTCTGTGG + Intronic
1070586223 10:77768788-77768810 CCCTTGGCCTTCTGACTCCTGGG - Intergenic
1071030418 10:81173697-81173719 CCTTTGGCTTATTGTCTCTGAGG + Intergenic
1071310005 10:84334275-84334297 CTGATGGCTTTCTGCCTCTTTGG + Intronic
1072632376 10:97155263-97155285 CCCTTGACTTTCTGCTTCCCAGG + Intronic
1073049055 10:100656243-100656265 CCCTTGGCTTCCTGCCTCTGCGG + Intergenic
1074207363 10:111295444-111295466 TCTTTTGATTTCTGCCTCTGTGG + Intergenic
1074264867 10:111891572-111891594 GCCTTGGTTTTCTGCTTCTAAGG + Intergenic
1074963804 10:118471308-118471330 ACCTGGCCTTTCTGGCTCTGTGG - Intergenic
1075604185 10:123792517-123792539 CCCCTGGCTTCCTGTCTCTGGGG - Intronic
1076078315 10:127555252-127555274 CCCTCGGTTTTCTGCCGCTATGG + Intergenic
1076421680 10:130336407-130336429 CCCATGGCATTTTCCCTCTGTGG - Intergenic
1076512366 10:131021806-131021828 CCCGTGGCTTTCTGCCGCATGGG + Intergenic
1077430422 11:2513451-2513473 CCCTAGGCTCTATGGCTCTGAGG - Intronic
1078082667 11:8215665-8215687 CCCTTGATATTCTGCCTCTAAGG + Intergenic
1078655134 11:13231623-13231645 CCCTCTGCTTCTTGCCTCTGGGG + Intergenic
1078882402 11:15465020-15465042 CTCTAGGATTTCTGTCTCTGGGG + Intergenic
1078893752 11:15580036-15580058 CTCTTGGCTTTCTGAGGCTGAGG + Intergenic
1079139106 11:17795795-17795817 CCCATGGCTGTCTTCCTCAGTGG - Intronic
1080500988 11:32870759-32870781 CTCATGGCTAGCTGCCTCTGTGG - Intergenic
1080569197 11:33541107-33541129 TCCTTGTCTGTCTGCCTGTGGGG + Intergenic
1081585348 11:44380295-44380317 TTCTTGGGTTTCTGCCTCTTTGG + Intergenic
1082567721 11:54700569-54700591 CCCAAGGCTTTCTGTCTCTCAGG + Intergenic
1082920529 11:58487573-58487595 CCATTGGCTCTCTGGCTCTCAGG + Intergenic
1083159723 11:60847699-60847721 GCCTTGGCTACATGCCTCTGAGG - Intronic
1083230147 11:61312151-61312173 GCCTTGTTTTTCTTCCTCTGTGG - Intronic
1084133259 11:67154383-67154405 CCTCTGGCTTTCTGTCTCTATGG + Intronic
1084205735 11:67591222-67591244 CCCATTGCTTTGTCCCTCTGTGG - Intergenic
1084310983 11:68316128-68316150 CAGTCGACTTTCTGCCTCTGTGG + Intronic
1084786181 11:71442987-71443009 CACTGAGCTTTCTGCCTCTGTGG + Intronic
1084857534 11:71998598-71998620 CCCTGGTCTTTCTGCCTCCATGG + Intronic
1085397136 11:76212220-76212242 GCCTTTGCTCTCTGCCTCTTAGG - Intergenic
1085475437 11:76785870-76785892 CCCATTGCTTCCTACCTCTGTGG + Intronic
1085484092 11:76847326-76847348 CCCTTCCCTTTCTGCCACTTTGG - Intergenic
1085919972 11:80942129-80942151 CCCTTGCTTTTCTTCCTATGTGG + Intergenic
1087516650 11:99172138-99172160 CCGTTGCAGTTCTGCCTCTGTGG + Intronic
1087837172 11:102886722-102886744 CCCCTGGGTTACTCCCTCTGCGG - Intergenic
1088395594 11:109364527-109364549 TCTTTGGCTTTCTGTTTCTGAGG + Intergenic
1088498780 11:110460591-110460613 CATTTGGCTTTCTCCCTCGGTGG + Intronic
1088581289 11:111319377-111319399 TCTTTGGCTTTCTCCCACTGTGG + Intergenic
1088756457 11:112889466-112889488 GCCTTGGCCTTCAGTCTCTGGGG - Intergenic
1088858652 11:113779762-113779784 TCCTTTTCTTTCTGCATCTGTGG + Exonic
1089325733 11:117655595-117655617 CCCTGGGATTTCTGGCACTGGGG - Intronic
1089533015 11:119143977-119143999 CCCTTGGCATTCTGCAGCTTTGG + Intergenic
1090907881 11:131093321-131093343 GCCATGCCTCTCTGCCTCTGAGG + Intergenic
1091710728 12:2738204-2738226 CCCCTGGCTTTGAGCCTCTCAGG - Intergenic
1092834857 12:12477772-12477794 CCTTTGTCCTGCTGCCTCTGAGG + Exonic
1092913391 12:13167721-13167743 AGCTTGGCTGTCTGCATCTGAGG - Intergenic
1096520389 12:52181544-52181566 CTCTTGGCTTCCTGCCTCTAAGG + Intronic
1097107023 12:56631979-56632001 CCCTTAGCCTTCTGTGTCTGTGG - Intronic
