ID: 922626419

View in Genome Browser
Species Human (GRCh38)
Location 1:227049521-227049543
Sequence TTTCACATGGGGCTTTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922626419_922626424 19 Left 922626419 1:227049521-227049543 CCAATCAAAAGCCCCATGTGAAA 0: 1
1: 0
2: 0
3: 23
4: 280
Right 922626424 1:227049563-227049585 AAGTAATATGAAAAACTAAAAGG 0: 1
1: 0
2: 2
3: 91
4: 1119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922626419 Original CRISPR TTTCACATGGGGCTTTTGAT TGG (reversed) Intronic
903472014 1:23593812-23593834 TTTCCCATGGGCATTTTGAAGGG + Intronic
904844800 1:33402553-33402575 TTTTACATTCTGCTTTTGATTGG - Intronic
905229570 1:36506609-36506631 TCTCACATGGGGCTTCATATCGG - Intergenic
905548238 1:38816905-38816927 TTTCCCAGGGGGCTACTGATGGG + Intergenic
905896341 1:41548127-41548149 TTGCACATGAGGCCATTGATTGG - Intronic
907710341 1:56875126-56875148 TTTCACATGTCACTTTTGACAGG - Intronic
909135381 1:71792666-71792688 TATAACATGGTGCTTTTGATAGG + Intronic
910509436 1:87987147-87987169 TCTCACTTTGCGCTTTTGATAGG - Intergenic
910641294 1:89465654-89465676 TTTGACATGGGGTTCTTGATGGG - Intergenic
911288437 1:96026845-96026867 TTTCCCATTGGACTTTTGTTGGG + Intergenic
911352257 1:96767472-96767494 TAACACATGGGGCTTTAGGTTGG + Intronic
911459905 1:98176121-98176143 ATTCATGTGGGGCTTTTGTTTGG + Intergenic
912051160 1:105529294-105529316 TTGCACATGGGGCCTTTGAAAGG - Intergenic
912686034 1:111765959-111765981 TTTCACAGGAAGCTTTTGTTTGG - Exonic
912972209 1:114294111-114294133 GTTCTCAGGGTGCTTTTGATGGG - Intergenic
912981480 1:114377778-114377800 TTTCCCAAGGGGCTTTTTATTGG - Intergenic
913303454 1:117398334-117398356 ATGCATATGGGGCTATTGATGGG + Intronic
915336621 1:155146858-155146880 TTTTAATTGGGGCTTTTGCTGGG + Intergenic
916849774 1:168691677-168691699 TTTCACATTGGCCTTATGACAGG + Intergenic
919374721 1:196780404-196780426 TTTCACATGTTGCTAATGATTGG + Intronic
920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG + Intronic
920582280 1:207122206-207122228 TTTCACTTGGGACTTTTTTTTGG - Intronic
921962338 1:221048409-221048431 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
922022991 1:221722886-221722908 TTTCTTTTGGGGCTTTTGTTTGG - Intronic
922626419 1:227049521-227049543 TTTCACATGGGGCTTTTGATTGG - Intronic
1063954331 10:11252216-11252238 TTTCACATGGCATTTTTGACAGG + Intronic
1064165756 10:12984335-12984357 TATCACATTGTGGTTTTGATAGG - Intronic
1066042817 10:31567969-31567991 CTTCAAATGGGGTTTTTGAGTGG + Intergenic
1066291060 10:34014786-34014808 GCTCACCTGGGGCTTTTGGTGGG + Intergenic
1066702847 10:38148373-38148395 TTTCACATGGAGAATTTCATGGG + Intergenic
1068038922 10:51798363-51798385 TATCTCATGGTGATTTTGATTGG + Intronic
1069290867 10:66778189-66778211 TTTCACCTCCGGCTTTTTATTGG + Intronic
