ID: 922621826

View in Genome Browser
Species Human (GRCh38)
Location 1:226994585-226994607
Sequence CTGTAGGCCTTTACAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922621820_922621826 26 Left 922621820 1:226994536-226994558 CCTTCTATGAGCTGAGGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 230
Right 922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG 0: 1
1: 0
2: 1
3: 10
4: 146
922621819_922621826 27 Left 922621819 1:226994535-226994557 CCCTTCTATGAGCTGAGGAAGAG 0: 1
1: 0
2: 2
3: 17
4: 182
Right 922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG 0: 1
1: 0
2: 1
3: 10
4: 146
922621818_922621826 28 Left 922621818 1:226994534-226994556 CCCCTTCTATGAGCTGAGGAAGA 0: 1
1: 0
2: 0
3: 19
4: 204
Right 922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922621826 Original CRISPR CTGTAGGCCTTTACAGATGA TGG Intronic
900908409 1:5576935-5576957 GTGTAGCCCTGTACAGGTGAGGG + Intergenic
905591010 1:39163514-39163536 CTGTAGGTAGTTCCAGATGAGGG + Intronic
906837369 1:49098496-49098518 CTTTTGCCCTTTAGAGATGATGG - Intronic
908564976 1:65345057-65345079 GAGTGGGCTTTTACAGATGATGG + Intronic
910217710 1:84858988-84859010 CTTTAAGCCTTTGCAGATGTTGG - Intronic
911321072 1:96414748-96414770 CTGTAGCCCATGACAGATGAGGG - Intergenic
911774627 1:101792507-101792529 CTTTAGGCTTTGACAAATGAAGG + Intergenic
911784397 1:101927170-101927192 CTCTAGGCCTTTACAGCATAGGG - Intronic
912968846 1:114261274-114261296 CTGCCGTCCTTTACAGATGAGGG - Intergenic
915979698 1:160412236-160412258 CTGTTGGCTTTGGCAGATGATGG + Intronic
916249058 1:162718376-162718398 CTCTAGGCCTTTTCAGCGGATGG + Intronic
919963639 1:202498607-202498629 CTGTAGGCCCATATAGATAATGG - Intronic
922246682 1:223805928-223805950 ATGTAGCCCTTTACAGAGAAAGG + Intronic
922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG + Intronic
1063440940 10:6072475-6072497 CTGTGGGTCTTTATGGATGAGGG - Intergenic
1063532369 10:6846772-6846794 CTTTATGCCTTTAAAAATGATGG - Intergenic
1065804090 10:29378904-29378926 CTGATGGCATTTACAGATGGAGG + Intergenic
1067126108 10:43516934-43516956 CTGTGTCCCTTTAGAGATGAAGG - Intergenic
1068565021 10:58565311-58565333 CTGCAAGTCTTTAGAGATGAGGG - Intronic
1070438557 10:76418025-76418047 CTGTAGTCATTGACAGATAAGGG - Intronic
1070461635 10:76676183-76676205 CTGTAGGCCCTTCCAGTTCATGG + Intergenic
1072019942 10:91388536-91388558 ATGTAGGCATTTAGTGATGAAGG + Intergenic
1073867910 10:107825960-107825982 CTGTAGGCCTGGACAGAGGGTGG + Intergenic
1076007070 10:126956355-126956377 CTGTAGGCCTTAGCACAAGAAGG - Intronic
1076080531 10:127576486-127576508 CTCCAGGCCCATACAGATGAAGG - Intergenic
1077971392 11:7195004-7195026 CTTTAGGCCATTTCACATGATGG - Intergenic
1078236131 11:9486526-9486548 CTGCTGGCCTTGGCAGATGAGGG - Intronic
1078462861 11:11528460-11528482 CTGATTGCCTTTACAGCTGAAGG - Intronic
1078893448 11:15577945-15577967 CTATAAGCATTCACAGATGAGGG + Intergenic
1080329661 11:31121088-31121110 CTGAAGGGCTTTGTAGATGATGG + Intronic
