ID: 922623049

View in Genome Browser
Species Human (GRCh38)
Location 1:227006004-227006026
Sequence GCTGACACAAGTCCAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922623040_922623049 14 Left 922623040 1:227005967-227005989 CCCAATCTTTTTCAGACCAGGAG 0: 1
1: 0
2: 1
3: 24
4: 189
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623046_922623049 -2 Left 922623046 1:227005983-227006005 CCAGGAGGATGAGATGTTGGGGC 0: 1
1: 0
2: 3
3: 31
4: 256
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623041_922623049 13 Left 922623041 1:227005968-227005990 CCAATCTTTTTCAGACCAGGAGG No data
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623035_922623049 24 Left 922623035 1:227005957-227005979 CCCCAAAGGCCCCAATCTTTTTC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623036_922623049 23 Left 922623036 1:227005958-227005980 CCCAAAGGCCCCAATCTTTTTCA 0: 1
1: 0
2: 1
3: 11
4: 196
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623037_922623049 22 Left 922623037 1:227005959-227005981 CCAAAGGCCCCAATCTTTTTCAG 0: 1
1: 0
2: 1
3: 12
4: 136
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623034_922623049 27 Left 922623034 1:227005954-227005976 CCTCCCCAAAGGCCCCAATCTTT 0: 1
1: 0
2: 4
3: 19
4: 336
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
922623039_922623049 15 Left 922623039 1:227005966-227005988 CCCCAATCTTTTTCAGACCAGGA 0: 1
1: 0
2: 2
3: 51
4: 490
Right 922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922623049 Original CRISPR GCTGACACAAGTCCAGAGGA GGG Intronic
901162633 1:7191717-7191739 GCTGTAACAAATACAGAGGATGG + Intronic
902383509 1:16063761-16063783 GCAGACTCAAGTCCACAGCAGGG + Intronic
902673017 1:17988090-17988112 GCTGGCAAAAGTTCAGAGAAAGG - Intergenic
903876451 1:26477578-26477600 TCTGATACAAGTCCCGAGGTCGG + Intergenic
904366543 1:30014451-30014473 CTTAACACAACTCCAGAGGAGGG + Intergenic
904622008 1:31781420-31781442 GCTGCTGCACGTCCAGAGGAGGG + Intergenic
907595289 1:55713937-55713959 CCTGACAAAAGACAAGAGGAAGG - Intergenic
908617483 1:65938290-65938312 GGTGACACAAGTCAAGATGGGGG - Intronic
913342325 1:117770974-117770996 ACTGTCAAAAGTCAAGAGGAAGG - Intergenic
913699666 1:121362252-121362274 TCTGACACTAGGCCAGAGGCAGG - Intronic
914137878 1:144917784-144917806 TCTGACACTAGGCCAGAGGCAGG + Intronic
920414477 1:205789577-205789599 GATGAAAAAAGTCCAGAGGGAGG + Exonic
920487074 1:206380961-206380983 TCTGACACTAGGCCAGAGGCAGG - Intronic
920556313 1:206907385-206907407 GCTGGCAAGACTCCAGAGGATGG + Intronic
922174017 1:223180918-223180940 GTTAAAACAAGTCCAGAGAAAGG + Intergenic
922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG + Intronic
923123995 1:231019910-231019932 GCAGTGACAAGTCCCGAGGAGGG + Exonic
923899837 1:238313754-238313776 CCTAACACATGTCCACAGGATGG - Intergenic
1062834603 10:627336-627358 GGTGACACAGGTCCAGATGCTGG - Intronic
1063616776 10:7607171-7607193 GCTGACACCTGTCTAGAGCAAGG - Intronic
1067173783 10:43928223-43928245 GCTGATAAAAATCCTGAGGAGGG + Intergenic
1067684438 10:48458200-48458222 CCTGACACAATTCCAGAAGCAGG + Intronic
1069956636 10:72056021-72056043 GCTGACCCAAGTTCAGAAGCAGG + Intergenic
1073722523 10:106189449-106189471 GCTGAAACAATTCCAGCAGAGGG - Intergenic
1075576469 10:123581222-123581244 CCTGACAGAAGTCCAGAGAAGGG - Intergenic
1076232755 10:128835360-128835382 GCTGCCCCAAGAACAGAGGAAGG - Intergenic