1071519257 10:86318971-86318993 TTTAAGATGGGGCTTAAGATAGG + Intronic
1073191237 10:101651770-101651792 TGTGACATGGGGGTCTTGATTGG - Intronic
1073811657 10:107158991-107159013 TTTCACATGAGGCATTTTTTTGG + Intronic
1073839360 10:107480722-107480744 TTTCACATGGGGTATTTGTAGGG + Intergenic
1075729734 10:124629015-124629037 TTTTACCTGTGGCTTTAGATTGG - Intronic
1077841806 11:5983504-5983526 TGTCACATGGGGGTTTAGAAAGG - Intergenic
1078447914 11:11418683-11418705 TTTCTCATCGGTCTTTGGATTGG + Intronic
1079584433 11:22108280-22108302 TTTCACATGGGCCTTTCCATAGG + Intergenic
1079660991 11:23036127-23036149 ATTCACCTGGGGCTTTGTATAGG - Intergenic
1080473070 11:32564891-32564913 TTGCACTTAGGGCTTATGATAGG - Intergenic
1081717954 11:45264460-45264482 TTGCACATGGGGCTCTCTATAGG - Intronic
1082981578 11:59128759-59128781 TTTCAGATGGTGTTTTTAATAGG - Intergenic
1085583556 11:77678573-77678595 TTCAACATGGGGATTTTGAGGGG - Intronic
1086399060 11:86446115-86446137 TCACACATGGGGCTTTTGAGGGG - Intronic
1086471133 11:87111796-87111818 TTTAACAGGGTGCTTTTGACAGG - Intronic
1087422478 11:97947857-97947879 TTGGAAATGGGGCTTTTGAAAGG - Intergenic
1088533308 11:110834003-110834025 TTTTACATGTGTCTTTTAATGGG - Intergenic
1089621011 11:119722220-119722242 ATTCACATGGGGCTCCTGAGAGG + Intronic
1090919403 11:131194829-131194851 TTGCTCATGGGGCCTTTGTTTGG + Intergenic
1092563286 12:9638588-9638610 TTCTACATAGGCCTTTTGATTGG + Intergenic
1092973848 12:13725088-13725110 TTTCAGGAGGGGCTTTTGGTAGG - Intronic
1093610641 12:21150668-21150690 TTTCAGATGGGGTTTTTGTGTGG - Intronic
1094757968 12:33493545-33493567 TTTCAGATGGGGTTTTTGTGTGG - Intergenic
1095660752 12:44732173-44732195 TGTAACATTGGGATTTTGATAGG - Intronic
1096337807 12:50770564-50770586 TTTCACATAGGCTTTTTAATTGG - Intronic
1097152742 12:56991573-56991595 TTTCATGTGGGGCTTTTTAGGGG - Intergenic
1098298640 12:69030215-69030237 TCTCACAGGGGTATTTTGATGGG + Intergenic
1098408894 12:70157725-70157747 TTTCACATGGGCTTTTAAATTGG - Intergenic
1098981751 12:76963559-76963581 TTTCACTTGGGTCAGTTGATTGG - Intergenic
1100849103 12:98690842-98690864 TTTCTGAGGGGGCTTATGATAGG - Intronic
1100939651 12:99712263-99712285 TTTCATGTGGGGTTTATGATAGG + Intronic
1101069743 12:101062049-101062071 CTTCACCTGGGGTTTTTGAGTGG + Intronic
1101617657 12:106354002-106354024 TCTCACATAGGGCTTTTCAAGGG - Intergenic
1103593155 12:122006506-122006528 TTTCACACGGGGCTTGTGGCCGG + Intergenic
1104516890 12:129435527-129435549 TTTCTCATGGTGGTTTTGATTGG + Intronic
1105709021 13:22987574-22987596 TTTCACTTGGGACATTTTATTGG - Intergenic
1106025911 13:25954821-25954843 CTTCAGATGGGGTTTTTGAGTGG - Intronic
1106471391 13:30058867-30058889 TTTCCCACGGGGATTTTTATTGG - Intergenic
