ID: 922621558

View in Genome Browser
Species Human (GRCh38)
Location 1:226992411-226992433
Sequence GAGGGAAGAAAGGATCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922621558_922621563 18 Left 922621558 1:226992411-226992433 CCAGCAGGATCCTTTCTTCCCTC 0: 1
1: 0
2: 3
3: 37
4: 362
Right 922621563 1:226992452-226992474 CTCCACACAGCAGCATCACCTGG 0: 1
1: 0
2: 3
3: 35
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922621558 Original CRISPR GAGGGAAGAAAGGATCCTGC TGG (reversed) Exonic
900612334 1:3549429-3549451 GAGGAAAGAGAGGCTTCTGCTGG - Intronic
900754345 1:4423317-4423339 GAGGGAAGGAAGGAACCTGGAGG - Intergenic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
901472497 1:9467397-9467419 GTGGAAGGAAAGGACCCTGCTGG + Intergenic
901678347 1:10899625-10899647 GAAGGAAGGAAGGGTCCTGTGGG + Intergenic
901793347 1:11666121-11666143 TAGGGAAAGAAGGAGCCTGCTGG - Intronic
902821477 1:18945945-18945967 CTGGGAAGAGAGGAACCTGCAGG - Intronic
904822297 1:33253642-33253664 GATGGGAGACAGGATCCTGAAGG - Intergenic
905932751 1:41801180-41801202 GAAGGAAGAGAGGTCCCTGCAGG + Intronic
906105230 1:43287545-43287567 GAGGAAAGAAAGGATTATCCTGG + Intergenic
906285049 1:44581689-44581711 GAGGGAAGAAAGAGTCCTAGGGG + Intronic
906304496 1:44708165-44708187 GAGGGAAGGAAAGTTCCTACGGG + Intronic
906460797 1:46034129-46034151 AAGGGAAGAAAGGCTGCGGCTGG - Exonic
906635852 1:47410003-47410025 CAGGGAAGAAAGGGCCCTGCTGG + Intergenic
907476777 1:54711103-54711125 GAGGGAAGAAACTCCCCTGCAGG + Intronic
908112309 1:60909451-60909473 GAGTGAAGAAAGAACACTGCAGG - Intronic
909084235 1:71152862-71152884 GAATAAAGAAAGGATCCTGAAGG - Intergenic
909265891 1:73558025-73558047 GAGGGAGGTAAGGAACCTGTTGG + Intergenic
910369904 1:86504259-86504281 GAGGGAAGAAGGTAACCGGCTGG - Intergenic
910728111 1:90360033-90360055 GAGCGAGGAAAGGAGCCGGCTGG - Intergenic
910993544 1:93079816-93079838 GAGGGCAGGAAGGAACCTGGGGG + Intronic
911018300 1:93358663-93358685 GAGGGAATAAAGGAAAATGCTGG - Intronic
911524203 1:98964494-98964516 GAGGGAAAAAAGGACTCTGCTGG + Intronic
912939278 1:114030743-114030765 AAGGGAAGAAATGATCGTGGTGG - Intergenic
915357354 1:155263277-155263299 GGGCGAAGAAAGGATGCTGAAGG + Exonic
915541985 1:156573232-156573254 GAGGCCAGAAGGGATCCTGGAGG + Intergenic
916632887 1:166635936-166635958 GAGAGAAAAAAAGATGCTGCTGG - Intergenic
917928461 1:179807727-179807749 GAGGACAGACAGGCTCCTGCTGG - Intronic
917959656 1:180132198-180132220 GGGGGAAGAAAGCATGCTGGAGG + Intergenic
918128866 1:181607773-181607795 CAGAGAAGAAAGTTTCCTGCAGG + Intronic
919515555 1:198517558-198517580 GAAGGAAGAAAGGAAACTTCAGG + Intergenic
919702402 1:200644396-200644418 GGGGGAAGAATGGATCCTGTGGG + Exonic
919845688 1:201640681-201640703 GAAGGGAGAAAAGATGCTGCTGG + Intronic
920900992 1:210110518-210110540 GAGGGAATGAAGTATCCTCCAGG + Intronic
921048076 1:211491416-211491438 AAAGGCAGAAAGGAACCTGCTGG + Intronic
921978288 1:221227027-221227049 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
922152888 1:223020533-223020555 GAGGGAAAAGAGGATGCTGGTGG - Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
923119484 1:230977921-230977943 GAGGGAAAAAAGGCCCCTGCAGG - Intronic
924862082 1:247935877-247935899 GAAGGAAGGCAGGAGCCTGCGGG - Intergenic
1065746115 10:28844151-28844173 GAGGAAAGGAAGGAGCCTGGAGG + Intergenic
1065762897 10:28999551-28999573 AAGGGCAGAAAGCATCCAGCAGG + Intergenic