1076563998 10:131386081-131386103 GCTGAGAAAGGACCAGAGGAAGG + Intergenic
1077746908 11:4916674-4916696 GCTTACAGAATTCCAGAGAAAGG + Intronic
1078526315 11:12104215-12104237 GCTGAGACAACTGCAGAGTAAGG + Intronic
1078573197 11:12476763-12476785 GCTGTCCCAAGGCAAGAGGATGG - Intronic
1081763721 11:45594713-45594735 GCCGACCCCAGGCCAGAGGACGG - Intergenic
1083155051 11:60817608-60817630 CCAGACACAAGCCGAGAGGAGGG - Intergenic
1083215164 11:61214199-61214221 GAAGACACAAGCCCAGAGGCTGG + Intergenic
1083218048 11:61233028-61233050 GAAGACACAAGCCCAGAGGCTGG + Intergenic
1083247309 11:61439181-61439203 CATGACAGAAGTCCAGAGGAAGG + Intronic
1085409293 11:76281935-76281957 GCTGACACAGGCCCAGGGAAGGG + Intergenic
1085621817 11:78043577-78043599 GCTGGCACAAGCACAGTGGAGGG + Intronic
1089538230 11:119173672-119173694 GCTGAGACAAGGCCAGTGGGGGG - Exonic
1090404848 11:126470405-126470427 TCAGACACAAGTCCAGGGGGAGG - Intronic
1091361110 11:134978944-134978966 GCTGACACAAGACAAGGAGAGGG - Intergenic
1091756513 12:3055930-3055952 GAGGACACAAACCCAGAGGAGGG - Intergenic
1095541292 12:43311267-43311289 CCTGCCCCAAGCCCAGAGGAAGG + Intergenic
1100479095 12:94960660-94960682 CCTGAAAGAAGTCCAGAGGTGGG + Intronic
1102340919 12:112121051-112121073 GCTGAGAGAAGTGCAAAGGATGG + Intergenic
1102507354 12:113392101-113392123 GCTCACACACGCCCAGGGGAGGG + Intergenic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1104463639 12:128973607-128973629 CGTCACACAAGCCCAGAGGAAGG + Intronic
1105638136 13:22235950-22235972 GCTGAGAGAGGTGCAGAGGAGGG + Intergenic
1108148896 13:47510821-47510843 GCTGTCACAACTCCACAGGCAGG + Intergenic
1109549207 13:63871148-63871170 TCTGACATAAGTCCAGAGGTAGG - Intergenic
1110231466 13:73171975-73171997 GCTGACAGAATTCCAGAGTGTGG + Intergenic
1111520267 13:89393156-89393178 GCTGATACAAGAAGAGAGGAAGG + Intergenic
1111550458 13:89803658-89803680 GCTGACTCAACCCCTGAGGAAGG - Intergenic
1113381787 13:109811530-109811552 GGGGACACACATCCAGAGGAGGG - Intergenic
1113434931 13:110283878-110283900 GCTGTCACATGTCGACAGGATGG + Intronic
1113693563 13:112328952-112328974 GGTGAGACAAATCCAGAGCAAGG - Intergenic
1119516343 14:75251563-75251585 GAAGACACAAGACCAGAGAAGGG - Intronic
1123162643 14:106294045-106294067 GCAAACACATGTCCACAGGAAGG - Intergenic
1126135028 15:45381589-45381611 GCATAAACAAGTACAGAGGAAGG + Intronic
1126946756 15:53830267-53830289 AATGACACAAGTCCTGAGAAAGG + Intergenic
1129879247 15:78996220-78996242 GCAGCCACAGGCCCAGAGGAGGG + Intronic
1131225817 15:90623729-90623751 GCTGACACGACGCCAGTGGAAGG - Intronic
1132021458 15:98366127-98366149 GCTACCAGAAGCCCAGAGGAAGG + Intergenic
1132387694 15:101411940-101411962 CCTGACACAACTCCAGGGGATGG - Intronic
1132727722 16:1345976-1345998 CCTCACACACGTCCTGAGGAGGG - Exonic
1133003077 16:2860828-2860850 CCTGGCACAAGTCCTGGGGAAGG + Intergenic
1133542748 16:6772289-6772311 CCTGACCCTAGTACAGAGGAAGG + Intronic
1136019377 16:27430257-27430279 GCTGACACGAGTCCAGTAGCCGG + Intronic
1138317973 16:56086752-56086774 TCTGAAACAGGTCCAGAGGCTGG + Intergenic
1138810088 16:60139476-60139498 GCTGACACAAGCACACAGCATGG - Intergenic
1139948003 16:70654750-70654772 GCTGACACAGGTCCTAAGAAGGG - Intronic
1141019495 16:80481868-80481890 GGAGACACAATTCCAGGGGAAGG - Intergenic
1141527762 16:84623404-84623426 GCTGACAAGAGTCCAGATGAAGG + Intergenic