1097597123 12:61647719-61647741 CCCTTGCCTCTCAGTCTCTGTGG + Intergenic
1098011678 12:66059868-66059890 CATTTGTTTTTCTGCCTCTGTGG - Intergenic
1104423097 12:128653224-128653246 TAATTGGCTTTCTGCCTCTATGG - Intronic
1105401757 13:20102384-20102406 CCCTTTGCTCTCTGGCTCTCTGG - Intergenic
1105474272 13:20717583-20717605 GCCTTGTCTTTCTGCTTCTCTGG + Intronic
1106895740 13:34300426-34300448 CCTTTCTCTTTCTGCCTTTGAGG - Intergenic
1109331744 13:60939661-60939683 CCCTTGGCTCTCCGTCTCTGTGG - Intergenic
1110158780 13:72351097-72351119 TCGTGGGCTATCTGCCTCTGAGG - Intergenic
1111455522 13:88478438-88478460 CTCATGTCTTTCTGCCTCAGGGG - Intergenic
1112128963 13:96500116-96500138 CGATCGACTTTCTGCCTCTGTGG + Intronic
1112566376 13:100554217-100554239 ACCTTGGCTTTCATCCCCTGGGG - Intronic
1112958807 13:105095840-105095862 CCCTTCTCTTTCTACCTCTAAGG - Intergenic
1113124822 13:106965714-106965736 CCCTTGGCTCTCTGGCTCTCAGG - Intergenic
1114459338 14:22876898-22876920 CCTTTGGCCCTCTGACTCTGAGG + Intronic
1115065317 14:29253046-29253068 CTCTTCGCTTTCTGGATCTGTGG + Intergenic
1115490369 14:33952492-33952514 CCCTCTCCTCTCTGCCTCTGAGG + Intronic
1115525145 14:34272419-34272441 CCTTGGCCTTTCTGCCACTGAGG - Intronic
1115752080 14:36504040-36504062 TCCTGGGCTTTGGGCCTCTGGGG + Intronic
1116396809 14:44456111-44456133 GCCTTGGCTTTGTGTCTGTGTGG - Intergenic
1116919715 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG + Intronic
1117581678 14:57157680-57157702 CCCTTGGCTGTCAGCCTCTCTGG + Intergenic
1118616169 14:67575827-67575849 CCCTGGGCTGCCTGCCTGTGCGG + Exonic
1119595959 14:75934092-75934114 CTCATGGCTTTCTGGCTCAGGGG - Intronic
1120754564 14:88230342-88230364 CCCTTGGCTGTTTGCCCTTGTGG - Intronic
1120899931 14:89566925-89566947 CCCTTGCCTTTTTTCCTCTAAGG + Intronic
1121272031 14:92644132-92644154 CTGAGGGCTTTCTGCCTCTGAGG + Intronic
1121537367 14:94700071-94700093 CCCTTGGGATTCTTCCTCTGAGG - Intergenic
1122255672 14:100473831-100473853 TCTTTGGCTTTCTGGCACTGTGG + Intronic
1122261921 14:100528567-100528589 GCCTTGGCTTTCTTTCTATGAGG + Intronic
1124902850 15:33840507-33840529 CCCATGTCTTTCTGACCCTGTGG + Intronic
1126175764 15:45733880-45733902 CCTTTGGATTCCTGGCTCTGAGG - Intergenic
1126919570 15:53505872-53505894 GCCTTTGCTTTCTGACTCTTTGG - Intergenic
1127221605 15:56886748-56886770 TCCTTTCCTTTCTGCATCTGGGG - Intronic
1127525290 15:59786711-59786733 CCCTGGGCTATCTGCCTCCCAGG + Intergenic
1127819416 15:62641837-62641859 CCCTTGGATCTCTGCCTGTAAGG - Intronic
1128563884 15:68686423-68686445 CACTTGGCTGTCTGCCTCTAAGG - Intronic
1128686450 15:69689848-69689870 CTCTTGGATTGCTCCCTCTGAGG + Intergenic
1129452750 15:75659924-75659946 CTCTTTTCTTTCTGCCTCTATGG + Exonic
1129992075 15:79974067-79974089 CTCTTGGCTTTGTGCTCCTGTGG - Intergenic
1131426545 15:92349905-92349927 CCCATGTCTTGCTGCCTGTGTGG - Intergenic
1131808015 15:96143122-96143144 CCCTCTGCTTTCTAGCTCTGTGG - Intergenic
1132367409 15:101267540-101267562 CCCATGTGTTTCTGCATCTGCGG - Intergenic
1132676544 16:1123534-1123556 GCCTTGGCTTTGGGCTTCTGGGG + Intergenic
1132836131 16:1954345-1954367 CCACAGGCTTCCTGCCTCTGTGG + Intronic
1132863108 16:2081214-2081236 CCCTGGGCTCTGGGCCTCTGCGG - Intronic
1133530718 16:6652719-6652741 CCTTCTGCTTTCTGTCTCTGTGG - Intronic
1134057613 16:11180402-11180424 CCTTTGGGTTTCTGCCCATGTGG - Exonic
1134191743 16:12126732-12126754 TCTTTGACATTCTGCCTCTGGGG + Intronic
1134369919 16:13613671-13613693 CCATTGGCTTTCTGCCTCTCAGG - Intergenic