1080509955 11:32959292-32959314 CTATAGCCCTTTACAGAAAAAGG + Intronic
1081211278 11:40337262-40337284 CAGTAAGGCTTTACAGACGAAGG + Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084112285 11:67022242-67022264 CTCTGGGCCTTTAGAGCTGAGGG - Intronic
1084602581 11:70154980-70155002 TTGTAGGGCCTTAGAGATGATGG - Intronic
1084867512 11:72071225-72071247 CTATAGGAATTTACAGAAGAAGG - Intronic
1088210604 11:107451928-107451950 ATGTATGCCTTTTCAGATTAAGG - Intronic
1093294195 12:17367598-17367620 CTGTACACCTTGACTGATGATGG - Intergenic
1094343861 12:29444336-29444358 CTATATGCCTTTTCAGATCAAGG + Intronic
1097237768 12:57551451-57551473 CTTTGGGCCATTACAGATAAAGG - Intronic
1098626164 12:72672135-72672157 CTGTAGTCCTGTATAAATGAGGG + Intergenic
1100780898 12:98025079-98025101 CAGTAGGCCTTTGCAAAAGAGGG - Intergenic
1101766843 12:107708920-107708942 TTCTAGGCCAGTACAGATGACGG + Exonic
1103056635 12:117826241-117826263 TTGTAGGCTTTGACAGATGGTGG - Intronic
1104535087 12:129611370-129611392 CTGTGGACATTTACAGATAAGGG - Intronic
1108034701 13:46277497-46277519 CTGTAGGCCTTGGTAGATGCTGG - Intergenic
1114083163 14:19218912-19218934 CTGTTGGCCTCTGCAGATGGGGG + Intergenic
1115375443 14:32670386-32670408 CTGAAGGTCTTTCCAGAAGAAGG + Intronic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1118447993 14:65869124-65869146 CTGAAGGACTTTCCAGATGGTGG + Intergenic
1121397470 14:93638950-93638972 CTGTCTGCTTTTATAGATGACGG + Intronic
1121557394 14:94848790-94848812 TTCAAGGCCTTCACAGATGAGGG - Intergenic
1121710156 14:96031700-96031722 CTGTAGGGTGTTACAGGTGATGG - Intergenic
1122714131 14:103683614-103683636 CTGTGTGTCTTTACAGAGGATGG - Intronic
1202894786 14_GL000194v1_random:684-706 CTGTTGGCCTCTGCAGATGGGGG + Intergenic
1130685693 15:86035397-86035419 CTGTAGGCCTTTATTTCTGAAGG - Intergenic
1134317770 16:13135391-13135413 ATGTAGATCTCTACAGATGAAGG - Intronic
1135256911 16:20948416-20948438 CTGTAGCCATATAGAGATGACGG + Intronic
1137446561 16:48535854-48535876 CACTAGCCCTTGACAGATGAGGG + Intergenic
1141547245 16:84778570-84778592 CTGTAGGCCTGTACAGCTGATGG + Intronic
1143158604 17:4854310-4854332 CTGGAGGTCTTCACAGATGGAGG - Intronic
1149939787 17:60851519-60851541 ATGTAGAGCTTTACAGATGGTGG - Intronic
1152166947 17:78715456-78715478 CTGTTGGCCATCACAGTTGATGG - Intronic
1152534012 17:80940104-80940126 CTGTAGTTATTTTCAGATGAAGG - Intronic
1153370407 18:4309063-4309085 CTGTAGGCCTCTACAGTTATCGG + Intronic
1155567153 18:27147770-27147792 CTGTAGGGGTTTACAGAGGAAGG - Intronic
1155805056 18:30159337-30159359 CTATAGGCTGTTTCAGATGATGG - Intergenic
1159388506 18:67758460-67758482 CTTTAGGTCTCTACAAATGAGGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159691276 18:71491436-71491458 TTTTTGGCCTTTTCAGATGATGG - Intergenic
1163808662 19:19416414-19416436 CTGAAGGCCTTTCCTGATGCTGG + Intronic
1165230174 19:34381863-34381885 CCCTTGGCCTTTACAGATGGTGG - Intronic
925920628 2:8635365-8635387 CTGTGGGCCTTGACAGAAAAAGG - Intergenic