1107273744 13:38653020-38653042 TTGTACATGGTGCTTTTGACTGG - Intergenic
1107343966 13:39439415-39439437 TCTCAGATGGGACTTTAGATTGG + Intronic
1109474109 13:62855881-62855903 TATCACATTGTGGTTTTGATTGG - Intergenic
1109635069 13:65104624-65104646 TATCACATTGTGGTTTTGATTGG + Intergenic
1110030188 13:70601637-70601659 AATTCCATGGGGCTTTTGATGGG + Intergenic
1110475428 13:75907857-75907879 TTTCACCTGAGGCCTCTGATGGG + Intergenic
1111084203 13:83352440-83352462 TATCTCATTGTGCTTTTGATTGG - Intergenic
1111490138 13:88961593-88961615 TGTCACATGGGGAGTTTGTTGGG - Intergenic
1111577760 13:90180553-90180575 TTTCTCATTGGGCTGTTGTTAGG - Intergenic
1112974651 13:105302464-105302486 TAAGACATGGGGCTTTTGAGAGG - Intergenic
1114908221 14:27157906-27157928 TTATACATTGGGCTTTGGATTGG - Intergenic
1116424873 14:44778774-44778796 TTCCCCATGAGCCTTTTGATAGG - Intergenic
1116557937 14:46337032-46337054 TCACACATGTGGCTTCTGATAGG - Intergenic
1116652528 14:47611635-47611657 TATCACATTGTGGTTTTGATTGG - Intronic
1116668216 14:47806255-47806277 TTTCAAATGGGGTCTTTGAAAGG - Intergenic
1117906642 14:60595866-60595888 TTGAAGATGGGGCTTTTGAGAGG - Intergenic
1119947372 14:78709184-78709206 ATTCACATGGCACTTTTGTTTGG + Intronic
1120196271 14:81486788-81486810 TGTCAAATGGGGCTTTTAACAGG - Intronic
1120541714 14:85759269-85759291 TTTGAAATGGGGCTTTTGGGAGG + Intergenic
1124455595 15:29839708-29839730 TTTCACATGGGGATTTGTACAGG - Intronic
1124567985 15:30833914-30833936 ACACACATGGGCCTTTTGATGGG + Intergenic
1124696113 15:31865791-31865813 TTTCACATGGTGCTGGGGATTGG - Intronic
1130577085 15:85102491-85102513 GTTCACAGGGGGCTTTTACTTGG + Intronic
1131043293 15:89293328-89293350 TTTAACATGGAAATTTTGATTGG + Intronic
1131966549 15:97850162-97850184 TTTCACATGGGCATATTGCTGGG + Intergenic
1132979503 16:2729205-2729227 TTTCTCACGGGGCCTGTGATGGG + Intergenic
1133453003 16:5919292-5919314 TTTCACTTTGGGCTTTTAGTAGG - Intergenic
1134051504 16:11140908-11140930 TTTCAAATGGGGCTGATGATAGG + Intronic
1134835173 16:17355235-17355257 TTTCCCATGAGGGTTTTGAAGGG + Intronic
1135847573 16:25932540-25932562 TGTCACATGGGGATGTTGTTAGG - Intronic
1135964755 16:27026544-27026566 ATTCACATGAGACTTTTGACGGG + Intergenic
1137840895 16:51639981-51640003 TTTCACCTCTGGCTTTTGATTGG + Intergenic
1138109875 16:54315292-54315314 TTTCTAATGGGGCTTTTGGAGGG - Intergenic
1138907252 16:61352237-61352259 TATCACATTGTGGTTTTGATTGG - Intergenic
1140241164 16:73202357-73202379 TCTTCCATGTGGCTTTTGATTGG - Intergenic
1142161569 16:88560453-88560475 TTTCCCATGAAGCTGTTGATCGG + Intergenic
1143485291 17:7250980-7251002 TTGCCCTTGGGGGTTTTGATGGG - Intronic
1145893141 17:28433039-28433061 TTTAAATTGGGGCTTTTGGTTGG - Intergenic
1146649107 17:34595748-34595770 TTTCACATGAGGGTATTGACAGG + Intronic