1067083765 10:43227629-43227651 CAGGGCAGCAAGGAGCCTGCAGG + Intronic
1067790878 10:49286837-49286859 AAAGGGAGAAAGGAGCCTGCAGG + Intergenic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1069169025 10:65201687-65201709 GAGAGAAGAAAGGATACTCCTGG + Intergenic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070671679 10:78381679-78381701 GAGGGAAGAGAGCATACTGTGGG - Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072550559 10:96474184-96474206 GCGGCAAGAAAGGATTCTTCAGG - Intronic
1073291044 10:102413471-102413493 AAGGGAAGAAAGGGCCCTCCAGG + Intronic
1074003956 10:109400198-109400220 AAAGGAAGAGAGGATCCTGGAGG - Intergenic
1074212384 10:111348225-111348247 GAAGGAAGTAAGGAACATGCTGG + Intergenic
1074596854 10:114876035-114876057 GAAGGAAGAAAGGAGCCTGAGGG + Intronic
1074907693 10:117879466-117879488 GAGGGGAGAAAGGGACCTCCAGG - Intergenic
1075125307 10:119694583-119694605 GAGGCAGGAAAGGAGCCTTCTGG - Intergenic
1076276158 10:129200452-129200474 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1076403674 10:130198692-130198714 GAGGGAAAAAAAAATTCTGCTGG - Intergenic
1076545828 10:131245247-131245269 GTGAGATGAAAGGAGCCTGCAGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1076994169 11:290209-290231 GAGGGAAGGGGGGACCCTGCGGG - Intronic
1077571286 11:3340441-3340463 GGGGGATGAGAGGGTCCTGCAGG - Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1080012141 11:27471010-27471032 GAGAGAGGAAGGGATCCTGAGGG - Intronic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1083368983 11:62163499-62163521 GAGGGAAGAAAGGCTGCTATGGG - Intergenic
1083990740 11:66244355-66244377 CAGGGAGGGAAGGAGCCTGCTGG - Exonic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085389057 11:76172925-76172947 CAGAGAAGGAAGGAGCCTGCTGG - Intergenic
1085392636 11:76190260-76190282 GAGTGAAGAAAGGGTCTTCCTGG - Intronic
1086141816 11:83507926-83507948 AAGGGCAGAAAGCATCCAGCAGG + Intronic
1086793068 11:91064998-91065020 CAGAGAGGAAAGGATTCTGCTGG - Intergenic
1086934276 11:92727808-92727830 GAGAGAAGACTGGAGCCTGCAGG - Intronic
1087803273 11:102527504-102527526 GAGGTAAGAAAGATTCCTGTAGG - Exonic
1090185847 11:124738727-124738749 GAGGAAAGGATGGCTCCTGCTGG - Intergenic
1091857039 12:3748425-3748447 AAGGGAAGAAAGTGTCCCGCTGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092786691 12:12032986-12033008 GAAGGAAGAAAGGGCGCTGCTGG + Intergenic
1092892110 12:12978709-12978731 GAAGGAAGAGAGGATTCTCCAGG + Intronic
1094208303 12:27863704-27863726 GAGGGAATCAAGGTTCCTGTGGG + Intergenic
1095599278 12:43996700-43996722 AACAGAAGAAAGGATCATGCTGG - Intronic
1096797884 12:54089943-54089965 GAGGGGAGAAACAGTCCTGCTGG + Intergenic
1097012554 12:55963855-55963877 GAGGGGAGAGAGGTTTCTGCAGG - Intronic
1097049447 12:56212920-56212942 GAGGGCAATAAGGATCCTGGAGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101390050 12:104292175-104292197 CAAGGGAGAAAGAATCCTGCTGG + Intronic
1101493203 12:105229324-105229346 GAGGAAAGAAAGGTACCTGTTGG + Intronic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101969221 12:109301113-109301135 GAGGGAGGAAAGAAACCGGCAGG + Intronic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1102206472 12:111094358-111094380 GAGGGAGGCAAGGGTCATGCTGG + Intronic
1102802638 12:115750040-115750062 GGGGGAAAAAAGGATCTTTCAGG - Intergenic
1103256200 12:119543546-119543568 GAGGGAAGAAAGAATGTTCCAGG + Intergenic