1141624195 16:85252926-85252948 GCTGACACATGCCCACAGGGAGG + Intergenic
1144578434 17:16444258-16444280 GATGCCACAAGTGCAGAGGTGGG + Intronic
1145912233 17:28549454-28549476 GCTGACTCAAGCCCAGAGCCTGG + Intronic
1147244821 17:39113009-39113031 GATGAAACAAGTCAAGATGAAGG + Intronic
1150796973 17:68246871-68246893 GATGACGAAAATCCAGAGGATGG + Intergenic
1151121961 17:71802622-71802644 GTTGACATACGACCAGAGGAAGG - Intergenic
1152726090 17:81947081-81947103 GGTGATTTAAGTCCAGAGGAGGG + Exonic
1153343598 18:4002962-4002984 GCTGATACAAGGCCAGTTGAAGG + Intronic
1153656622 18:7288600-7288622 GCAGCCCCAAGTCCTGAGGAGGG - Intergenic
1154494190 18:14944005-14944027 GCTGACACAAGACAAGGAGAGGG + Intergenic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1163469430 19:17487895-17487917 GCTGGCACAGGTCCAGATGGGGG - Intronic
1166743543 19:45129088-45129110 GCCTACAGAAGGCCAGAGGAGGG - Intronic
1167299490 19:48670750-48670772 GCTGACAGATGTCAGGAGGAAGG + Exonic
928289001 2:30020979-30021001 GCTGACAGGAGTCCAGGGAAAGG - Intergenic
930146848 2:48016335-48016357 GCTTTCACAAGGCCAGAGCAAGG + Intergenic
937076991 2:119114254-119114276 CCAGACACAAGTCCAGGAGAGGG + Intergenic
942901174 2:181121047-181121069 GCTAACACAAGCTCAGAGGAGGG + Intergenic
944686350 2:202121238-202121260 GCACATACAAGTCCAGAGGTAGG - Intronic
945719107 2:213396699-213396721 GCTGACAAATGTCCTGAAGATGG - Intronic
947846669 2:233250264-233250286 TGTGTCTCAAGTCCAGAGGAAGG - Intronic
1168736131 20:138427-138449 GCTTACACAAGTGCACAGCACGG + Intergenic
1169927822 20:10801626-10801648 GCTGACACAAGGCCAGGAGCAGG - Intergenic
1171117342 20:22536400-22536422 GCTGACACAGATACAGAGAAGGG - Intergenic
1172339832 20:34147820-34147842 ACTGACACAAGGCCAGAGTTGGG - Intergenic
1173916220 20:46710190-46710212 GCAGAATCACGTCCAGAGGAGGG - Intronic
1175202631 20:57288683-57288705 GCTGGCAGAACTACAGAGGATGG + Intergenic
1175664809 20:60849472-60849494 CCTGGCACATGCCCAGAGGAGGG - Intergenic
1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG + Intronic
1179342140 21:40522308-40522330 GCTGACACAAATCCACAACAAGG + Intronic
1182057314 22:27369747-27369769 GCAGACACAAATCCTGAGGCTGG - Intergenic
1183093231 22:35537787-35537809 GCATACACAAGCTCAGAGGAGGG + Intergenic
1184962301 22:47940145-47940167 GCTGGAACAAGTCAAGAGCAAGG + Intergenic
1203295700 22_KI270736v1_random:41237-41259 GCTCACACAATTACAGAGGCTGG + Intergenic
949093971 3:63716-63738 CTTGGCACAGGTCCAGAGGAAGG - Intergenic
950075043 3:10181088-10181110 GGAGACAGAAGTCCAGGGGATGG - Intronic
950182504 3:10925717-10925739 GTAGAGACATGTCCAGAGGAAGG + Intronic
952407975 3:33022109-33022131 CCACACACAAGTTCAGAGGAGGG - Intronic
953368356 3:42366383-42366405 CCTGGCACACGTCCTGAGGAGGG + Intergenic
954370944 3:50169341-50169363 CCTGGCACAGGTCCAGAGGCAGG - Intronic
954702236 3:52456284-52456306 GCGGAGACAAGACCGGAGGAGGG + Intronic
954869783 3:53759017-53759039 TCTGACAGGAGTCCAGGGGAGGG - Intronic
956707353 3:72010937-72010959 GCTGAGACAAGGCCGGAGGCAGG + Intergenic
959081838 3:101810450-101810472 GCTGCCACAACTCAAGGGGAAGG - Intronic
961857404 3:129886184-129886206 TCTGACAGAATTCTAGAGGAAGG + Intronic
963678612 3:148346347-148346369 GCTGAGACAATTCCTGAAGAGGG + Intergenic
964433603 3:156630095-156630117 GCTGACCCCAGTCCACAGCATGG + Intergenic
968473265 4:791540-791562 GCTGACACAAGGCCAGGAAACGG + Intronic
