ID: 922614813

View in Genome Browser
Species Human (GRCh38)
Location 1:226955443-226955465
Sequence TCCTTGGCTGCCACTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 7, 2: 20, 3: 43, 4: 331}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922614803_922614813 24 Left 922614803 1:226955396-226955418 CCCTGGCTGCCACTCTCCCTGGC 0: 7
1: 5
2: 20
3: 127
4: 512
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614805_922614813 15 Left 922614805 1:226955405-226955427 CCACTCTCCCTGGCTGCCACTCT 0: 2
1: 9
2: 21
3: 188
4: 1786
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614804_922614813 23 Left 922614804 1:226955397-226955419 CCTGGCTGCCACTCTCCCTGGCT 0: 6
1: 5
2: 24
3: 121
4: 602
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614811_922614813 -8 Left 922614811 1:226955428-226955450 CCCTGGTTCACACTCTCCTTGGC No data
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614807_922614813 8 Left 922614807 1:226955412-226955434 CCCTGGCTGCCACTCTCCCTGGT 0: 1
1: 20
2: 19
3: 56
4: 414
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614812_922614813 -9 Left 922614812 1:226955429-226955451 CCTGGTTCACACTCTCCTTGGCT 0: 1
1: 33
2: 11
3: 28
4: 253
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614809_922614813 -1 Left 922614809 1:226955421-226955443 CCACTCTCCCTGGTTCACACTCT 0: 12
1: 9
2: 3
3: 62
4: 632
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331
922614808_922614813 7 Left 922614808 1:226955413-226955435 CCTGGCTGCCACTCTCCCTGGTT 0: 1
1: 19
2: 17
3: 47
4: 374
Right 922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG 0: 1
1: 7
2: 20
3: 43
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922614813 Original CRISPR TCCTTGGCTGCCACTCTCCC TGG Intronic
900169610 1:1260201-1260223 TCCTGGGCTTCGCCTCTCCCTGG - Intronic
900181074 1:1311227-1311249 TCCTGGGCTGGCCCACTCCCTGG + Intronic
900242152 1:1622197-1622219 TCCTGGGCTGCCTCCTTCCCTGG + Intronic
900584789 1:3427587-3427609 TGCTTGGATGCCTCTTTCCCAGG - Intronic
901081206 1:6585315-6585337 CCCTTGCCTGCTTCTCTCCCAGG - Intronic
901131533 1:6964511-6964533 GCCATGGCTGCCTCTCTCCCAGG + Intronic
901884739 1:12215029-12215051 TCATTTCCTGCCACTGTCCCAGG - Intergenic
902187706 1:14737845-14737867 TCTTGGGCTGCCAATCTCCTAGG + Intronic
902402414 1:16165526-16165548 TCCCTGGCTGCCATGCTCCCTGG + Intergenic
902668583 1:17956170-17956192 TCCTCGGGTACCAGTCTCCCTGG - Intergenic
902710206 1:18234111-18234133 TGCTTGGCAGCCACTCATCCTGG + Intronic
902885744 1:19403484-19403506 TCCTTGTCTTGCACACTCCCAGG - Intronic
903576760 1:24344146-24344168 CCCTGGGCTTCCCCTCTCCCAGG - Intronic
903820123 1:26095385-26095407 TGCTGGGCGGCCACCCTCCCAGG + Intergenic
904464196 1:30698383-30698405 CCCCTGGCTGCCTCTTTCCCCGG - Intergenic
904748485 1:32725822-32725844 TCCTTGGTGCCCACTCTCTCTGG + Intergenic
905263877 1:36738075-36738097 TCCTTTGCTACCACTCACCATGG - Intergenic
905478838 1:38247518-38247540 TCCTTGGCTGCTATTCTGCTTGG + Intergenic
906371198 1:45255320-45255342 TCCTTAGATGCCCCCCTCCCTGG - Intronic
908445648 1:64196807-64196829 TCCGTGGCTGGCCTTCTCCCAGG - Intergenic
909683530 1:78319701-78319723 TCCTTTGCTGCCATTCCACCAGG - Intronic
912552214 1:110491690-110491712 TCCTAGGCTGCCATCCACCCTGG + Intergenic
913300538 1:117365697-117365719 TCCTTGCTTACCAGTCTCCCTGG + Intergenic
914889110 1:151607218-151607240 TCATTGACTCCCACTCTCTCTGG + Intergenic
915008544 1:152663425-152663447 TCCCAGGTTGCCACTCACCCTGG - Exonic
915009831 1:152675324-152675346 TCCCAGGTTGCCACTCACCCTGG - Exonic
915010988 1:152686152-152686174 TCCCAGGTTGCCACTCACCCTGG - Exonic
915012244 1:152698390-152698412 TCCCAGGTTGCCACTCACCCTGG - Exonic
915430334 1:155860927-155860949 TCTTTGGCAGCAACTCTCACTGG - Intronic
921046793 1:211483548-211483570 TCCTTTCGTCCCACTCTCCCAGG - Intronic