1104301008 12:127565102-127565124 GAGTGAAGGGAGGATCCTGCTGG + Intergenic
1104378657 12:128288036-128288058 AAAGTAAGAGAGGATCCTGCAGG - Intronic
1104454410 12:128898918-128898940 GAGAGAAGCAAGGAACTTGCTGG - Intronic
1105276530 13:18933552-18933574 GAGGACAGGAAGGATCCAGCAGG - Intergenic
1106708944 13:32311253-32311275 GAGGGAAGAGAGGATCTACCTGG + Exonic
1108091374 13:46853400-46853422 AAGGGAAGAGAGCAACCTGCTGG - Intronic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1112212876 13:97398481-97398503 GAGTCAAGAAAGGATTCTACTGG - Intergenic
1112347321 13:98601116-98601138 GAGTCCAGAAAGAATCCTGCTGG - Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1114173855 14:20301235-20301257 GAGAGAAGAAAAGACCCTCCAGG + Intronic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1117779909 14:59221820-59221842 GAGGGAAGAATGCTTCCAGCAGG - Intronic
1118153241 14:63212298-63212320 GAGGGAAGAATGGATTTTGATGG + Intronic
1118236570 14:64010704-64010726 GAGGGAAGAAAGAAACTTTCTGG - Intronic
1118686281 14:68294813-68294835 CAGGGAGGAAAGGCTCCTGCAGG - Intronic
1119927782 14:78512771-78512793 GAGATAAAAAAGGAACCTGCAGG + Intronic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120745188 14:88145927-88145949 GAGGGTAGAAATGATCCAGAAGG + Intergenic
1121221471 14:92288579-92288601 GAGTGGAGGAAGGATCCTCCTGG - Intergenic
1121335636 14:93076139-93076161 GGGGGAAGGAAGGATCTTGGAGG - Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1126774113 15:52085047-52085069 AGGAGAAGAAAGGATCATGCTGG + Intergenic
1129259800 15:74358708-74358730 AAGGGAAGAAATGATCGTGGTGG - Intronic
1129301851 15:74629999-74630021 GAAGGAAGGCAGGAGCCTGCAGG + Exonic
1130807724 15:87343902-87343924 GAAGGGAGAAATGATTCTGCTGG - Intergenic
1130812509 15:87394704-87394726 GAGGCAAGAAAGGAAACTGAAGG + Intergenic
1130937925 15:88485850-88485872 GAGGGAAGAAAGACTCTTGAGGG - Intergenic
1130984552 15:88836540-88836562 GAGGGAAGGAGGGCACCTGCCGG - Intronic
1131352819 15:91717282-91717304 GAGGGAAGGAAGGATTGTGTGGG - Intergenic
1134520620 16:14917848-14917870 GAGGGCAGAAGGGATACTGGGGG - Intronic
1134550954 16:15138126-15138148 GAGGGCAGAAGGGATACTGGGGG + Intronic
1134708292 16:16316499-16316521 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134715507 16:16356532-16356554 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134951310 16:18352146-18352168 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1134959250 16:18395627-18395649 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1135152536 16:20021542-20021564 AAGGCAAGAAAAGATCCTCCTGG - Intergenic
1135550083 16:23391209-23391231 GAGTGAAGAAATGAATCTGCAGG + Intronic
1136473336 16:30496366-30496388 GAGGGAGGGAAGGATCGGGCTGG - Intronic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138226408 16:55299279-55299301 CAGGGAAGACAGGAGCCAGCAGG - Intergenic
1138373194 16:56543538-56543560 GAGGGATCAAAGGAGCCTGCTGG + Intergenic
1138538868 16:57676158-57676180 GGGGGAGGGTAGGATCCTGCAGG - Intronic
1138776124 16:59725974-59725996 GAGGGAAGAATGGTTCCTCCAGG - Intronic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1140262402 16:73391663-73391685 AAGAGAAGAAAGGAACCTACAGG + Intergenic
1140710389 16:77672126-77672148 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
1141015467 16:80445078-80445100 GAGGGAATAATTGATCCTGTTGG - Intergenic