1134527838 16:14957957-14957979 CCCCATACTTTCTGCCTCTGTGG - Intergenic
1134583968 16:15395595-15395617 CCCCATGCCTTCTGCCTCTGTGG + Intergenic
1136192326 16:28623763-28623785 CCCCATGCCTTCTGCCTCTGTGG - Intergenic
1137444937 16:48525937-48525959 CCCTTGTCTTCTTGTCTCTGAGG + Intergenic
1137612314 16:49826898-49826920 CCCTTTGCTTTCTTCCCCAGTGG - Exonic
1137764508 16:50967594-50967616 GCCTTGGCTTCCTGCCTCACTGG - Intergenic
1138106730 16:54291056-54291078 TCCTTGGATTTCTGTCTCTCAGG + Intergenic
1139199862 16:64963580-64963602 CTCTGAGCTTTCTGCATCTGTGG - Intronic
1139377493 16:66509262-66509284 CTCCTGGCTTCCTTCCTCTGGGG - Exonic
1139650540 16:68360028-68360050 ACCTTGGCTTCCTGCCTCCTAGG + Exonic
1140317574 16:73913903-73913925 CCCTAGACTTTCTGTATCTGTGG - Intergenic
1140457842 16:75115071-75115093 CCGTGGGCTGCCTGCCTCTGGGG - Intronic
1141215198 16:82017382-82017404 CATTCGGCTTTCTGTCTCTGTGG - Intergenic
1141469276 16:84227876-84227898 CCCTCTGCTTTCTGTCTCTGTGG - Intronic
1141905416 16:87022309-87022331 TCTTTGGCTTTCTTCCTCAGGGG - Intergenic
1142134205 16:88444195-88444217 CCCTTGGGTCTCAGCCTGTGGGG + Intergenic
1142305598 16:89283003-89283025 TCCTTGTCCTTCTGCCTCTCAGG + Exonic
1142740067 17:1926688-1926710 CACTTGGATTTCTTCCTCTTGGG + Intergenic
1143728541 17:8866619-8866641 CACTTGCTTTCCTGCCTCTGGGG + Intronic
1143889424 17:10091201-10091223 CCATCTGCTTTCTGTCTCTGTGG - Intronic
1144653133 17:17019371-17019393 CCCATGGCTTCCTGGCCCTGAGG - Intergenic
1144826746 17:18109425-18109447 TCCTGGGCTTTCTGGATCTGTGG + Intronic
1145694383 17:26775197-26775219 CCCTTGGCTTTTTACCCCCGCGG + Intergenic
1146372263 17:32272512-32272534 CCCGTGGCTTTGTTCCTCTCTGG - Intronic
1146603861 17:34241248-34241270 GCCTTGGCTTTCTGCCTGTAGGG + Intergenic
1146722330 17:35132225-35132247 ACCTTCGATTTCTGGCTCTGGGG + Exonic
1146735581 17:35235970-35235992 GCCTTGGGATTCTCCCTCTGGGG + Intergenic
1147181028 17:38685821-38685843 CCCTTGCTGTCCTGCCTCTGGGG + Intergenic
1148822895 17:50370749-50370771 TCCTTGGCTTTCTCCTTTTGGGG + Intronic
1149254329 17:54807777-54807799 CCCTTGGCTTAGTGACTTTGGGG - Intergenic
1149504711 17:57184444-57184466 GCCCTGGCTTTCTGCCTGGGAGG - Intergenic
1149770738 17:59318890-59318912 CTGTTGGCTTTCTGCTTTTGAGG + Intergenic
1149772675 17:59333099-59333121 CCCGTGCTTTCCTGCCTCTGGGG + Intronic
1151575582 17:74951220-74951242 CCCATTGGCTTCTGCCTCTGGGG + Exonic
1151902873 17:77028662-77028684 CCATCTGCTTTCTGTCTCTGTGG - Intergenic
1152290370 17:79436830-79436852 CCCTGGGCTCCCTGGCTCTGAGG - Intronic
1152337007 17:79704497-79704519 CCATTTGCTCTCTGTCTCTGTGG - Intergenic
1152513798 17:80809165-80809187 CACTTGGCATTCTGCCTTTTCGG + Intronic
1152794283 17:82299253-82299275 GCCTTGGCCTTCTGCGACTGTGG + Intergenic
1153584602 18:6608233-6608255 CCATTGGCTCTCTGGCTCTCAGG - Intergenic
1154963257 18:21330649-21330671 CCTTTGGTTTTCTTCCACTGAGG + Intronic
1155834572 18:30564649-30564671 CCCTTGGGTTTATGAATCTGTGG + Intergenic
1157086363 18:44584214-44584236 CCCTTAGCTTCCTCCCTCTATGG - Intergenic
1157682138 18:49615458-49615480 CCCTCTGCTTTCTGTGTCTGTGG + Intergenic
1158161847 18:54493720-54493742 CCCTTGTCTCCCTGTCTCTGTGG + Intergenic
1159012863 18:63074768-63074790 CCTTTGGATTTCTGCTTCTGAGG + Intergenic
1159864700 18:73690350-73690372 TCCTTGTCTTCCTGTCTCTGAGG - Intergenic
1161064145 19:2229314-2229336 CCCCTGGCCTTCTGCCTCAGGGG + Intronic
1161319210 19:3633286-3633308 CCCTGGGCTCTCTGGCTCTGAGG - Intronic
1161390133 19:4016382-4016404 ACCAGGGCTATCTGCCTCTGGGG - Intronic