1147459958 17:40562013-40562035 TACCTCATGGGGCTTTTGAGAGG - Intronic
1148670566 17:49407103-49407125 TGGCACCGGGGGCTTTTGATGGG + Intronic
1149464531 17:56866416-56866438 ATTCACCTAGGGCTTTTGCTAGG + Exonic
1153313310 18:3699312-3699334 TTTCAGATGGGGTTTTTGTGTGG + Intronic
1154098802 18:11448504-11448526 TCTGACATGGGGCTTTTGTGGGG - Intergenic
1154375071 18:13802388-13802410 TTTCACATGCCGCTTTGGAGCGG + Intergenic
1154504151 18:15018589-15018611 TTTCTCATGGGCCTTTAGACTGG + Intergenic
1156726418 18:40133556-40133578 TTCCTCATGGGGCCTTTCATGGG - Intergenic
1157887421 18:51382562-51382584 TTTCAAATAGGGCTTATCATGGG + Intergenic
1160267080 18:77347880-77347902 TATCACATTGTGGTTTTGATTGG + Intergenic
1164035881 19:21454531-21454553 TTTCCCGAGGGGCTTTTAATTGG + Intronic
1167616692 19:50538410-50538432 TGAAACATGGAGCTTTTGATTGG - Intronic
1168533016 19:57145051-57145073 GATCAGGTGGGGCTTTTGATAGG - Exonic
926588819 2:14718335-14718357 TTTACCATGTGGCATTTGATGGG - Intergenic
928225990 2:29448640-29448662 TTACCCATGGAGCTTTTGGTGGG - Intronic
930420408 2:51145562-51145584 TTGGACGTGGGGCCTTTGATAGG - Intergenic
930836304 2:55797412-55797434 TATCACATTGTGGTTTTGATTGG - Intergenic
930945005 2:57062603-57062625 TTCCACATGGGCCTCTTCATAGG - Intergenic
932856229 2:75236638-75236660 TATCTCATTGTGCTTTTGATTGG + Intergenic
935644602 2:105323744-105323766 ATTCCCATGGGGGGTTTGATAGG + Intronic
936430423 2:112457914-112457936 TTTCATAAGGGGCTTTTGCTTGG - Intergenic
937185791 2:120040532-120040554 TTTCCCATGTGGCTTTTGTATGG - Intronic
937723735 2:125134502-125134524 TTACGCATGGGAGTTTTGATTGG + Intergenic
938503334 2:131848792-131848814 TTTCTCATGGGCCTTTAGACTGG + Intergenic
940017571 2:149122813-149122835 TTTCACATGTTGCTTTTATTTGG + Intronic
941464843 2:165813816-165813838 TTTCTCATGTGGCTGTTGAGAGG + Intergenic
942732696 2:179076879-179076901 TTTCAGATGGGGTTTTTGTGTGG - Intergenic
942939741 2:181602216-181602238 TCTCCCATGGGGCTTATGAAGGG - Intronic
943288130 2:186031617-186031639 TTTCCCATGGGGCTGTGGATAGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947088299 2:226480104-226480126 GTAAACATGGGGCTTTTGATAGG - Intergenic
947383255 2:229565045-229565067 TTGCAGCTGGGGCTTTTGAGAGG - Intronic
947754510 2:232551753-232551775 TGTGACCTGGTGCTTTTGATGGG + Intronic
1168858070 20:1023455-1023477 TTTCACAAAGTCCTTTTGATGGG - Intergenic
1168987341 20:2061248-2061270 TATCACATTGTGGTTTTGATTGG - Intergenic
1169422251 20:5470114-5470136 TCTCACATGGGGCTTCTGCCTGG + Intergenic
1177459825 21:21396285-21396307 TATCACATTGTGGTTTTGATTGG - Intronic
1177957281 21:27614495-27614517 TATCACATTGTGGTTTTGATTGG + Intergenic
1178290254 21:31361694-31361716 TTACTCATTGGGCTTTTGAGTGG - Intronic