1141103141 16:81212555-81212577 GAGCGCAGAGAGGATCCCGCGGG - Intergenic
1141690556 16:85594093-85594115 GAGGGAGGAAAGGGGCCTGGAGG + Intergenic
1141941027 16:87276364-87276386 GAGGGCAGGAGGGATCTTGCTGG - Intronic
1141985269 16:87575803-87575825 GGGGGAAGAGAGGCTCCTACAGG - Intergenic
1142245315 16:88967633-88967655 GAGGGAAGGAAGGAGCAGGCCGG + Intronic
1142703058 17:1676176-1676198 TAGGGTAGATAGGTTCCTGCTGG - Intronic
1143148146 17:4789752-4789774 GAGGGGAGTCAGGAACCTGCGGG - Exonic
1144161424 17:12564169-12564191 GAGGGAAGAGAGGCTGGTGCTGG + Intergenic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144551849 17:16247737-16247759 GTGGGACGAAAGAAGCCTGCTGG - Intronic
1144662395 17:17079757-17079779 GAGGGAATAATGGATTTTGCTGG - Intronic
1145813039 17:27776191-27776213 GAGGCATGAGAGGATCCAGCTGG + Intronic
1146716079 17:35088590-35088612 GAGGGAACAGTGGACCCTGCGGG + Intronic
1147212798 17:38881812-38881834 GAGGGGAGCTAGGATCTTGCAGG + Intronic
1147633654 17:41949153-41949175 GTGGGAAGAAAAGATCCCTCTGG + Exonic
1149028382 17:52056285-52056307 GAGGGAAGAAGGCAGCTTGCAGG + Intronic
1150823976 17:68457892-68457914 GAGGGAAGAAGGAATGCGGCTGG + Intergenic
1152276396 17:79360324-79360346 CAGGGAACCAAGGAACCTGCAGG + Intronic
1152517772 17:80836245-80836267 GAGGGAAGAAAAGATCTGACCGG - Intronic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1152863867 17:82710771-82710793 GAGGACACAAAGGCTCCTGCCGG + Intergenic
1153200605 18:2643694-2643716 ATGGGAAGAAAAGATCATGCAGG - Intergenic
1153413854 18:4824044-4824066 TGGGGAAGAAAGGAGCCTTCAGG - Intergenic
1153950422 18:10053729-10053751 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1154326192 18:13392499-13392521 GAGGGAAGCAGGGACCCTTCCGG + Intronic
1154410782 18:14141088-14141110 GAGGGGAGAGAGGATTCTGCTGG + Intergenic
1154974782 18:21446501-21446523 CAGGAAAGAACTGATCCTGCAGG - Intronic
1155174208 18:23288683-23288705 GAGGGAAGAAATGACCGTGGTGG - Intronic
1155334863 18:24753196-24753218 GAGAGGAAAAAGGACCCTGCCGG - Intergenic
1157227944 18:45884715-45884737 GAGTGAAGAAAGGAGACAGCAGG + Exonic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1158935058 18:62356839-62356861 GAGCAAGGAAAGGAGCCTGCAGG + Intronic
1159163179 18:64670588-64670610 GAGGGAAGAATGGATACTGGAGG + Intergenic
1159438292 18:68446084-68446106 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159831549 18:73284073-73284095 GAGGCAAGAGAGAAGCCTGCAGG - Intergenic
1160341764 18:78095334-78095356 TAAAGAAGAAAGGATGCTGCAGG - Intergenic
1162014071 19:7834446-7834468 TAGGTCAGAAAGGATTCTGCAGG + Intronic
1163383746 19:16986238-16986260 GAGGGAAGATGGGTTCATGCTGG - Intronic
1163609163 19:18292178-18292200 GGGGGGAGAAAGGATCCGGGGGG + Intergenic
1165379093 19:35465204-35465226 GAGAAAGGTAAGGATCCTGCAGG - Intergenic
1165823694 19:38693470-38693492 GAGGGAAGAAAGGGCCTTGGTGG - Intronic
1166102152 19:40577145-40577167 GAGGGAACCCTGGATCCTGCGGG + Intronic
1166459852 19:42977459-42977481 GAGGGCAGGAAGCATCCAGCTGG - Intronic
1166477177 19:43137513-43137535 GAGGGCAGGAAGCATCCAGCTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167096668 19:47378148-47378170 GAGGGGAGAGAGGAACCTGCAGG + Intronic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
1168195279 19:54770136-54770158 GAGGGGAGATAGGAACCTGGAGG + Intronic
1168212631 19:54901614-54901636 GAGCGAAGAAAGGATGCTAGTGG + Intergenic
926223662 2:10952506-10952528 CTGGGAAGACAGGATTCTGCAGG - Intergenic