968593167 4:1469737-1469759 GCTGCTACAAGCCAAGAGGATGG - Intergenic
976310735 4:83609661-83609683 GCTGGCAAAGGTCCAGAGAAAGG - Intergenic
977281586 4:95046692-95046714 CCTGACAGAAGGGCAGAGGAAGG - Intronic
981078896 4:140618636-140618658 GATGACACCAGTGCAGAGGAAGG - Intergenic
981488416 4:145313429-145313451 GGTTACACTAGCCCAGAGGAAGG + Intergenic
982073924 4:151719930-151719952 GCTGAGAGGAGTCCTGAGGAAGG + Intronic
985409712 4:189670364-189670386 GCAGACAGAGGCCCAGAGGAAGG - Intergenic
985675783 5:1230623-1230645 GGTGACACAAACCCAGAGCAAGG + Intronic
989117180 5:37966113-37966135 GCTGACACAAGGTGTGAGGAAGG - Intergenic
989147074 5:38259144-38259166 GCTGTCTCAATTACAGAGGATGG + Intronic
989301534 5:39900347-39900369 GGAGACACAAGTGCAGAGCAGGG - Intergenic
991314793 5:65288964-65288986 ACCGACACAAGTTCAGAGGTGGG + Intronic
993584949 5:89712607-89712629 GCTGGGAAAACTCCAGAGGATGG + Intergenic
994100157 5:95882956-95882978 GCAGACACTAGTCTAGAGGCTGG + Intergenic
997614580 5:135237629-135237651 GCTGACACAGAGCCAGGGGAGGG - Intronic
999363925 5:151008974-151008996 GCTGAACCAGGGCCAGAGGAAGG + Intergenic
999501057 5:152147112-152147134 GCTTTCTCAAGTCCAGAGGGAGG + Intergenic
1001218986 5:169883168-169883190 GATGACACACGTCCAGGTGATGG - Exonic
1002961969 6:1923694-1923716 CCTGTCACAAGTCCAGTGAAAGG + Intronic
1006775137 6:36586641-36586663 GGTGATACAAGTCTAGAGGTTGG - Intergenic
1008149420 6:47932326-47932348 GCTGACTCAAGTTCAGACAAAGG + Intronic
1012387258 6:98696623-98696645 CCTGACACCTTTCCAGAGGATGG + Intergenic
1015582035 6:134736125-134736147 GCTGAGACAGATCAAGAGGAAGG - Intergenic
1016290888 6:142527085-142527107 GCTGACACAAGGCCACAGAGAGG - Intergenic
1016918350 6:149265912-149265934 GCTGACAAAAGCCGAGAGCAGGG - Intronic
1017664787 6:156709170-156709192 ACTGAAATAAGTCCAGATGAGGG + Intergenic
1018201904 6:161402913-161402935 GCTGACACAATTCCCTGGGAGGG + Intronic
1018812382 6:167307436-167307458 GTTGAGACAGTTCCAGAGGACGG + Intronic
1023677360 7:42644242-42644264 GCTGACATTAGCCCAGTGGATGG + Intergenic
1028227674 7:88267768-88267790 GATGCCACAAGTGCAGAGTAAGG - Intergenic
1028932481 7:96428591-96428613 CCTGCCAGAAGTCCAGAGGCGGG + Intergenic
1030069591 7:105687469-105687491 AATGGCACAAGTCCAGAGGGTGG + Intronic
1033283641 7:140022911-140022933 GCAGACACACGTCCTCAGGAAGG + Intergenic
1033893593 7:146044366-146044388 TCTGACAATATTCCAGAGGAAGG + Intergenic
1039139079 8:34362893-34362915 GCCGAGACAATTCAAGAGGAAGG - Intergenic
1049272075 8:141701210-141701232 GCTGACACATGTCCAGGGGCAGG + Intergenic
1051936545 9:22448219-22448241 GCTGAAAACAGTCCAGAGCAGGG - Intronic
1059567366 9:115396429-115396451 GGGGACACAAGTGCAGAGAATGG + Intronic
1062214083 9:135379704-135379726 GGTGACACAAGACCACAGGCTGG - Intergenic
1203673044 Un_KI270755v1:35116-35138 GCAGACAGAGGCCCAGAGGAAGG + Intergenic
1186472467 X:9832265-9832287 GCAGAACCAAGTCCTGAGGATGG - Intronic
1186638889 X:11434075-11434097 GCTGCCACAACTGCAGGGGAAGG + Intronic
1187387044 X:18858332-18858354 GCTGTTACAAGTCAGGAGGATGG - Intergenic
1193709448 X:84861182-84861204 TCTGACACAAGTCCTGTGAAGGG + Intergenic
1194469997 X:94282316-94282338 GCTGACACTATTCCAAAAGATGG - Intergenic
1195203069 X:102567895-102567917 GCCGACAGAAGTCAAGATGAAGG - Intergenic
1199566245 X:149218293-149218315 TCTGGTACAAGTCCAAAGGATGG - Intergenic
1200420069 Y:2955643-2955665 ACTGACAGAATTCCAGAGGCAGG - Intronic