1178930526 21:36814741-36814763 TTTAACATGTGGGTTCTGATTGG + Intronic
1179355660 21:40656325-40656347 TTTCACATTAGGATTTTGAAGGG - Intronic
1179676915 21:42989335-42989357 TTTCTCATGGATCTTTTGACTGG + Intronic
1180989791 22:19928633-19928655 TTCCACATAGGGATTTTGAGGGG - Intronic
1184627748 22:45750592-45750614 TTTCACAGTGGGATTTTAATTGG - Intronic
950508237 3:13409566-13409588 TATCAAATGGGGGTTTTAATAGG - Intronic
951513067 3:23526244-23526266 TTTCACAAGGGGCTTCATATAGG - Intronic
951531117 3:23698934-23698956 TGTCAAATGAGGCTTTTAATGGG - Intergenic
953163090 3:40440367-40440389 ATTCAGATGGGGGTTTTGGTGGG - Intergenic
953915466 3:46917433-46917455 TGACTCATGGGGCTGTTGATTGG - Intergenic
954026818 3:47789635-47789657 TTTCACATTGGGTCTTTGAGTGG - Intergenic
954212084 3:49103630-49103652 TTCAACATGGGGCTGCTGATGGG - Exonic
955254711 3:57318904-57318926 TTTAAGATTGGGATTTTGATAGG + Intronic
956465527 3:69517051-69517073 TTACACATGAGGCCTTTGAAAGG + Intronic
956641821 3:71422930-71422952 TTACACATGGGGGTTTGTATTGG - Intronic
957267000 3:77980220-77980242 TTTCCCACTGGGATTTTGATTGG - Intergenic
959278312 3:104305274-104305296 TTTCAGATGGGGTTTTTGCATGG - Intergenic
960217748 3:115063507-115063529 TTGTACATGGGGCCTTTGGTAGG - Intronic
960218954 3:115080073-115080095 TAGCAGATGGGGCTTTTGAGAGG + Intronic
960537354 3:118828394-118828416 TTCCACAGGGGGCTTGTGGTCGG - Intergenic
960768381 3:121164278-121164300 TTTCTCATAGTGGTTTTGATTGG - Intronic
964683370 3:159366806-159366828 TTTCAAAAGATGCTTTTGATAGG + Intronic
965018616 3:163195362-163195384 TTTCACATAGGGCTTTTTAAAGG - Intergenic
965035662 3:163434503-163434525 TATCTCATTGTGCTTTTGATTGG - Intergenic
965490778 3:169333282-169333304 TTTGACATGGTGCAGTTGATGGG - Intronic
966077328 3:175953334-175953356 TTGGAGATGGGGCTTTTGGTAGG + Intergenic
967382797 3:188879146-188879168 TTTCTCATGAGGCTGTTGTTTGG + Exonic
967619898 3:191620198-191620220 CTTCACATCTGTCTTTTGATTGG - Intergenic
968972769 4:3804517-3804539 TTCCACATGAGGCTTTTGTGGGG - Intergenic
970096771 4:12472305-12472327 TTGCACATTGGGCCTGTGATGGG + Intergenic
970953869 4:21787908-21787930 TTTCCCATGGCACATTTGATTGG - Intronic
971475681 4:27069468-27069490 TTTCAGATGGGGCTTCAAATGGG + Intergenic
971912253 4:32809714-32809736 TTTCAGATGAGACTTTGGATTGG - Intergenic
972079945 4:35138191-35138213 TTTCACATGTGGCAATTAATGGG - Intergenic
972625582 4:40795732-40795754 CTTCAAATCGGGCTTTTAATCGG - Intronic
973287355 4:48433416-48433438 TCTCACATGGGCCTTTATATAGG - Intergenic
974684548 4:65210026-65210048 TTTGACATTGGTATTTTGATAGG - Intergenic
975297699 4:72752368-72752390 TTTCAAATGGGGTTTTTGTGGGG - Intergenic
975510196 4:75186346-75186368 TATCACATTGTGGTTTTGATTGG - Intergenic
975720830 4:77247154-77247176 TTTCACATGGGGCTTTATTCCGG + Intronic