926369562 2:12166275-12166297 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
927454849 2:23240629-23240651 GAGGGAAGGGAGGATCTTGCAGG - Intergenic
927685127 2:25165299-25165321 GAGGAATGATAGGATCCTGGTGG - Intronic
927832532 2:26364659-26364681 GATGGAAGAAAGAATGCTGATGG + Intronic
928946297 2:36774941-36774963 AAGGAAAGAAAGCAGCCTGCTGG + Intronic
931198530 2:60075318-60075340 CTGGGGAGAAAGCATCCTGCAGG - Intergenic
932740573 2:74287732-74287754 GATGGAAGAAAGGATGTTGATGG - Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933292406 2:80452635-80452657 GGGAGAAGAAAGGATGCTGGTGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
935305660 2:101733899-101733921 CAGGGAACAAAGGCTCCAGCAGG - Intronic
935627113 2:105180524-105180546 CACGGATGAAAGGATCCTGAAGG - Intergenic
938208624 2:129445078-129445100 GGGGAAAGAATGGCTCCTGCTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939045235 2:137242320-137242342 GAGGGAAGAGAGACTCCTGGAGG - Intronic
940007351 2:149020202-149020224 GATGGATGAGAGCATCCTGCTGG + Intronic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941845055 2:170123950-170123972 GAAAAAAAAAAGGATCCTGCAGG + Intergenic
941987079 2:171520550-171520572 GAGGGAAGACAGGAACCTCCTGG - Intergenic
942481845 2:176396595-176396617 GAGGGAGGAAAGGATCTTAGAGG - Intergenic
942919227 2:181350865-181350887 GAGTCAAGAAAGGAGCCTGATGG - Intergenic
944981307 2:205123757-205123779 GATGGAAGTAAGGATCCTTCAGG + Intronic
946052290 2:216873607-216873629 GAGGGTAGATAGAACCCTGCCGG - Intergenic
946153692 2:217793300-217793322 GAGGGAAGAAAGGGTGTTTCAGG - Intergenic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
947161668 2:227221369-227221391 GAGGGAAGACAGGAGACTCCAGG - Intronic
947877292 2:233476201-233476223 GAGGGCAGAAAGGACACCGCTGG - Exonic
948647174 2:239412722-239412744 TAGGTCAGAAAGGATTCTGCAGG - Intergenic
1169867164 20:10214515-10214537 GAGGGCAGAAAGGAGTCTGATGG + Intergenic
1170000788 20:11611179-11611201 GATGGAAGAAAGGCTACTACGGG + Intergenic
1170577064 20:17672082-17672104 CAGGGAGGAAGGGCTCCTGCAGG + Intronic
1170604534 20:17865706-17865728 TAGGGAAGAATGTCTCCTGCAGG + Intergenic
1170900931 20:20462456-20462478 GGAGGAAGGAAGGATACTGCAGG - Intronic
1171849722 20:30299771-30299793 GAGGGGAGAAAAAGTCCTGCTGG + Intergenic
1172877279 20:38172624-38172646 GAGCGAAGAAAGCACACTGCAGG + Intergenic
1174042211 20:47708121-47708143 GAGGGCAGAAGGGATCCTGGTGG - Intronic
1174050709 20:47765491-47765513 GAGGGAAGAAAGGAAATTGTGGG + Intronic
1174098655 20:48109745-48109767 GAGGGAAGAAAGGAGCATCTGGG - Intergenic
1176045516 20:63090785-63090807 GAGGGAACAAAGTGTCCTGGAGG - Intergenic
1176862279 21:14017330-14017352 GAGGGGAGAGAGGATTCTGCCGG - Intergenic
1178713521 21:34942459-34942481 GAGGGAAGAAAGGCATCTGGAGG - Intronic
1180157092 21:45983059-45983081 TAGGGAAGAGAGGCTCCCGCAGG + Intronic
1182037796 22:27213166-27213188 GAGGGAATAAAGGAACCTTGAGG + Intergenic
1182254804 22:29030744-29030766 GAGGGGAGGAGGGACCCTGCAGG + Intronic
1182556712 22:31133264-31133286 CAGGGAAGAAAGGGGCCTGGAGG + Intronic
1182919258 22:34064511-34064533 AAGGGAAAAAAGGATCCAGGGGG + Intergenic
1183292272 22:37010168-37010190 CAGTGAAGACAGGATCCTGGAGG - Intergenic
1183699603 22:39443627-39443649 GCGTGAACAGAGGATCCTGCAGG + Intergenic