921213891 1:212921400-212921422 TCCCAGGCTGCCAGGCTCCCAGG - Intergenic
922614780 1:226955317-226955339 TCCCTGACTCCCACTCTCCCTGG + Intronic
922614792 1:226955363-226955385 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614797 1:226955379-226955401 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614802 1:226955395-226955417 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614806 1:226955411-226955433 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG + Intronic
922614816 1:226955459-226955481 TCCCTGGCTCCTACTCTCCCTGG + Intronic
922614820 1:226955475-226955497 TCCCTGGCTGCCACTCTCTCTGG + Intronic
922614826 1:226955505-226955527 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614829 1:226955521-226955543 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614834 1:226955537-226955559 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614849 1:226955598-226955620 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614852 1:226955614-226955636 TCCCTGGCTCCCATTCTCCCTGG + Intronic
922614857 1:226955630-226955652 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614862 1:226955646-226955668 TCCCTGGTTCCCATTCTCCCTGG + Intronic
922614867 1:226955662-226955684 TCCCTGGTTCCCGCTCTCCCTGG + Intronic
922614872 1:226955678-226955700 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614882 1:226955708-226955730 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614885 1:226955724-226955746 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614890 1:226955740-226955762 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614898 1:226955770-226955792 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614901 1:226955786-226955808 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614906 1:226955802-226955824 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614914 1:226955832-226955854 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614917 1:226955848-226955870 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922614920 1:226955864-226955886 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614923 1:226955880-226955902 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614931 1:226955910-226955932 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614934 1:226955926-226955948 TCCCTGGTTCCCATTCTCCCTGG + Intronic
922614950 1:226955988-226956010 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614953 1:226956004-226956026 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614958 1:226956020-226956042 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614961 1:226956036-226956058 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922614964 1:226956052-226956074 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614969 1:226956068-226956090 TCCCTGGTTCCCACTCTCCCTGG + Intronic
922614974 1:226956084-226956106 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614977 1:226956100-226956122 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922614980 1:226956116-226956138 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614983 1:226956132-226956154 TCCCTGGTTCCCATTCTCCCTGG + Intronic
922614988 1:226956148-226956170 TCCCTGGTTCACACTCTCCCTGG + Intronic
922614998 1:226956196-226956218 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615006 1:226956226-226956248 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615009 1:226956242-226956264 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615014 1:226956258-226956280 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615017 1:226956274-226956296 TCCCTGGCTTCCACTCTCCCTGG + Intronic