976270937 4:83229813-83229835 GTTCACAGTGGGCTTTTGTTTGG + Intergenic
978849487 4:113316070-113316092 TTTTACATTTAGCTTTTGATAGG - Intronic
978950233 4:114549364-114549386 TTTCACATGGGCTTTTTAATTGG + Intergenic
981168918 4:141598427-141598449 TATCACATTGTGGTTTTGATTGG - Intergenic
982714080 4:158788501-158788523 TTTTATTTGGGGTTTTTGATGGG + Intronic
982733524 4:158980681-158980703 CTTCAAATGGGGCTTCTGAGTGG - Intronic
984354309 4:178637956-178637978 CTTCACATGGGGTTTTTGCTTGG - Intergenic
984476008 4:180236177-180236199 TTTCTCATGGGGCTCTTGTAAGG - Intergenic
984601613 4:181733664-181733686 TATCTCATGGGGCTTATGGTTGG + Intergenic
985497940 5:220627-220649 TTTCCCAAGGGTCTTTAGATAGG + Intronic
985625988 5:988083-988105 TCTAACACGGGGCTTTTGACTGG - Intergenic
985958127 5:3279571-3279593 TTTCTCATGGGGCTTTGAAATGG - Intergenic
986894786 5:12352118-12352140 TTTCACCTGAGGCTTTTGGCTGG - Intergenic
987165917 5:15197844-15197866 TTTCACATAGGCTTTTTAATTGG + Intergenic
987608253 5:20167348-20167370 TTTAAGATCGGGATTTTGATCGG + Intronic
988838909 5:35063991-35064013 TTTCACAGTGGGCTTTGGGTTGG + Exonic
990170401 5:53042184-53042206 TTTCACATGTGGCAGTGGATAGG - Exonic
990597862 5:57329441-57329463 TTTCACATGGAGCCTTTGGGAGG - Intergenic
991001832 5:61790834-61790856 TGTCACCTGGGGCTGTTGACTGG - Intergenic
993410365 5:87566683-87566705 CTTCGGATGGGGTTTTTGATTGG + Intergenic
993678864 5:90850344-90850366 CCTCACATGGGGCTTTTGAAAGG + Intronic
995947623 5:117668563-117668585 TTTCACATGTGTTTTGTGATTGG + Intergenic
1000102844 5:158033414-158033436 TTCCAAATGGGGCTTCTGAGAGG - Intergenic
1000264992 5:159627511-159627533 TATCACATTGTGGTTTTGATTGG - Intergenic
1000655801 5:163876524-163876546 TGTCACGTGGGCCTCTTGATGGG + Intergenic
1000729629 5:164817096-164817118 ACTCCCATGGGGATTTTGATGGG - Intergenic
1002857713 6:1052791-1052813 TTTCACAGAAGGCTTTTTATAGG + Intergenic
1004605846 6:17194485-17194507 CATAACATGGGGCTTATGATTGG + Intergenic
1006467676 6:34205863-34205885 TCTCACCTGGGGCTTTTGCATGG - Intergenic
1006942451 6:37762034-37762056 TTGCACATGAGGCTATTTATGGG - Intergenic
1007285067 6:40741658-40741680 TTGCTCATGGGGCTTTCCATAGG - Intergenic
1007297356 6:40835151-40835173 TTTAACATGTAGCTTTTGAAGGG + Intergenic
1007858251 6:44879901-44879923 CTTCAGATGGGGCTTTTGAGTGG - Intronic
1009026441 6:58006125-58006147 GTTTTCATGGGTCTTTTGATTGG + Intergenic
1009201992 6:60757598-60757620 GTTTTCATGGGTCTTTTGATTGG + Intergenic
1009433587 6:63593023-63593045 TTCCACATGGGCCTTTCCATAGG - Intergenic
1009444846 6:63730077-63730099 TTCTACATGGGGCTTTGAATGGG - Intronic
1010302550 6:74279104-74279126 TGTCACATGGGCCTCTTTATAGG + Intergenic
1010761713 6:79731634-79731656 TTTCACAAGAGGCTTTTGTTGGG - Intergenic