1161704024 19:5809705-5809727 CTCTGGGCTTTCTGCCACTGGGG + Intergenic
1162208225 19:9071866-9071888 CCCTAGGCTTTGTGCCTCACTGG - Intergenic
1163362025 19:16852793-16852815 CCCTTGCCTTTCTGATGCTGTGG + Intronic
1163444098 19:17336833-17336855 TCCTTGGCTCTCTGTCTCTCTGG - Intronic
1164280473 19:23763873-23763895 CCCTTTGCTTTATGTCTCTCAGG - Intronic
1164734516 19:30531003-30531025 TGCTTGGCTTTCAGCCTCTCTGG + Intronic
1165128076 19:33614826-33614848 CCTTTTGCTTTCTAGCTCTGGGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1166318632 19:42003055-42003077 TTCTTGCTTTTCTGCCTCTGTGG + Intronic
1166435410 19:42763212-42763234 CTCTTGTGTTTCTGCTTCTGGGG + Intronic
1166491836 19:43267081-43267103 CCCTTCTGTTTCTGCTTCTGGGG + Intronic
1167516886 19:49928902-49928924 TCTTTCTCTTTCTGCCTCTGAGG - Exonic
1168374741 19:55867284-55867306 CACTTGGCTTACGGTCTCTGGGG - Intronic
1202680338 1_KI270712v1_random:3253-3275 GCCTTGGCTTTTTGCCGCCGCGG - Intergenic
925408766 2:3626843-3626865 CCCTGGGCGCTCTGCCTGTGTGG + Intronic
925830070 2:7885034-7885056 CCCCTTGCTTTCTGGCTTTGAGG + Intergenic
926345747 2:11943375-11943397 CTCCTGGCTATCTGACTCTGGGG - Intergenic
927521984 2:23704383-23704405 CCCCAGGCTTTCTGGCCCTGTGG + Intronic
927981494 2:27377646-27377668 GCCTGGTCTCTCTGCCTCTGAGG - Exonic
928718831 2:34095671-34095693 ATGTTGGCTTTCTTCCTCTGTGG + Intergenic
930411254 2:51028357-51028379 CCCTTACCTTTCTGTCTCTCGGG - Exonic
932706301 2:74027556-74027578 CACTTATCTTTCTGTCTCTGTGG + Intronic
933001172 2:76925401-76925423 CCCCTTGATTTCAGCCTCTGAGG + Intronic
933598894 2:84309517-84309539 CCAGTGGCTTTCTGCCGCTTTGG + Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
934148064 2:89115825-89115847 CCTTTGTCTCTCTGCCTCTTAGG - Intergenic
934221221 2:90084784-90084806 CCTTTGTCTCTCTGCCTCTTAGG + Intergenic
934248110 2:90324448-90324470 CCCGCGGCTTTTTGCCTCCGCGG - Intergenic
934554973 2:95282276-95282298 CTCTGGTCTTTTTGCCTCTGTGG + Intronic
934887026 2:98033795-98033817 CCCTTGGCTTTGTGATTTTGAGG - Intergenic
936630710 2:114199917-114199939 CTCTTGGCACACTGCCTCTGGGG - Intergenic
936680267 2:114761942-114761964 TGCCTGGCTTTCTGTCTCTGTGG - Intronic
937133793 2:119534879-119534901 CCCCTGTCTTCCTGTCTCTGTGG + Intergenic
937347600 2:121136215-121136237 CCCTGGGCACACTGCCTCTGGGG - Intergenic
937547989 2:123048324-123048346 CTCTTGGATTTCTGACTGTGGGG - Intergenic
938555358 2:132418486-132418508 GGCTTGGGTTTCTGCCACTGTGG + Intronic
938607969 2:132915852-132915874 CCCTAAGCCATCTGCCTCTGGGG - Intronic
938778250 2:134560652-134560674 CTCTTGGCTTTCTGGGTCCGGGG - Intronic
939579987 2:143936831-143936853 CCCTGTGCTTTATGCGTCTGAGG - Intergenic
944906975 2:204271753-204271775 CACTTGACTTTTTGACTCTGAGG - Intergenic
946226504 2:218266661-218266683 CCCAAGGTTTCCTGCCTCTGGGG + Intronic
947115058 2:226760929-226760951 ACCTTAGCTTTCTGCCTATTTGG - Intronic
948124665 2:235555998-235556020 TCCTTGTGTTTCTGCCTGTGGGG + Intronic
948760088 2:240184911-240184933 CTCTTACCTTGCTGCCTCTGCGG - Intergenic
1169366226 20:4995035-4995057 TTCTTGGCTTTGTGACTCTGAGG - Intronic
1169729083 20:8767215-8767237 CCCTAGAGTTTCTGCCTCAGGGG + Intronic
1170688076 20:18587522-18587544 TCCTTGTCTTCCTGCCTCAGTGG - Intronic
1170963067 20:21042575-21042597 CCATTGGCTCTCTGGCTCTCAGG - Intergenic
1173013517 20:39204212-39204234 CCCTTTACTTACTGCCACTGAGG + Intergenic
1173423736 20:42925698-42925720 CCCTTGGGTTTCTGATTCAGTGG + Intronic
1173685184 20:44918587-44918609 CCCTTGTCTGTCTGACTCTCAGG + Intronic