922615021 1:226956290-226956312 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615024 1:226956306-226956328 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922615027 1:226956322-226956344 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615030 1:226956338-226956360 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615035 1:226956354-226956376 TCCCTGGTTCCCACTCTCCGTGG + Intronic
922615040 1:226956370-226956392 TCCGTGGTTCACACTCTCCCTGG + Intronic
922615042 1:226956386-226956408 TCCCTGGTTCCCATTCTCCCTGG + Intronic
922615054 1:226956434-226956456 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615062 1:226956464-226956486 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615065 1:226956480-226956502 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615070 1:226956496-226956518 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615078 1:226956526-226956548 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615081 1:226956542-226956564 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615086 1:226956558-226956580 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615094 1:226956588-226956610 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615097 1:226956604-226956626 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922615100 1:226956620-226956642 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615103 1:226956636-226956658 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615111 1:226956666-226956688 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615114 1:226956682-226956704 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615119 1:226956698-226956720 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615126 1:226956728-226956750 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615133 1:226956758-226956780 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615147 1:226956820-226956842 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615150 1:226956836-226956858 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922615153 1:226956852-226956874 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615156 1:226956868-226956890 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615161 1:226956884-226956906 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615169 1:226956914-226956936 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615172 1:226956930-226956952 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922615175 1:226956946-226956968 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615178 1:226956962-226956984 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615186 1:226956992-226957014 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615206 1:226957084-226957106 TCCCTGGTTCACACTCTCCCTGG + Intronic
922615209 1:226957100-226957122 TCCCTGGCTCTCACTCTCCCTGG + Intronic
922615215 1:226957132-226957154 TCCCTGGCTCCTGCTCTCCCTGG + Intronic
922615219 1:226957148-226957170 TCCCTGGCTTCCGCTCTCCCTGG + Intronic
922615225 1:226957180-226957202 TCCCTGACTCCCGCTCTCCCTGG + Intronic
922615230 1:226957196-226957218 TCCCTGGCTCCTACTCTCCCTGG + Intronic
924240539 1:242035763-242035785 TCCTTTGCTGACCCACTCCCTGG + Intergenic
1064328459 10:14372539-14372561 TCCTCTGCTGCCACTCTCCCTGG + Intronic
1064346846 10:14540449-14540471 TCCTTTGGTGACACTCTCCTGGG + Intronic
1064374152 10:14780378-14780400 TCCTTGGGGGACACTCACCCAGG + Intergenic
1065804674 10:29383464-29383486 TCCTTATCTCCCACACTCCCCGG - Intergenic
1067883674 10:50068397-50068419 TCAGTGTCTGCCCCTCTCCCTGG - Intronic
1068171825 10:53404191-53404213 ACCGTGGCTGCCACACTCCAGGG - Intergenic
1068567174 10:58589019-58589041 TCCTTGGCTGCCGGTGTCCTTGG - Intronic
1068573797 10:58660704-58660726 TCCTTGGCTACCAGTCTCATAGG + Intronic
1069574238 10:69515616-69515638 GCCTTGGCTGCCACCTTCCTGGG + Intergenic
1069865738 10:71501783-71501805 TCCTGCCCTCCCACTCTCCCTGG - Intronic
1070715588 10:78718772-78718794 TCCCTGGCTCCCACTCCTCCTGG - Intergenic