1183784171 22:40019764-40019786 TAGTGAAGACAGGAGCCTGCAGG + Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184037738 22:41926517-41926539 GAGGGCTGAAAGGACCCTGTGGG - Intronic
1184443954 22:44536273-44536295 GAGAGAAGAAAAGATCGTGGGGG - Intergenic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
1185367468 22:50443479-50443501 GAGGGTAGAGAGGACCCTGCCGG - Intronic
949635351 3:5976277-5976299 GAGGGCAGGAAGCATCCAGCGGG + Intergenic
950221041 3:11196293-11196315 GAGGGAGGAAAGGGTGCTCCAGG - Intronic
950289836 3:11774764-11774786 GAAGGAAGAAAGGATCTCCCTGG + Intergenic
952253806 3:31678493-31678515 TAGAGAAGGAAGGATCCTGAAGG + Intronic
952856298 3:37773227-37773249 GAGGGATGGATGCATCCTGCAGG + Intronic
953340590 3:42131191-42131213 GAGGGGAGACAGGAGCCTCCAGG - Intronic
954860152 3:53681415-53681437 GGGAGAAAAAAGGATCCAGCAGG - Intronic
956853725 3:73255707-73255729 GTGGGAGGAAAGAAACCTGCAGG - Intergenic
957508146 3:81152843-81152865 GAGAGAAGAAAAGAGCATGCAGG + Intergenic
958737678 3:98028656-98028678 GAGGTAATAAAGGACACTGCAGG + Intronic
959303681 3:104633482-104633504 GTGGGAAGAAAGGAGATTGCTGG - Intergenic
959517467 3:107285490-107285512 AAGGGAAGAAAGTAGCCAGCTGG - Intergenic
959620041 3:108389944-108389966 GAGGGAAGAATGGCTCCAGTGGG - Intronic
960148150 3:114225391-114225413 GAAGGAATATTGGATCCTGCTGG + Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961378580 3:126482804-126482826 GAGGGAAGAAAGAGGACTGCAGG - Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961746377 3:129066017-129066039 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
962292493 3:134148170-134148192 GAGGGCAGGAAGCATCCAGCAGG - Intronic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
966885137 3:184373327-184373349 GAGGGAAGAAGGGCTCTTCCAGG - Intronic
967147374 3:186617486-186617508 AAGGGAAGAAAGCATCCTAAGGG + Intronic
967845149 3:194037062-194037084 AAGGGCAGGAAGGATCCTGGAGG + Intergenic
968809065 4:2792102-2792124 GAGGAAGGACAGGATCTTGCTGG - Intergenic
968988872 4:3895315-3895337 GAGGAAAGAAAGCATCTTTCAGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969314483 4:6373236-6373258 TGGGGATGGAAGGATCCTGCAGG + Intronic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
969938021 4:10702257-10702279 AAGGGAAGAAAGGACGTTGCAGG + Intergenic
970401785 4:15724269-15724291 GATGGAAGAACGGATCCTACAGG - Intronic
970421588 4:15910225-15910247 TAGGGAAGAAAGGCTCATGGTGG - Intergenic
970819417 4:20195824-20195846 AAGGGAAGAAATGATCCTGGTGG - Intergenic
971082844 4:23234838-23234860 AAAGGAAGAAAGGCTCATGCAGG + Intergenic
972573796 4:40333612-40333634 GAGGGGAGAAGGGACCCTGAAGG + Intergenic
972610774 4:40653538-40653560 GAGGGAGAAAGGGAGCCTGCAGG + Intergenic
972883315 4:43452946-43452968 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
972916199 4:43883113-43883135 GAATGAAGAAAGGAACCAGCAGG - Intergenic
973773812 4:54228251-54228273 TCGGGAGGAAACGATCCTGCCGG - Intronic
973803476 4:54501030-54501052 GAGAGAAGGAGGGATCCTGTTGG - Intergenic
973812046 4:54581064-54581086 GAGGTGAGGAAGGATTCTGCTGG + Intergenic
974500153 4:62689076-62689098 GAGGGTAGGAAGCATCCAGCAGG + Intergenic
975047814 4:69826167-69826189 GAGGGAAGGAAGGAATCTCCAGG - Intronic
975066297 4:70068616-70068638 TTGGGAATAAAGAATCCTGCAGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
977284490 4:95085413-95085435 GAGGGAAGAAAGGAGACATCTGG + Intronic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