1174580944 20:51571051-51571073 GGCTTGTCTTTCTCCCTCTGTGG + Intergenic
1175414276 20:58791394-58791416 CCTCTGGGTCTCTGCCTCTGAGG + Intergenic
1175991457 20:62791837-62791859 CCCTTTGCTTTCTTCCTATTTGG - Intergenic
1176360954 21:5996037-5996059 CCCTGGGCTTCGTGCCTGTGAGG + Intergenic
1176378715 21:6101000-6101022 CACTCTACTTTCTGCCTCTGTGG + Intergenic
1177021130 21:15859500-15859522 CTCTTGTTTTTCTGGCTCTGTGG + Intronic
1177802467 21:25841309-25841331 TGCTTGGCTTTCTGCCTCAGTGG - Intergenic
1179614103 21:42570566-42570588 CTCTTGGCCTTGTGCCTCAGTGG + Intronic
1179614563 21:42573391-42573413 CCCTGTGCTGTCTCCCTCTGAGG + Intronic
1179744760 21:43437237-43437259 CACTCTACTTTCTGCCTCTGTGG - Intergenic
1179762564 21:43542513-43542535 CCCTGGGCTTCGTGCCTGTGAGG - Intronic
1180103988 21:45605335-45605357 CCCTGGGCTTCGTGCCTGTGAGG + Intergenic
1180132834 21:45837549-45837571 CCCTGGGTTGTCTGCCTCTTGGG + Intronic
1180567229 22:16682245-16682267 CATTTTGCTTTCTGTCTCTGTGG - Intergenic
1181482702 22:23211093-23211115 CAGTCTGCTTTCTGCCTCTGTGG + Intronic
1181732386 22:24856582-24856604 CCCTTTGCTTCCTCCCGCTGAGG - Intronic
1182108190 22:27704236-27704258 CCCCTGGGTTTCTGGGTCTGAGG - Intergenic
1182686912 22:32128191-32128213 GCCTTGGCTCTCTGGGTCTGTGG + Intergenic
1182961783 22:34482168-34482190 CAGTTTGCTTTCTGTCTCTGTGG - Intergenic
1183292468 22:37011127-37011149 GCCTTGGCTGCCTACCTCTGCGG - Exonic
1184168338 22:42743644-42743666 CCCTTTGGTCTCTCCCTCTGGGG + Intergenic
1184275253 22:43406197-43406219 CTCTGGCCTTTCTGCCTCGGGGG + Intergenic
1184486386 22:44782528-44782550 CCATCTGCTTTCTGTCTCTGTGG + Intronic
1184834668 22:47014172-47014194 CCCCTGGCTTTCTGCAGCGGTGG + Intronic
1185179926 22:49353377-49353399 CCGGTGCCTTTCTGCCACTGAGG + Intergenic
1203238653 22_KI270732v1_random:31663-31685 GCCCTGGCTTTCTGCCGCCGCGG + Intergenic
949851883 3:8428282-8428304 GCCTTGGCTATCTGCCTTGGGGG + Intergenic
950897613 3:16467677-16467699 CCGTTGGCTTTTTGCATCTCTGG - Intronic
951026036 3:17831202-17831224 CCCTTGGATTTCTCACTCTAGGG + Intronic
952037805 3:29224155-29224177 CCCTTTGCTTTCTGCTTCTAGGG + Intergenic
954152568 3:48664817-48664839 CCCCTGCCTGTCTGCCTCCGTGG - Intergenic
954318157 3:49812517-49812539 CCCCTGGCATTCTCACTCTGAGG - Exonic
954614804 3:51964166-51964188 TCCCTGGCTTTCTGCCACTCAGG + Intronic
954616197 3:51969866-51969888 CCCTGGGCTTTCCTCATCTGGGG - Intronic
955232424 3:57110882-57110904 CCCTTGGGTGTCTGCCTTTCAGG - Intronic
955901205 3:63757361-63757383 CCCCTGGCTTGCTGCTTATGTGG - Intergenic
956268577 3:67425641-67425663 CCATTGGCTCTCTGGCTCTCAGG + Intronic
956838173 3:73112730-73112752 CCCTTGGCGTGATGGCTCTGGGG + Intergenic
959965879 3:112354276-112354298 CCCTTGGCTTTTTGGCCATGGGG + Intronic
961201085 3:125046088-125046110 CCTTCTGCTTTCTGCCTCTGTGG - Intronic
962370317 3:134816029-134816051 ACGTTGTCCTTCTGCCTCTGAGG + Intronic
962751990 3:138440309-138440331 CCCTTGGCTGTCTGCCTGAGTGG - Intronic
962855496 3:139341059-139341081 CTCTTGAGTTCCTGCCTCTGGGG + Intronic
963482318 3:145891653-145891675 ACCTTTTCTTTCTTCCTCTGTGG + Intergenic
963572956 3:147020506-147020528 GCCAAGGCTTTGTGCCTCTGGGG - Intergenic
963759370 3:149271686-149271708 CACTTGGCTTTCTGTCTGGGGGG - Intergenic
964098875 3:152964905-152964927 CCCTAGCCTTTGAGCCTCTGGGG - Intergenic
964151356 3:153528411-153528433 CCTCTGTCTTTCTGTCTCTGTGG + Intergenic
964616561 3:158672675-158672697 CCCTGGGCTGACTGCTTCTGAGG + Exonic
965097099 3:164244337-164244359 CCATTTGCTTTCTGGCTCTCAGG - Intergenic