1070913277 10:80136315-80136337 TCCTTTCCTCCCGCTCTCCCAGG - Intronic
1072542616 10:96409874-96409896 TCCTTGGCTGCCCCTCCAGCGGG - Intronic
1073362654 10:102912538-102912560 TCCTTGGGTGCCGCTGTTCCTGG - Intergenic
1074713024 10:116193110-116193132 TCCTTGGCTTCCATTTTTCCAGG - Intronic
1076153774 10:128187126-128187148 TCCTTGGGTGCCACTGTGGCTGG + Intergenic
1077550145 11:3196603-3196625 GCCGTGGCTCCCACTGTCCCTGG + Intergenic
1078720374 11:13878581-13878603 TACTTGGCTGCCTCTCACCTGGG - Intergenic
1079234177 11:18675919-18675941 TCCTTGCCCACCATTCTCCCTGG + Intergenic
1079719203 11:23789330-23789352 TCATTAGCTTCCACTCTTCCTGG - Intergenic
1081626622 11:44659806-44659828 CCCTTGGCTGCCAGCATCCCTGG - Intergenic
1081632666 11:44700479-44700501 TCCTTTGATGCCAGTCTTCCTGG + Intergenic
1083321248 11:61848390-61848412 TCGATGGCTGCCATTCGCCCAGG - Intronic
1083464056 11:62833582-62833604 CCCTTGGCTCCCACATTCCCGGG + Intronic
1083849986 11:65359677-65359699 TCCTTGACTGCAACTCTCTCCGG - Intergenic
1084062929 11:66687593-66687615 TCCGGGTCTGCCTCTCTCCCCGG + Exonic
1084474295 11:69380167-69380189 TCCTTGGCTGGCACTATCCCTGG + Intergenic
1084491318 11:69480168-69480190 GCCTTGGCCTCCTCTCTCCCAGG + Intergenic
1085305038 11:75481191-75481213 TCCTAAGATGCCACTCTCCAAGG + Intronic
1085762514 11:79254492-79254514 TCCTTAGCTGCCTCTCTCCAAGG - Intronic
1085774260 11:79351375-79351397 TCTATGGCAGGCACTCTCCCAGG - Intronic
1088417359 11:109604616-109604638 TCCTTGGCTTCAACTCTCAGCGG + Intergenic
1088823435 11:113475173-113475195 TCCGGGGCCGCCACTCTCCTCGG + Exonic
1088896456 11:114082483-114082505 TCCAAGGCTCCAACTCTCCCGGG - Intronic
1090160186 11:124484412-124484434 TCCTTTTCTACCCCTCTCCCTGG - Intergenic
1092944886 12:13443564-13443586 TCATTGGCTCCCACTTGCCCTGG - Intergenic
1095662239 12:44750638-44750660 TTCTCAGCTGCCACTCTCCCAGG + Intronic
1095662903 12:44758757-44758779 TCCTTAACTGCCACTCACTCAGG + Intronic
1096606354 12:52769146-52769168 TCCTTGGCTTCCAGTTTCCCAGG - Intronic
1096652705 12:53069736-53069758 TCCTCCTCTGCCTCTCTCCCCGG + Intronic
1096804105 12:54129818-54129840 ACCCTGGCGGCCCCTCTCCCGGG + Intergenic
1097698897 12:62800852-62800874 TCCCTTGCTGCCCCTCTGCCTGG - Intronic
1098891076 12:76011365-76011387 TCCTTGGCTGCCTTTCCCTCAGG - Intergenic
1101601838 12:106216217-106216239 TCCTTTCCTGCATCTCTCCCTGG - Intergenic
1101865606 12:108517531-108517553 TCCTTGGATGCCCTTCACCCTGG - Intronic
1102774836 12:115509352-115509374 TCCTTTGCTGTCACACACCCAGG + Intergenic
1103207196 12:119139198-119139220 TCCTAGTCAGCCACTCTCTCTGG - Intronic
1104374471 12:128251690-128251712 CCCTTCCCTGCCACTCTCCTGGG + Intergenic
1108704740 13:52974852-52974874 TCCTGGGCTGCCACAGACCCAGG + Intergenic
1112265731 13:97921660-97921682 TCCCTGTCTTCCACTCTGCCAGG + Intergenic
1112772190 13:102803585-102803607 GACTTGGCTTCCACTTTCCCAGG - Intronic
1114217690 14:20669120-20669142 TCCCTGGCTGCACCTCTGCCTGG - Intergenic
1115198215 14:30825031-30825053 TCCTTCACTGCCACTCTCCAAGG - Intergenic
1116785575 14:49284577-49284599 TCCTTGACTGCCACTTTAGCAGG + Intergenic
1118007531 14:61577109-61577131 CTCTGGGATGCCACTCTCCCAGG - Intronic
1118600716 14:67469996-67470018 TACTTTGGTGCCACGCTCCCAGG - Intronic
1119381903 14:74234564-74234586 TCCTTCCCTCCCACTCCCCCAGG + Intergenic
1121113869 14:91330406-91330428 GCCTTTGCAGCCACTCTCCATGG - Intronic
1122918577 14:104870175-104870197 TCCCTGGCTGCCCCTCACCACGG - Intronic
1123041922 14:105493791-105493813 TGCTTGACTGCCACTCAGCCTGG + Intronic
1123702841 15:22928473-22928495 CCCTTGGCCGCCATTTTCCCGGG - Intronic
1124048953 15:26177278-26177300 GACTTTGCTGCCTCTCTCCCAGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1124880703 15:33640016-33640038 TCCTGTGCTGCCTCTCTGCCAGG + Intronic
1124983331 15:34583481-34583503 ACCTTGGCTGCCTGACTCCCTGG - Intronic