926172670 2:10562541-10562563 TTGTAAGCAATTACAGATGATGG - Intergenic
931347979 2:61463941-61463963 CTGTCATCCTTTTCAGATGAGGG - Intronic
931826644 2:66007335-66007357 CTGTAGGGCTCTACACAGGATGG - Intergenic
937335601 2:121060408-121060430 CTGCAGCCCTTTCCAGATGGGGG + Intergenic
938493417 2:131777719-131777741 CTGTTGGCCTCTGCAGATGGGGG - Intergenic
938499072 2:131820948-131820970 CTGTTGGCCTCTGCAGATGGGGG + Intergenic
940449426 2:153818752-153818774 CTGTGGGCCTTTACTGGGGAGGG - Intergenic
943559349 2:189442183-189442205 TTGTCCCCCTTTACAGATGATGG - Intronic
943802474 2:192079073-192079095 CTGAAGGCCTTAACGGTTGAAGG - Intronic
948572838 2:238928127-238928149 CTGAAGGCCTTCCCAGGTGATGG - Intergenic
1168863029 20:1059765-1059787 CTGAAGGACTTGACAGCTGAAGG - Intergenic
1169876467 20:10302691-10302713 CTGTAGGACTTTATTTATGATGG - Intronic
1172278207 20:33692403-33692425 TAGGAGGCCTTTACAGTTGAGGG + Intergenic
1173462187 20:43251904-43251926 ATGTAGCCCTTTAGGGATGAGGG + Intergenic
1175509854 20:59516589-59516611 CTGGAGTCCTTTACTGAGGAAGG + Intergenic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1176614485 21:9016671-9016693 CTGTTGGCCTCTGCAGATGGGGG + Intergenic
1176710718 21:10147200-10147222 CTGTTGGCCTCTGCAGATGGGGG - Intergenic
1177807493 21:25888576-25888598 CTGGAAGCCTTTCTAGATGAGGG - Intronic
1180294810 22:10874355-10874377 CTGTTGGCCTCTGCAGATGGGGG - Intergenic
1180497616 22:15903769-15903791 CTGTTGGCCTCTGCAGATGGGGG - Intergenic
951166129 3:19486775-19486797 CTGTAAGGTTTTACAGATTATGG - Intronic
952212432 3:31241698-31241720 CTGAAGGCCCTGACAGCTGAAGG - Intergenic
952317019 3:32239907-32239929 CTCTAGGCCTTCACAGGGGAGGG - Intronic
953168699 3:40488125-40488147 GGGTTGGCCTTTTCAGATGAGGG - Exonic
955627952 3:60939411-60939433 CTTTAGTCCTTTACAGAAAAAGG + Intronic
956098503 3:65742785-65742807 CTGTAGGTTTTCACAGATGCAGG - Intronic
959689043 3:109178600-109178622 CCTTAGCCCTTTCCAGATGAGGG - Intergenic
963016299 3:140827563-140827585 CTCTAGGCCTTTACTCATGCTGG - Intergenic
964793851 3:160477189-160477211 CTGTAGTCCTTTACATTTGTAGG + Intronic
964892919 3:161558040-161558062 CTGTATCACCTTACAGATGATGG + Intergenic
965213737 3:165831163-165831185 ATGTAGGCCTTTACAGAAGCAGG - Intronic
965375965 3:167924408-167924430 CTGTAGACCTTCAAAGATCAAGG - Intergenic
966535054 3:181022841-181022863 ATGTAGGCATTTACAGATACAGG + Intergenic
974121203 4:57640964-57640986 ATGTGGCCCTTTACAGAAGAAGG + Intergenic
976542901 4:86298245-86298267 TTGTAGACATTTCCAGATGAGGG + Intronic
984360962 4:178731282-178731304 CTGTAGGACTTTAAATATCAAGG - Intergenic
987165540 5:15194298-15194320 CTTTAGGCCTGAAGAGATGAAGG - Intergenic
988447788 5:31307135-31307157 CTGTAGGGCTTTGTAGTTGATGG + Intronic
988814509 5:34820698-34820720 TTGTAGGACTTTCTAGATGAAGG + Intronic
990073152 5:51809741-51809763 CTTCAGGCATTTATAGATGATGG - Intergenic
991516575 5:67442771-67442793 CTGTAGGCCTTAGCAGGAGAAGG + Intergenic
993981846 5:94552031-94552053 CTGTGTGTCTTTACAGATGAGGG - Intronic