1010775989 6:79886515-79886537 TATCACATTGTGATTTTGATAGG - Intergenic
1010914315 6:81596777-81596799 TTTCACATGGGTCTTGAGGTAGG - Intronic
1012463303 6:99488487-99488509 TTTCACACAGGGCTTCTGAAAGG - Intronic
1014494793 6:122107930-122107952 TTTAACATGGTACTTTTGAAGGG + Intergenic
1014876796 6:126671790-126671812 TTTCAGATGAGACTTTTAATGGG + Intergenic
1015100389 6:129471563-129471585 TTTCATATGGGGCTGTTGACTGG - Intronic
1015727669 6:136316229-136316251 TTTGAGATGGGGCCTTTGAGAGG + Intergenic
1015834630 6:137406876-137406898 TTTCTCATTGTGGTTTTGATTGG + Intergenic
1018529034 6:164743500-164743522 TTTCACATTGGGCATGTTATGGG - Intergenic
1018593814 6:165456281-165456303 TTACACATGAAGCTTTTGCTTGG - Intronic
1019076384 6:169391427-169391449 TTTCTCAAGGGGCTTTTATTGGG + Intergenic
1019793379 7:3032078-3032100 ATTCTCATGCGTCTTTTGATAGG - Intronic
1020949433 7:14656607-14656629 TGTCTTATGGGGCTTTTGTTTGG + Intronic
1021696134 7:23278090-23278112 ATTCTGATGGGGCTTTTGGTGGG + Intergenic
1022144562 7:27524169-27524191 TTTCACAGGCTGCTTGTGATAGG + Intergenic
1022608900 7:31848574-31848596 TTCCACATGTGGCTTTTGCATGG - Intronic
1023122277 7:36921825-36921847 TCTCACCTGGGGCATTTGCTGGG + Intronic
1024681069 7:51688336-51688358 TTACACATGTGGCTTTTGCCTGG + Intergenic
1025083534 7:56004525-56004547 TTTCACGTGGGGATTTTAACTGG + Intergenic
1027582990 7:80021097-80021119 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
1028497969 7:91483248-91483270 TTGGACATGTGGGTTTTGATAGG + Intergenic
1029210171 7:98901406-98901428 TTTCACATGGGAATTTTAAGGGG + Intronic
1030155677 7:106452047-106452069 TTTCACATAGGCTTTTTAATTGG + Intergenic
1030929946 7:115510168-115510190 TTTCAGATGAAGCTTTTGAAGGG + Intergenic
1032182310 7:129690781-129690803 TTTCACTTGGGCCTTTGGGTTGG + Intronic
1037345143 8:17890799-17890821 TTTTATAAGGGGCTTTTGCTTGG - Intronic
1037398057 8:18464059-18464081 TATCACATTGTGGTTTTGATTGG + Intergenic
1037604836 8:20429280-20429302 GTTCACAGGTGGCTTTTGACAGG - Intergenic
1037712687 8:21367951-21367973 TTTCTCTTGGCGCTTTGGATTGG - Intergenic
1038998922 8:32957821-32957843 TTTCAGATGAGGCTTTTGGGGGG + Intergenic
1042986581 8:74590515-74590537 TATCTCATTGTGCTTTTGATTGG - Intergenic
1043303590 8:78765854-78765876 ATTCACATGGGGGTTTTGTGTGG - Intronic
1044158499 8:88881622-88881644 CTTCACATGGGACTTTTTATAGG - Intergenic
1045555694 8:103212956-103212978 TTCCACCTGGGGCTGTAGATCGG - Exonic
1046291475 8:112167564-112167586 TTGCACATGGGCCTTTTCTTTGG + Intergenic
1046435831 8:114188526-114188548 TTGCAAATGGAGATTTTGATAGG - Intergenic
1047979679 8:130167396-130167418 TTCTACATGGGGCTTATGGTAGG + Intronic
1050026860 9:1343800-1343822 TTGCAGATGGGGCTTTTGGAAGG - Intergenic