1125420098 15:39496656-39496678 TCCCTGGCTGCACCTCTGCCAGG - Intergenic
1125599914 15:40909853-40909875 GGCCTGGCTGGCACTCTCCCGGG + Intergenic
1127614281 15:60668102-60668124 TCCTTGGCTGCTGCTCTCAGGGG + Intronic
1127902330 15:63350076-63350098 TCCTTGGCAGGCCGTCTCCCAGG - Intronic
1128248249 15:66147605-66147627 GCCTTGGCACCCACTCTGCCCGG - Intronic
1128313479 15:66645996-66646018 TCCTTGGGTGCCCCTAGCCCAGG + Intronic
1129710051 15:77816313-77816335 ACCTTGGCTGTTACTCTCCATGG - Intronic
1130935258 15:88464748-88464770 CCCCAGGCTGCCACTCTGCCTGG + Exonic
1130963757 15:88682155-88682177 GCCTGGGCTCCCTCTCTCCCAGG - Intergenic
1132474885 16:129793-129815 GACTTGGCTTCCACTGTCCCGGG - Intronic
1132497515 16:270861-270883 GCCCTGGCTGCCACTCTCGATGG - Intronic
1134218953 16:12338399-12338421 TCCTTGGCTGCCTTCCCCCCGGG + Intronic
1135272822 16:21083943-21083965 TCCTTGGGAGCCACTGTCCTAGG + Intronic
1135375839 16:21946526-21946548 TCCATGGCGGCCATTCCCCCTGG + Intergenic
1137032098 16:35532990-35533012 TCCTGGTCTGCCCCTCTCCTGGG + Intergenic
1139373474 16:66482182-66482204 TGCTTGGCTGCCACCCTCTGTGG - Intronic
1139701412 16:68710231-68710253 TCCATGGCTCCAACACTCCCTGG + Intronic
1141592477 16:85077828-85077850 TCCCTGGGGGCCACACTCCCTGG + Intronic
1142108456 16:88318638-88318660 ACCTGGGCTGCCTCCCTCCCTGG + Intergenic
1143125751 17:4640070-4640092 TCCCTTTCTGTCACTCTCCCTGG - Intronic
1143402725 17:6656752-6656774 TCCCTTTCTGTCACTCTCCCTGG + Intergenic
1143864801 17:9916268-9916290 GCCCTGGCCCCCACTCTCCCGGG - Exonic
1144422422 17:15110447-15110469 TCCTCGGCTCCAACTCTCACTGG - Intergenic
1144718407 17:17450561-17450583 TCCTGGGCTGCCACTGCTCCTGG + Intergenic
1144832323 17:18138664-18138686 CCCATGGCTGCCCATCTCCCTGG - Intronic
1145812695 17:27774066-27774088 TCCTTCAGTGCCACTCTCCGTGG + Intronic
1147321471 17:39648734-39648756 TGCTTGGCTCCCACACTCCCTGG + Intronic
1147445987 17:40475575-40475597 CCCTTTCCTGCCACTCTGCCAGG - Intergenic
1147753048 17:42748988-42749010 GCCTTGGCAGCTACTCTCCTGGG + Intergenic
1147977135 17:44254449-44254471 TCCCTGCCTCCCACCCTCCCAGG + Intronic
1148815036 17:50321496-50321518 TCAGTGGCTGCCACTCTGCTGGG + Intergenic
1149684849 17:58529388-58529410 CCCTTGGCTCCCACCCTCCAAGG + Intronic
1150333143 17:64310674-64310696 TCCTTTGCTGACTCTCTGCCTGG + Intergenic
1150581316 17:66476450-66476472 GCCTTGGCTGGCATTCTCTCGGG - Intronic
1152031805 17:77847450-77847472 TCCTGGGCTCCCACCCTCCCCGG + Intergenic
1152273797 17:79341992-79342014 TCCATGGCTGGCCCCCTCCCCGG + Intronic
1152484178 17:80578911-80578933 TCCTCGCCTGCCAGCCTCCCTGG + Intronic
1152978702 18:251417-251439 TCCTTCACTGGCACTCTTCCAGG - Intronic
1152987730 18:335058-335080 TCCTTTGCCGCCACGCTCTCCGG + Exonic
1153553214 18:6284419-6284441 TCTTTGGCTTCGACTTTCCCAGG - Intronic
1158315442 18:56207313-56207335 TCATCGTCTGCCTCTCTCCCAGG - Intergenic
1158514387 18:58119230-58119252 TCCCAGGCTTCCACTCTCCATGG - Intronic
1159637289 18:70820735-70820757 TCCTTGACTGCAACTCCCTCTGG + Intergenic
1159682701 18:71374213-71374235 TCCTTCAATGCCACTTTCCCTGG - Intergenic
1160527912 18:79548094-79548116 CCCTTGCCTGCCACCCACCCGGG + Intergenic
1161309485 19:3585974-3585996 TCCCGGGGTGCCACACTCCCAGG + Intronic
1161730640 19:5958664-5958686 TCCTGGGCTGCCACCCACTCCGG - Intronic
1161773113 19:6241994-6242016 TCCCTGGCTCCCAGGCTCCCAGG - Intronic
1162932090 19:13962407-13962429 CCCTTGGCCGCCCCCCTCCCAGG - Exonic
1163227454 19:15974419-15974441 TCCTTGACTGCAACTCTCCTAGG - Intergenic
1164846583 19:31437871-31437893 TCCATGGCTGCCACTCACCATGG + Intergenic
1164852685 19:31497891-31497913 TGCTTGGCTGCCACTCAGCATGG - Intergenic
1165141224 19:33701085-33701107 ACCTTCACTGCCACACTCCCTGG + Intronic
1165246949 19:34503297-34503319 TCCGTGGGAGCCACTCTCCCGGG + Exonic
1165373514 19:35425336-35425358 CCCTTGCCTGCCACTCTACATGG + Intergenic