995473712 5:112527769-112527791 CTGTAGGGTTTTGCAGATTAGGG + Intergenic
996154707 5:120083771-120083793 CTATAGGCCATTATAGATAAAGG + Intergenic
997631931 5:135375207-135375229 ATCTAGGCCACTACAGATGATGG - Intronic
999461548 5:151761098-151761120 CTGTAGGCATGTATAGATGGTGG + Intronic
1001353005 5:170990444-170990466 TTGTTGGCCTTTTCAGAGGAAGG - Intronic
1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG + Intergenic
1004533611 6:16477898-16477920 CTGGAGGCCTGCCCAGATGAGGG + Intronic
1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG + Intronic
1016661636 6:146587864-146587886 GGGTAGACCTTTACAGGTGAAGG - Intergenic
1022410648 7:30136148-30136170 CCGTTGGCTTTTCCAGATGACGG + Intronic
1023556967 7:41433696-41433718 CTGAAGGTCTTTGTAGATGAAGG + Intergenic
1023780407 7:43650149-43650171 CTGTCGGACTCTGCAGATGAGGG + Exonic
1024152444 7:46586310-46586332 CTGTAGTCCTTGACACATAATGG + Intergenic
1024435724 7:49352815-49352837 CTGTAGCCCCTTTAAGATGAAGG - Intergenic
1026001365 7:66561305-66561327 ACCTAGGCCTTTATAGATGAGGG - Intergenic
1028129182 7:87150122-87150144 CTGTAGGGCCTTCCAGCTGATGG - Intergenic
1028827442 7:95289767-95289789 CTGTAGGCATTTACGGGTAAAGG - Intronic
1035302135 7:157904476-157904498 CTGTCGGGCTTTCCAGAGGATGG - Intronic
1035337063 7:158136689-158136711 CTGGTGTCTTTTACAGATGACGG - Exonic
1035560071 8:597796-597818 CTCTAGGGCTTTGCAGATGCAGG - Intergenic
1038105781 8:24432373-24432395 CTGTAAGTTTTTAAAGATGAAGG + Intergenic
1038463544 8:27738294-27738316 CTGTATCCCTTAACAGAAGACGG + Intronic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1046425227 8:114038881-114038903 CTGTATGCCTCTACAGGTGAAGG - Intergenic
1046649123 8:116817678-116817700 GTGAAGCCCTCTACAGATGATGG + Intronic
1049362588 8:142219448-142219470 CTGTCGCCCTTTACAGATTCTGG + Intronic
1051319404 9:15884704-15884726 CTGTCACCTTTTACAGATGAGGG - Intronic
1054328674 9:63730847-63730869 CTGTTGGCCTCTGCAGATGAGGG - Intergenic
1054393525 9:64634361-64634383 CTGCAGGCCTTTGCACATGCCGG - Intergenic
1054800257 9:69340935-69340957 CTGTAAGTGTTTACAAATGATGG + Intronic
1058717884 9:107738738-107738760 CTGGAGGCCATGACAGAGGAAGG - Intergenic
1059725303 9:117002904-117002926 CTCTAGCCCTGAACAGATGAAGG - Intronic
1060311667 9:122467959-122467981 CTGTTGGCCTTCCCAGGTGAAGG - Intergenic
1062419161 9:136471109-136471131 CTGTTTGCCATTACAGAAGAGGG - Intronic
1202795478 9_KI270719v1_random:116188-116210 CTGTTGGCCTCTGCAGATGGGGG - Intergenic
1190338946 X:49281241-49281263 CTGTAGGACTTTTAGGATGAGGG + Intronic
1196084961 X:111674857-111674879 CTGTTGGCCTCTCCACATGAAGG + Intronic
1197323707 X:125065706-125065728 ATGCAGGACTTTACACATGAAGG - Intergenic
1198161097 X:134009338-134009360 CTACAGGCCTTTACAGCTGAAGG - Intergenic
1201917199 Y:19195202-19195224 ATGTAGGCCTTTAGAGAGAAAGG + Intergenic
1202299282 Y:23394451-23394473 CTGTAGGCCCATACAGATAATGG - Intergenic
1202571527 Y:26276147-26276169 CTGTAGGCCCATACAGATAATGG + Intergenic