966913744 3:184573598-184573620 CCCTGGGCTCTCTGCCCCTTGGG + Intronic
967048546 3:185760583-185760605 CAGCTGGCTTTCTGCCTCTGTGG + Intronic
967336567 3:188350902-188350924 CCCTTGCCATTTTGCCTGTGTGG + Intronic
967500999 3:190197419-190197441 CCCTGGCCTTTCAGACTCTGGGG - Intergenic
967544114 3:190703241-190703263 CCCTTGGTTTTATGCCTTTTAGG - Intergenic
967942981 3:194780473-194780495 CGCTTGACCTTCTGCCTCTTGGG + Intergenic
967981616 3:195069394-195069416 CCCCTTGCTGTCTGCCTCTGAGG - Exonic
969267641 4:6075284-6075306 CACTTGGCTTTCTGTATCTGTGG - Intronic
969531769 4:7734381-7734403 CCCTTGGCTGCCCTCCTCTGCGG + Intronic
969868040 4:10087895-10087917 CCATTTGCTTTCTGCTTCTGGGG - Exonic
972088680 4:35253345-35253367 CCCTTGGATTTCTGGACCTGTGG + Intergenic
972565655 4:40266845-40266867 CCCTTGGCTTTGTGATTTTGGGG + Intergenic
973884592 4:55307481-55307503 ATCTTGGCTCACTGCCTCTGGGG + Intergenic
976395203 4:84547889-84547911 CCTTTGGCTTTCTGCCTATCAGG + Intergenic
976769091 4:88632045-88632067 CCTATGGACTTCTGCCTCTGGGG - Intronic
976997550 4:91454396-91454418 CACATTGTTTTCTGCCTCTGCGG + Intronic
977065145 4:92304804-92304826 CCCTTCGCTTTCCCCCTCTCCGG + Intronic
977456392 4:97266384-97266406 CCTTTTGCTTTCTCCCTCTGTGG + Intronic
978456653 4:108900123-108900145 CCTTTGGCTTTCTGCATTTCTGG + Intronic
981269572 4:142829380-142829402 CCCTTGGCTTTTGCCCTGTGAGG + Intronic
982702612 4:158672643-158672665 ACCCTGGCTTCCTCCCTCTGGGG + Intronic
983908280 4:173206959-173206981 CACTTTGCTTTCTGTCCCTGTGG + Intronic
985050554 4:185986916-185986938 CCCTTGGTTTTCAACCACTGTGG + Intergenic
985573679 5:663940-663962 CCCTTGCCTGTCTGCACCTGGGG - Exonic
985713348 5:1442432-1442454 ATCTTCGCTTTCTGGCTCTGTGG + Intronic
987471121 5:18329500-18329522 TCCTTTGTTTTCTGCCTCTCTGG - Intergenic
990135031 5:52634748-52634770 CACATGGCTTTCTCCCTGTGTGG + Intergenic
991309197 5:65216388-65216410 CCATCTGCTTTCTGTCTCTGTGG - Intronic
991941691 5:71859499-71859521 CCCTTTGCTTTGTGCCTCCGTGG + Intergenic
992073716 5:73172324-73172346 CCTTTTGCTTTCTGCGTTTGGGG - Intergenic
992098477 5:73382789-73382811 CCCTGGGCTTCCTGGCTTTGGGG + Intergenic
992678220 5:79126996-79127018 GCCTTGCCTTTCTTCCTCTGTGG - Intronic
992778655 5:80109245-80109267 ATCTTGGCTCTCTGCCTCCGGGG + Intergenic
997260372 5:132461066-132461088 CCCTTGGGGTTCAGCCTCTGTGG - Exonic
997409996 5:133683793-133683815 GCCTTGCCTTTCTGCATTTGAGG - Intergenic
999079648 5:148830903-148830925 TCCTTTGCTTTCTACCTCTTTGG + Intergenic
999080989 5:148843548-148843570 AAGTTTGCTTTCTGCCTCTGGGG + Intergenic
999386749 5:151158869-151158891 CAATTTGCTTTCTGCTTCTGCGG + Intergenic
1000098643 5:157993423-157993445 CCATTGGCTTTCTGGCTCCCAGG + Intergenic
1000634827 5:163631981-163632003 CCCAGGGCTTTCTTGCTCTGAGG + Intergenic
1000904124 5:166942597-166942619 CCCTTGGGTTTGGGACTCTGAGG + Intergenic
1001964527 5:175900902-175900924 CCCATGGGTGTCTGCCCCTGGGG + Intergenic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1002533601 5:179863969-179863991 CCCTGGGCTTCCTGCCTGTGCGG + Exonic
1002971458 6:2026192-2026214 CCCTGGGCTTTCTGGCCATGTGG + Intronic
1003367089 6:5485044-5485066 CCATGGGCTTTCTCCCTCTTTGG - Intronic
1004660783 6:17707106-17707128 CCCTTGGCTTTGTGCCTCTGCGG - Intergenic
1005017950 6:21391725-21391747 CCCTAGTGTTTCTGCCTCAGTGG - Intergenic
1005927052 6:30452861-30452883 CGCTGGGATTTCTGCCACTGAGG - Intergenic
1006024361 6:31138010-31138032 CCCCTGGCCTCCTGCCCCTGAGG - Exonic
1006211958 6:32403252-32403274 CTCTGTGATTTCTGCCTCTGTGG - Intronic