1165383889 19:35499201-35499223 TCTGTGGCTTCCACTCTGCCGGG - Intronic
1166754783 19:45183986-45184008 CACTAAGCTGCCACTCTCCCAGG - Intronic
1167252364 19:48406688-48406710 TCCCTGTCTGCCACTCTTACAGG - Intronic
1168242488 19:55094487-55094509 TCCGTGGCTGACACCCTCCGCGG + Intronic
1168337479 19:55604808-55604830 TGCTAAGCTTCCACTCTCCCAGG - Intergenic
927427332 2:22995710-22995732 TCTTTGGGTCCCACTGTCCCTGG - Intergenic
928373907 2:30759944-30759966 CCCTTGCCTGCCCCGCTCCCTGG + Intronic
930129333 2:47833046-47833068 ACTTTGTCTGCCACTTTCCCAGG + Exonic
933331391 2:80896860-80896882 TGCTTGGCTGACACTTTCTCAGG + Intergenic
933993553 2:87650989-87651011 CCCTTCCTTGCCACTCTCCCTGG + Intergenic
934978330 2:98821902-98821924 TCCTGGGTTCCCGCTCTCCCGGG + Exonic
936295554 2:111264826-111264848 GCCCTGACTGCCACTCACCCGGG - Intergenic
936300310 2:111299894-111299916 CCCTTCCTTGCCACTCTCCCTGG - Intergenic
937502067 2:122489934-122489956 TCCTTGGCTTCCTCTCCCCATGG - Intergenic
937940289 2:127280098-127280120 CCCTTTGCTGCCAGGCTCCCAGG + Intronic
938194606 2:129315574-129315596 TCCTTGGCTGCAACTCCCTTTGG + Intergenic
940898946 2:159108726-159108748 ACCCTGGCTGCCCCTCTGCCTGG - Intronic
944847189 2:203680835-203680857 CTCTTGGATGCCCCTCTCCCAGG - Intergenic
947535708 2:230939505-230939527 TCCTGGGCTGCCCAGCTCCCTGG + Intronic
947711884 2:232321197-232321219 TCCTTGGTTGTCACACTCCCTGG - Intronic
947718650 2:232354290-232354312 TCCTTGGCTGTCACACTCCCTGG - Intergenic
947743171 2:232494216-232494238 TCCTTGGCTGCCAGGGTCCTGGG + Intergenic
947954728 2:234178849-234178871 TCCGTGGCTGCCTCTGTGCCAGG + Intergenic
948196616 2:236101541-236101563 GCCTTGGCTGTTCCTCTCCCTGG + Intronic
948712438 2:239833455-239833477 TCCTCTGCTGCCATTGTCCCTGG - Intergenic
948962038 2:241346884-241346906 TGCTTGGATGCCACTCATCCTGG - Intronic
1170558702 20:17537225-17537247 TCCTGGGCTGTCACTTTCCATGG - Intronic
1170770450 20:19328126-19328148 GCCTTTGCTGCCCCTCTGCCTGG - Intronic
1172079664 20:32329905-32329927 TCTTTGGGTGCCATTCTTCCTGG + Intronic
1172303992 20:33868774-33868796 CCCCTGCCTGCCACTCTCTCTGG + Intergenic
1172335203 20:34110385-34110407 TCTTTGGCTTCCATTCTGCCAGG - Intronic
1173021939 20:39274364-39274386 TCCTTTCCTCCCTCTCTCCCTGG + Intergenic
1174591731 20:51650666-51650688 TCCCTGACTTCCATTCTCCCAGG - Intronic
1174739342 20:52997134-52997156 GCCTTTGCTGCATCTCTCCCAGG - Intronic
1174904529 20:54536660-54536682 TGCTAGGCTGCCACACTTCCTGG - Intronic
1175160124 20:57002181-57002203 TCCTTGTGAGCCACCCTCCCTGG - Intergenic
1175983637 20:62753627-62753649 TCTTTGGCTGCCACACTTGCGGG - Intronic
1176003744 20:62847968-62847990 TCCTTGGCTGCCCGGCTGCCCGG - Intronic
1176050352 20:63116079-63116101 TCCCTGGCACCCACACTCCCTGG + Intergenic
1176050357 20:63116095-63116117 TCCCTGGCACCCACACTCCCTGG + Intergenic
1176050362 20:63116111-63116133 TCCCTGGCACCCACACTCCCTGG + Intergenic
1180955739 22:19740453-19740475 TCCTTGGCTGACAGTATCCATGG + Intergenic
1181628282 22:24135889-24135911 TCCATGGCTCCTCCTCTCCCAGG + Intronic
1182021506 22:27085576-27085598 TCCATGGCTCCCACTGTCCCTGG + Intergenic
1182446079 22:30390398-30390420 CCCTTGGCTGCCTCACTTCCTGG - Intronic
1184491320 22:44810804-44810826 TCCTTTGCTGCCTCCCTCCACGG - Intronic
1184503058 22:44885551-44885573 TCCTTACCTGCCCCTCTCCAGGG - Intronic
1184695256 22:46135361-46135383 TCCCAGCCTGCCACCCTCCCTGG - Intergenic
1185168696 22:49278401-49278423 TCCTTGGCTGCCACCTGCGCTGG + Intergenic
1185226545 22:49656805-49656827 TCCGAGGCAGCCACTTTCCCTGG - Exonic
950026001 3:9820333-9820355 CCCTTGGCTCCCACTGTCCCAGG - Intronic
953045146 3:39288401-39288423 GCTTTGGCTTCCACTCTTCCAGG + Intergenic
956740085 3:72268986-72269008 TCCTTTACTCCCTCTCTCCCTGG - Intergenic
956740390 3:72271171-72271193 TCCCTGCCTGCCTCTCTCACAGG - Intergenic
957328569 3:78729070-78729092 TCCTAGGCGGGGACTCTCCCAGG - Intronic