1050807709 9:9702394-9702416 TTTCACAGTGGGCTTTTTCTGGG + Intronic
1051148507 9:14056012-14056034 TTTCACATTGATCTCTTGATTGG - Intergenic
1051352663 9:16213166-16213188 TTTCAGAAGGGGCTTTTATTGGG + Intronic
1052789840 9:32865055-32865077 TTTCAACTGGGGATTTTGGTAGG - Intergenic
1053609214 9:39694192-39694214 TAACACATAGGGCTTTTGAGAGG - Intergenic
1053867056 9:42450464-42450486 TAACACATAGGGCTTTTGAGAGG - Intergenic
1054089102 9:60777296-60777318 TAACACATAGGGCTTTTGAGAGG + Intergenic
1054244311 9:62648205-62648227 TAACACATAGGGCTTTTGAGAGG + Intergenic
1054558437 9:66682753-66682775 TAACACATAGGGCTTTTGAGAGG + Intergenic
1057484413 9:95471233-95471255 TTCCACAAAGGGCTTTGGATGGG + Intronic
1058382474 9:104392592-104392614 CTTCAGATGGTGCTCTTGATAGG - Intergenic
1058589960 9:106554720-106554742 ATTGACATTGGGATTTTGATAGG - Intergenic
1059249415 9:112875589-112875611 TTCCACATGGGGTTGTCGATAGG + Intronic
1059433873 9:114265136-114265158 CTCTACATGGGGCTTTTGATGGG + Intronic
1062046248 9:134425776-134425798 GTCCCCATGGGGCTTGTGATGGG - Intronic
1187300527 X:18044785-18044807 TGTCTCATGGGAATTTTGATTGG + Intergenic
1188960258 X:36482745-36482767 TTTCACATGGGTTTCTTGAATGG - Intergenic
1189371955 X:40435731-40435753 TTTCTCATGGACATTTTGATGGG + Intergenic
1189664490 X:43339516-43339538 TTTTATATGGGGCTTTTGCTCGG - Intergenic
1190502392 X:51092550-51092572 TTTGAGATGGGGCTTTTGGGAGG - Intergenic
1191155860 X:57271720-57271742 CTTCAGATGGGGCATTTGAGTGG - Intergenic
1192713376 X:73615511-73615533 CTTCAAATGGTGCTTGTGATTGG + Intronic
1192790646 X:74379196-74379218 TTTCACATGTGCATTCTGATTGG + Intergenic
1192807115 X:74520882-74520904 TTTCACAGGGGGCATTGCATTGG - Intronic
1193615900 X:83688077-83688099 GTTCACATGGGGTTTTTGTGTGG + Intergenic
1194203652 X:90984506-90984528 TTTCAAATGGGGTTTTTGTGTGG - Intergenic
1194866852 X:99079338-99079360 TTCCACATGTGTCTTTGGATGGG + Intergenic
1194881466 X:99256806-99256828 TATCACATTGTGGTTTTGATTGG + Intergenic
1195346019 X:103952085-103952107 TTTGAGATGGGGGTTTTGCTAGG + Intronic
1195355293 X:104033762-104033784 TATCACAAGAGGCTTTTGTTTGG - Intergenic
1195361582 X:104087440-104087462 TTTGAGATGGGGGTTTTGCTAGG - Intergenic
1196181488 X:112695860-112695882 TATCCCATTGGGATTTTGATAGG + Intergenic
1196281064 X:113824680-113824702 CTTCAGATGGGGTTTTTGAATGG + Intergenic
1196840269 X:119853017-119853039 TATCACAAGGGGCATTTGTTGGG - Intergenic
1197059973 X:122166035-122166057 TTTCACATGGGCTTTTTAATTGG + Intergenic
1198532281 X:137558700-137558722 TTTCACCAGGGGCTTTTCTTGGG + Intergenic
1200519499 Y:4193623-4193645 TTTCACATATGGCTTTTACTAGG + Intergenic
1200549485 Y:4559945-4559967 TTTCAAATGGGGTTTTTGTGTGG - Intergenic
1200937364 Y:8749865-8749887 TTTTTCATTGGGCTTTTGCTGGG - Intergenic