1006572917 6:35020176-35020198 TCCATGGTTTTCTGCATCTGTGG + Intronic
1006801569 6:36763162-36763184 CAATTGGGTTTCTTCCTCTGTGG - Intronic
1010057786 6:71585902-71585924 CCCTTAGCCTGCTGCCTCAGAGG - Intergenic
1011164197 6:84427623-84427645 TCCTTGTCTATCTGCCTCTGTGG - Intergenic
1011511838 6:88109638-88109660 CCTCTGGCTTTCTGCCTGAGAGG + Intergenic
1011699542 6:89942753-89942775 CCCTTGGCCTGCTGACTCAGTGG - Intronic
1012827960 6:104169483-104169505 CCATTGGCTCTCTGGCTCTCAGG + Intergenic
1013040354 6:106426798-106426820 CTCTTCTCTCTCTGCCTCTGTGG - Intergenic
1013415205 6:109918501-109918523 CCCCTGGCTTTGTGCTTCTCTGG - Intergenic
1013781996 6:113739063-113739085 CTCTTGGATTACTTCCTCTGGGG - Intergenic
1015629708 6:135219601-135219623 CCCTTGGCTCCCTCCCTGTGAGG - Intergenic
1016774149 6:147885845-147885867 GCCTTGGCTTTTTTGCTCTGTGG + Intergenic
1017829460 6:158112744-158112766 CCCCTTTCTTACTGCCTCTGAGG - Intronic
1018156294 6:160988460-160988482 TGCCTGTCTTTCTGCCTCTGCGG + Intergenic
1018582824 6:165322352-165322374 CCATTGGCTCTCTGACTCTTAGG + Intergenic
1018898675 6:168039504-168039526 CCCTTCCCTTGCTGCCTCCGGGG - Intronic
1018935678 6:168272504-168272526 CTCCTGGCTTTCTGCCTGTGGGG + Intergenic
1019625027 7:2011582-2011604 TCCCTGCCTTTCTGCCTCAGCGG - Intronic
1019727248 7:2609911-2609933 CCCATGGCTTACTGCTTCTCGGG + Intronic
1019777154 7:2918608-2918630 CCCCTGAATTTCAGCCTCTGAGG - Intronic
1019973140 7:4558259-4558281 CCATCGGCTTTCTGCCTCCATGG - Intergenic
1021111299 7:16697606-16697628 TCCTTGACTTTCTGACACTGAGG - Intronic
1021264311 7:18500436-18500458 GCCTTGGCTGTTAGCCTCTGAGG - Intronic
1022128027 7:27376742-27376764 CCTTTTCTTTTCTGCCTCTGAGG + Intergenic
1022357685 7:29631118-29631140 TCCTTGGCTGTCTGCTTTTGGGG - Intergenic
1022368004 7:29744076-29744098 TCCTTGGCTGTCTGCTTTTGGGG - Intergenic
1023702380 7:42905260-42905282 TCCTTGCCTTTCTTCCTCTTGGG + Intergenic
1023991073 7:45129119-45129141 CAATTGACTTTCTGTCTCTGTGG + Intergenic
1024624372 7:51192039-51192061 CCCTTGACTTCCTGCTTCTCAGG - Intronic
1024893190 7:54226545-54226567 ACCCTGGCTCTCTGCCTGTGGGG - Intergenic
1024900728 7:54315842-54315864 ACCCTGGCTCTCTGCCTGTGGGG + Intergenic
1026217191 7:68360027-68360049 CCTTTGGCTCTCTGGCTCTCAGG + Intergenic
1026561900 7:71457341-71457363 CCCTTGGCTTTGTGATTCTGGGG + Intronic
1027143855 7:75680369-75680391 CCCATTTCTCTCTGCCTCTGTGG + Intronic
1028645867 7:93096038-93096060 CCCTGGGCTTTCTCCTTGTGGGG + Intergenic
1029972844 7:104805893-104805915 CCCTGGGCTCTCTTCCTCTGTGG + Intronic
1030114201 7:106050702-106050724 GTCTCGGCTTTGTGCCTCTGGGG - Intergenic
1030547056 7:110909155-110909177 CCTTTGCCTTTCTGCCACTCTGG - Intronic
1030601857 7:111602065-111602087 CCCCTGTCTTTTTGCCTCTTTGG - Intergenic
1031206936 7:118771888-118771910 GCTTTGACTTCCTGCCTCTGTGG + Intergenic
1031331650 7:120473135-120473157 ACCATGGTTTTCTCCCTCTGTGG - Intronic
1031336377 7:120538514-120538536 GCCTGGTCTCTCTGCCTCTGAGG + Intronic
1031541507 7:123000596-123000618 CCCTGGACTTTCTGAATCTGGGG - Intergenic
1031965463 7:128025024-128025046 CCCTTAGCTGTCACCCTCTGTGG + Intronic
1032984924 7:137327404-137327426 CCCTCTGTTTTCTGTCTCTGAGG + Intronic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1034435512 7:151061148-151061170 ACCTTGAGGTTCTGCCTCTGAGG - Intronic
1035521940 8:281840-281862 CCCTTGGCTTTCTGGCTCTTTGG + Intergenic
1037269440 8:17110451-17110473 CACTCTGCTTTCTGTCTCTGTGG + Intronic
1038061288 8:23916293-23916315 CTCTTGGCTTCCTGGATCTGTGG + Intergenic