960961958 3:123077483-123077505 CCCTTGGCTGCCACTAGCCGAGG + Intronic
961349619 3:126291606-126291628 GCCGGGGCTGCCACTCTCCCAGG + Intergenic
961938251 3:130609229-130609251 TCCTTGGCTCAAGCTCTCCCTGG - Intronic
962236072 3:133708527-133708549 CCCCTGCCTGTCACTCTCCCTGG - Intergenic
962816398 3:139005261-139005283 TCCTTGCCTGCCACTTACCAAGG + Intergenic
962987451 3:140548477-140548499 TCCCTGACTGCCAGTCTCCAAGG - Intronic
963067566 3:141275429-141275451 TCCTTAGCTGCTTCTGTCCCTGG + Intronic
963645247 3:147905419-147905441 TCCTTTTCTGCCTCTCTCCTTGG + Intergenic
965471082 3:169092972-169092994 ACCATGGCAGCCAATCTCCCAGG - Exonic
965600727 3:170452037-170452059 TTCATGGCTGCCCCTCCCCCAGG - Intronic
967992118 3:195139209-195139231 CCCTTGGCTGCAAAGCTCCCGGG + Intronic
968515846 4:1015334-1015356 TGCCTGCCTGCCACTCTCCCTGG + Intronic
968613189 4:1566308-1566330 TCCCAGGCGTCCACTCTCCCGGG + Intergenic
968830424 4:2930787-2930809 ACCTAGGCTCCCACTCTGCCTGG + Exonic
969298772 4:6285161-6285183 TCCCTGGATGTAACTCTCCCTGG - Intronic
969395363 4:6917178-6917200 TTCTTGGCTGGGACTGTCCCTGG + Intronic
970186010 4:13454802-13454824 TCCTTGGCAGGTACTCCCCCAGG - Intronic
973070777 4:45856006-45856028 TCCTTGGCTGAGACACTCACAGG - Intergenic
975372336 4:73603436-73603458 TCCTTGGCTAGCTCTCTTCCAGG - Intronic
975670322 4:76773676-76773698 TCCCTGGCTGCCTCTGTGCCAGG - Intronic
975912968 4:79290599-79290621 GCCCTGGCAGGCACTCTCCCAGG + Intronic
976980294 4:91218190-91218212 CCCTTGGCAGCCACTGGCCCGGG + Intronic
978420078 4:108522646-108522668 TCCTTGGCTGGCTCTCTTCCTGG + Intergenic
978912576 4:114082091-114082113 GCCTAGGCTGCCACACTCTCTGG + Intergenic
979346015 4:119587922-119587944 TCCTTGGCCTCCACACTCCATGG + Intronic
980165745 4:129225021-129225043 TCCTTTGCTGCCAAGCTTCCTGG + Intergenic
981551330 4:145944359-145944381 TCCTTGACGGCCCCTCTTCCTGG + Intergenic
981976638 4:150737723-150737745 TCCTTGGTTGCAAAACTCCCTGG - Intronic
983338026 4:166421010-166421032 TCCATGGCTACCACTGTCCCAGG + Intergenic
985646266 5:1086078-1086100 GCCGTGGCTGCCGCACTCCCAGG - Intronic
986122523 5:4855140-4855162 TGCCTGGCTGCCACTCCCTCAGG + Intergenic
986200753 5:5576120-5576142 TCCTTGTCTCCCACCTTCCCAGG - Intergenic
987247268 5:16061250-16061272 TCCATGGCTGCCACTGCTCCTGG + Intergenic
990301986 5:54458558-54458580 TCCAGGGCTGCCACTCTCACAGG + Intergenic
990995924 5:61732168-61732190 ACCTTGGCATCCATTCTCCCTGG + Intronic
991920117 5:71648206-71648228 TCATTGACTGCCACTATCCCTGG - Intronic
997236527 5:132275204-132275226 TCCTTTGCTTCAACTCTTCCAGG + Intronic
997926054 5:138032544-138032566 TCCAAGGCTGCCACACCCCCCGG + Intronic
998169219 5:139862430-139862452 TCATTGGCTGCCACTCAGCCAGG + Intronic
1001897931 5:175397340-175397362 TCCATGGCTTGCACTCTCACGGG - Intergenic
1002701560 5:181128504-181128526 GCCTTTCCTTCCACTCTCCCGGG + Intergenic
1003663436 6:8087010-8087032 TCCTCGGCTGCATCTCTCTCAGG - Intronic
1006212941 6:32412745-32412767 TCCTTTGCTGCCACTCTGAGAGG - Intergenic
1006374017 6:33662137-33662159 GCCATGGCTGCCCCTCTCTCAGG - Intronic
1017869522 6:158475136-158475158 GCCTTGATTGCCACACTCCCTGG + Intronic
1017956642 6:159183706-159183728 TTCTGGGATGCCACACTCCCTGG - Intronic
1018859853 6:167703789-167703811 CCCATGTCTGCCAATCTCCCAGG + Intergenic
1018994313 6:168699688-168699710 TCCATGGCTGCCGCTTTCCATGG + Intergenic
1019336444 7:485117-485139 TCCAAGGCTGCCACAATCCCAGG + Intergenic
1019446875 7:1075971-1075993 CCCGGGGCTGCCACTCTCCAGGG + Intronic
1019733431 7:2639343-2639365 GCCTTGGCTGACACTGTCCCCGG + Intronic
1020254808 7:6497225-6497247 TCCTTCCCTGCGTCTCTCCCAGG + Intergenic
1021767877 7:23967668-23967690 TCCTTTGCTGCCACTCTTCAAGG - Intergenic
1023185698 7:37530721-37530743 ACCTTGGCTTTCACTCACCCTGG - Intergenic
1024028365 7:45433359-45433381 TCCCTGGCTGGAACTCTTCCTGG + Intergenic