981261566 4:142727125-142727147 GAAGGAAGAAAGAGTCCTTCTGG + Intronic
982088731 4:151862178-151862200 GAGGGAAGAAAGGAGTTTCCAGG - Intergenic
982601486 4:157456377-157456399 AAGGTAAGAAAGGATTCTGAAGG - Intergenic
983931952 4:173462010-173462032 GAGGAGAAAAAAGATCCTGCAGG + Intergenic
984855270 4:184189642-184189664 GAAGAAAGAGAGGACCCTGCAGG + Intronic
985569509 5:637289-637311 GAGGGAAGAAAGGGGCATACTGG - Intronic
985643994 5:1076561-1076583 GTGGGCAGTCAGGATCCTGCCGG - Intronic
986785339 5:11109025-11109047 GAGGGCAGAGAGGGTCCTTCTGG + Intronic
986854795 5:11855894-11855916 GAGAGAATAAAGGATATTGCCGG + Intronic
987993475 5:25245627-25245649 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
988080232 5:26404889-26404911 GAGGGCAGGAAGCATCCAGCCGG + Intergenic
988738711 5:34048515-34048537 GCTGGAAGAAGGGACCCTGCAGG + Intronic
988994801 5:36704532-36704554 CAGGGTAGAAGTGATCCTGCTGG - Intergenic
989379432 5:40798470-40798492 CAGGGGAGAAAGGAGCCTGGGGG - Intergenic
992225669 5:74618042-74618064 AAGGGAAGAAAGAATCCCTCTGG + Intergenic
994675695 5:102818672-102818694 GAGGGAAGAACTCATCTTGCTGG - Intronic
995148477 5:108813762-108813784 GAGGGAAGAAGAGACACTGCTGG - Intronic
995160616 5:108976270-108976292 GAGGGAGGAAAAGATCCTAAAGG - Intronic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
997758905 5:136425774-136425796 GAGGGAAGAAAGGAACTAGATGG - Intergenic
1000304875 5:159986020-159986042 GTGGGAAGAAAGGAACCCACAGG + Intergenic
1000373319 5:160557532-160557554 GTGGTAAGAAAGGAACCTGAAGG - Intergenic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1001338543 5:170822477-170822499 GAGGAAAGAAAGGCTTCTTCGGG - Intergenic
1002912872 6:1504575-1504597 GAAGTAAGAAAGCAGCCTGCTGG + Intergenic
1003121421 6:3321880-3321902 GAGGGAAGACAGGGGCCTGCTGG + Intronic
1003513705 6:6801943-6801965 GAGGGAAGAAGGGATCAGGGAGG + Intergenic
1006793030 6:36716022-36716044 GAGTGAAGAAAGGCACCTGCAGG - Intronic
1008448281 6:51619141-51619163 AAGAGAAGAAAGCCTCCTGCGGG - Exonic
1008804769 6:55413888-55413910 AATGGAAGACAGGATCCTACTGG + Intergenic
1010212396 6:73372432-73372454 CAAGGAAGAAATGATCCTGTGGG + Intronic
1012221281 6:96652223-96652245 GAGGCAAGAAAGGAAACTGTTGG + Intergenic
1014456049 6:121636116-121636138 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1018611323 6:165650353-165650375 GAGGGGAGAAGGGGTCCTGGGGG - Intronic
1019843064 7:3468663-3468685 GAGGCCAGGAAGAATCCTGCTGG + Intronic
1021612716 7:22473848-22473870 GATGGCAGACAGGATCCAGCAGG + Intronic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1021890496 7:25181368-25181390 GAGGCTAGAAATGAGCCTGCAGG + Intergenic
1024238642 7:47416691-47416713 CAGGGTAGAAAGTACCCTGCAGG - Intronic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1026140708 7:67703926-67703948 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1030120016 7:106100876-106100898 AAGGGAAGAAAGGATCTTGCAGG - Intronic
1030460402 7:109827875-109827897 GAGGGTAGAAGGCATCCAGCAGG + Intergenic
1031004013 7:116451869-116451891 GAGAGAAAAATGGATGCTGCAGG - Intronic
1034189711 7:149204602-149204624 GGGGCAAGAAAGGAGCTTGCCGG + Intronic
1034506528 7:151496652-151496674 TAGGGAAGAAAGAAACCTGGTGG - Intronic
1034558941 7:151867383-151867405 GAGGCAAGGAAGGATCCTCCCGG - Intronic
1037429390 8:18793760-18793782 CAGGGAAGATATTATCCTGCAGG + Intronic
1037641681 8:20750062-20750084 GAGGCAAGAAAGGACTCTTCTGG + Intergenic