1038498560 8:28024633-28024655 CCCTTGGCTTTCTGTGCCCGAGG + Intronic
1038980142 8:32750806-32750828 CCCTTGTGTTTCTCCCTCTTTGG - Intronic
1039581822 8:38672932-38672954 CCCCTGGCTTTCAGTCTCTGTGG + Intergenic
1039793179 8:40891548-40891570 CCCTGGGCCCTCTGCCCCTGAGG + Intronic
1040554403 8:48466426-48466448 AGCTTGGGTTTCTGACTCTGAGG + Intergenic
1041548501 8:59074710-59074732 CCCTTGACTCTGTGCCTCTTAGG + Intronic
1042490688 8:69394103-69394125 TCCTGGGCTCTCAGCCTCTGGGG + Intergenic
1044411565 8:91889782-91889804 CTCTTGGCCTACTGCCTATGAGG - Intergenic
1044589518 8:93900045-93900067 TCCAGGGCTTTCTTCCTCTGAGG + Intronic
1044928230 8:97227256-97227278 CCTTTGCCCTTCTTCCTCTGAGG - Intergenic
1045357382 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG + Intergenic
1048385959 8:133912735-133912757 GCCTTGGCTGTCTGCCTCCTGGG - Intergenic
1049429635 8:142554543-142554565 CCCTGGGCTCACTGCCTATGGGG - Intergenic
1049516929 8:143064646-143064668 CAATTGGCTTTCTGTGTCTGTGG + Intergenic
1049627368 8:143631311-143631333 CCCTGGGCTCACTGCCTATGGGG - Intergenic
1050147339 9:2583401-2583423 CCCGAGGCTTTCTGCCTCCAAGG - Intergenic
1051002418 9:12300507-12300529 ACCTTGGCTATTTACCTCTGAGG - Intergenic
1054989648 9:71308720-71308742 ACTTTGGTTTTCTGCTTCTGTGG - Intronic
1056489558 9:87091979-87092001 ACATTGGCTTCCTGCTTCTGAGG - Intergenic
1056793838 9:89642967-89642989 CTCTTGGTTTTCTCACTCTGTGG + Intergenic
1056979449 9:91295107-91295129 CCCTTGGCTTTCATTCTCTCTGG + Intronic
1057191005 9:93087684-93087706 CCCTTGGCTGCATGCCTCAGGGG + Intergenic
1057222550 9:93265010-93265032 CCCCTGGCTTTCTGCTCCTAGGG + Intronic
1057479171 9:95430666-95430688 CTCTTGGTGGTCTGCCTCTGTGG + Intergenic
1057761093 9:97874969-97874991 GTCTTGGCTTTCTGGCACTGTGG + Intergenic
1058106826 9:100981618-100981640 ACCTTCATTTTCTGCCTCTGTGG - Intergenic
1059701313 9:116777609-116777631 CCCTAGGGTTTCTGACTCCGAGG + Intronic
1059874649 9:118620860-118620882 AACTTGGCTGTCTGCCCCTGGGG + Intergenic
1059896462 9:118871658-118871680 GCCTTGTCATTCTGCCTGTGTGG + Intergenic
1060268178 9:122124371-122124393 CCCTTGGCTCTCAGGCTCTCAGG + Intergenic
1060891212 9:127189751-127189773 CCTTTGGCTCTCTGCCTGTGGGG - Intronic
1061917427 9:133762701-133762723 CTCTGGGCTGTATGCCTCTGGGG - Exonic
1062181241 9:135192352-135192374 CACTTTGCTTTAAGCCTCTGAGG - Intergenic
1185549700 X:973201-973223 CCCTTGGCCTTCTGATCCTGGGG - Intergenic
1187008856 X:15259519-15259541 ACCTTGGCATGCTGCCTTTGAGG - Intronic
1189717836 X:43883214-43883236 AACTTGGCTTGCTGCTTCTGGGG - Intergenic
1189959165 X:46308121-46308143 ATCTTGGCTTTTTTCCTCTGGGG - Intergenic
1194197263 X:90910079-90910101 CCATTGGCTCTCTGGCTCTCAGG + Intergenic
1195022636 X:100845247-100845269 CACTTTACTTTCTGTCTCTGTGG + Intronic
1195151447 X:102074218-102074240 CCCTTTACTTTGTGCCTTTGGGG - Intergenic
1197262828 X:124334865-124334887 TTCTTGGCCTTCTGCCTCTGAGG - Intronic
1197345572 X:125322904-125322926 TCCTTGACCTTCTGCCCCTGAGG - Intergenic
1198619539 X:138490794-138490816 GCCTGGGCTTTCTGCCTCCATGG - Intergenic
1199995677 X:153024245-153024267 TCCATGGCTCTCTCCCTCTGTGG - Intergenic
1200544456 Y:4502732-4502754 CCATTGGCTCTCTGGCTCTCAGG - Intergenic
1201265055 Y:12198310-12198332 GTCTTTGCTGTCTGCCTCTGAGG + Intergenic
1202169114 Y:22022088-22022110 AACTTGGTGTTCTGCCTCTGAGG + Intergenic
1202222247 Y:22564280-22564302 AACTTGGTGTTCTGCCTCTGAGG - Intergenic
1202320868 Y:23631381-23631403 AACTTGGTGTTCTGCCTCTGAGG + Intergenic
1202549899 Y:26038675-26038697 AACTTGGTGTTCTGCCTCTGAGG - Intergenic