1024241584 7:47440170-47440192 TCCTTGGCCGCACCTCCCCCAGG - Intronic
1024417024 7:49119600-49119622 ACCTTGCCGGCCACTCTCCCTGG - Intergenic
1026873871 7:73869036-73869058 TCCCTGGCTCCCCATCTCCCAGG + Intergenic
1027211198 7:76150251-76150273 TGCTTGCCTGTCACACTCCCTGG - Intergenic
1029652484 7:101903110-101903132 CCTGTGGCTGCCTCTCTCCCTGG + Intronic
1031817664 7:126459361-126459383 TCCATGGCTGGCTCTCTCTCAGG - Intronic
1032358695 7:131234421-131234443 TCCTAGGCTTCCAGTCTCCAGGG + Intronic
1033292007 7:140093502-140093524 TCTTTGGCTGCCATTTTCCAAGG + Intronic
1034296585 7:149978219-149978241 TTCCTGGCTGCCACTGGCCCTGG + Intergenic
1034581736 7:152049876-152049898 CCCTTAGCTGCCACTGTCCTAGG + Intronic
1034809446 7:154118612-154118634 TTCCTGGCTGCCACTGGCCCTGG - Intronic
1034999677 7:155602968-155602990 GCCTTGGGGGCAACTCTCCCAGG - Intergenic
1035003655 7:155638391-155638413 TCGTTTGCTGCCATTCTCTCAGG + Intronic
1035014635 7:155754387-155754409 TCCTTTGGAGCCACTCTTCCAGG + Intronic
1035354814 7:158270659-158270681 TACCTGGCTGTCCCTCTCCCTGG + Intronic
1035354829 7:158270703-158270725 TACTGGGCTGCCCCTCTCCCTGG + Intronic
1035472689 7:159120276-159120298 TCCTTGCCTGCTCTTCTCCCTGG - Intronic
1035550849 8:523674-523696 CCCTTGGCTACCACTGCCCCAGG - Intronic
1035717259 8:1763865-1763887 ACCTGGGCTGCCACTCAGCCGGG - Exonic
1035743970 8:1948187-1948209 CCCCTGGCGCCCACTCTCCCGGG + Intronic
1036435794 8:8732040-8732062 TCCATGTCTGTCAGTCTCCCAGG - Intergenic
1036754349 8:11462468-11462490 TGCTTGGCTGTCACTCTCCTTGG + Intronic
1037689619 8:21171074-21171096 TCCTTGTATTCCCCTCTCCCAGG - Intergenic
1038340833 8:26683810-26683832 TCCCTGGCTGCCACCCTGTCTGG - Intergenic
1038481831 8:27907218-27907240 TCCTGGGGTACCTCTCTCCCCGG + Exonic
1040489908 8:47910240-47910262 TCCTTGGCTATCAATCCCCCTGG + Intronic
1043924937 8:86026186-86026208 TGCCTGGCTCCCACTCACCCAGG + Intronic
1047012258 8:120685114-120685136 TGCATGCCTGCAACTCTCCCAGG + Intronic
1047330958 8:123886327-123886349 GCCTTTGGTGCCATTCTCCCCGG + Intronic
1048843563 8:138585435-138585457 TCCTTTGCTGTCTCCCTCCCAGG - Intergenic
1049071639 8:140359800-140359822 TCCTCGGCCGCCACACTCCATGG - Intronic
1052916298 9:33926529-33926551 GTCTTGGCTGCCACACTCTCTGG - Intronic
1053363005 9:37502883-37502905 ACCTTGCCTGCCTCTCTGCCAGG + Intronic
1056073243 9:83010796-83010818 TCCTTGGAAGACACTCTCTCGGG + Intronic
1056563177 9:87750775-87750797 TCTTCTGCTGCCCCTCTCCCAGG - Intergenic
1056654358 9:88496945-88496967 TCCTTTGCTGCCAAAGTCCCTGG + Intergenic
1057453930 9:95190605-95190627 CCCTGGGCTGCCTCTCCCCCAGG + Intronic
1059631521 9:116128984-116129006 TCATCTCCTGCCACTCTCCCAGG + Intergenic
1060600767 9:124875952-124875974 TCCTTGGCCTCCCCTCTCCTGGG + Intronic
1060623201 9:125086319-125086341 TCTATGGCTGCCACTGTTCCAGG + Intronic
1061108839 9:128552694-128552716 TCCCCGGCTGCCCCTCTCACCGG - Exonic
1061423507 9:130484982-130485004 TTCCTGGCTGCCACCCTCCCAGG - Intronic
1061512835 9:131071390-131071412 TTCTACCCTGCCACTCTCCCTGG - Intronic
1062275554 9:135728685-135728707 GCTTGGGCTGCCCCTCTCCCAGG - Intronic
1062466372 9:136683391-136683413 TCCTGGGCTGGGACACTCCCAGG + Intronic
1187405121 X:18996805-18996827 CCCATGGCTGCCACTCCCCAAGG + Intronic
1188764285 X:34073400-34073422 TTTTTGGCTACCACTCCCCCAGG + Intergenic
1192151908 X:68717892-68717914 TACCTGGCTGCCAGTCTGCCAGG - Exonic
1195369409 X:104158287-104158309 TCCTTGGCTGCCAGCCTTCAAGG - Intergenic
1195711341 X:107775846-107775868 TCCTTTGCTCCCTCCCTCCCCGG + Intronic
1196558945 X:117123208-117123230 ACCATGGCTGCCTTTCTCCCAGG - Intergenic
1196644415 X:118101421-118101443 TCCTTCTCTGTCTCTCTCCCTGG - Intronic
1197283441 X:124565529-124565551 TCCATGGCTACCACACTCCATGG + Exonic
1197998850 X:132411135-132411157 TACTTGGCTGGCCCTCTCCATGG - Intronic
1200216884 X:154371890-154371912 TCCGGGGCTGCCGCTCTCCAGGG - Intronic