1037775814 8:21834933-21834955 GAGGAAAGAAAGGAACATTCTGG + Intergenic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1041018959 8:53618903-53618925 GAGGGAAAAAAGAAAACTGCTGG + Intergenic
1041394825 8:57379545-57379567 AAGGGAAGCAAGCTTCCTGCGGG - Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1044699441 8:94952561-94952583 AAGGGAAGAAAGGATCTGACTGG + Intronic
1044759507 8:95503142-95503164 GAGGGAAGAAAGGAGAATGGAGG - Intergenic
1046099165 8:109594638-109594660 AAGGGAAGAAAGGAACCTGTGGG - Intronic
1046128319 8:109938775-109938797 GAGGGCAGGAAGAATCCAGCAGG + Intergenic
1047451872 8:124972462-124972484 GAGGGAAGAAAGAAAACGGCAGG + Intergenic
1049255944 8:141613940-141613962 GATGGAAGGAAGGCGCCTGCTGG + Intergenic
1049475134 8:142793810-142793832 GAGGGAAGAGAGGCCCATGCTGG + Intergenic
1049691938 8:143965358-143965380 CTGGGAAGACAGGATCCTGTAGG - Intronic
1051707440 9:19895659-19895681 GAAGGAAGGCAGGAGCCTGCAGG - Intergenic
1051733031 9:20167416-20167438 AAGGCAAGAAAGAATCCTGTGGG + Intergenic
1052045062 9:23784333-23784355 GAAGGAAAAAAGGATGCTGTGGG + Intronic
1052867322 9:33472356-33472378 AGGGGAAGAAAGCATCCTCCAGG - Exonic
1053070894 9:35101356-35101378 GAGGGAAGTCTGGATCCTCCTGG + Intronic
1053787495 9:41663063-41663085 GAGGGGAGAAAAAGTCCTGCTGG + Intergenic
1054157629 9:61651704-61651726 GAGGGGAGAAAAAGTCCTGCTGG - Intergenic
1054175773 9:61874402-61874424 GAGGGGAGAAACAGTCCTGCTGG + Intergenic
1054477403 9:65582709-65582731 GAGGGGAGAAAAAGTCCTGCTGG - Intergenic
1054661766 9:67706408-67706430 GAGGGGAGAAACAGTCCTGCTGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057878003 9:98772361-98772383 GAGGAAAGAAAGGATCTCCCCGG + Intronic
1057891890 9:98875846-98875868 GAGGAAAGAGAGGATGCTCCAGG + Intergenic
1058921430 9:109618886-109618908 GAGGGATGTTAGGATCTTGCAGG + Intergenic
1060521258 9:124295271-124295293 GAGGGAACACAGGACCCGGCCGG + Intronic
1060534935 9:124377915-124377937 GGGGAAAAAAAAGATCCTGCTGG + Intronic
1060786764 9:126457213-126457235 GAGGGAAGAAGGGATCCCAAAGG - Intronic
1061369027 9:130187539-130187561 CAGGGCAGAACGGCTCCTGCAGG - Intronic
1061934652 9:133850604-133850626 GAGGGAATGAAAGATCCTTCTGG + Intronic
1186187231 X:7033116-7033138 GAGGGCAGGAAGCATCCAGCTGG - Intergenic
1186384916 X:9100422-9100444 CAGGGAAGAAACTACCCTGCAGG - Intronic
1187656238 X:21477638-21477660 GATGTAAGAGAGGATCCTGGAGG + Intronic
1188341236 X:29004577-29004599 GAGGGAAGAAATAATCCAGGAGG + Intronic
1190139730 X:47832266-47832288 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1192979990 X:76328914-76328936 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1194827154 X:98577656-98577678 GAGTGAAGAAATGGTCCTTCAGG + Intergenic
1195232341 X:102862209-102862231 GAGTGAAGAAAGGGTCATGGAGG - Intergenic
1195254626 X:103080125-103080147 GTGAGAAGAGAGGATCCAGCAGG - Intronic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1195617003 X:106920485-106920507 GAGGGAGAAAGGGATCCTGAGGG - Intronic
1196323993 X:114379659-114379681 GAGGGCAGGAAGCATCCAGCAGG + Intergenic
1198307247 X:135395345-135395367 GAGGGCAGGAAGCATCCAGCAGG - Intergenic
1198686916 X:139237004-139237026 GGGGGAAGGAAGGATCCATCAGG - Intergenic
1199204597 X:145134139-145134161 GAGGAAAGAAAGACTCCTGGAGG - Intergenic
1199950412 X:152701531-152701553 GAGGGAAGACAGTATCTTGGGGG + Exonic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic