ID: 922627182

View in Genome Browser
Species Human (GRCh38)
Location 1:227060533-227060555
Sequence TTGTATGGGAACCTAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922627176_922627182 22 Left 922627176 1:227060488-227060510 CCAGCAACAATGTGACAAATGCT 0: 1
1: 0
2: 1
3: 13
4: 236
Right 922627182 1:227060533-227060555 TTGTATGGGAACCTAGAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922627182 Original CRISPR TTGTATGGGAACCTAGAGGA GGG Intronic
900272082 1:1796044-1796066 TTGTATGGGTACTTGGAGCATGG - Intronic
903142514 1:21347454-21347476 TTGTTTGGGAACCTGGAGGGCGG + Intergenic
905130985 1:35757164-35757186 TGCATTGGGAACCTAGAGGAAGG - Intronic
905310623 1:37046530-37046552 TTGTCAGGGAACCTGGAGGATGG - Intergenic
911565285 1:99456780-99456802 CTGTCTGGGAAACTAGAGCACGG - Intergenic
912447873 1:109751424-109751446 TTTGATGGGAACCTGGAGAAGGG - Intronic
917962817 1:180157923-180157945 TCTTATGGGAACCCAGGGGAGGG + Intronic
919301257 1:195769584-195769606 TAGTATTGGAATTTAGAGGAGGG - Intergenic
920625069 1:207588968-207588990 TTGTATTGTAAACCAGAGGAGGG + Intronic
920990947 1:210939089-210939111 ATTCATGGGAGCCTAGAGGAGGG - Intronic
922627182 1:227060533-227060555 TTGTATGGGAACCTAGAGGAGGG + Intronic
922627189 1:227060567-227060589 TTTCTTGGGGACCTAGAGGAGGG + Intronic
922995023 1:229949833-229949855 TTGTATGTGTAACTTGAGGAAGG - Intergenic
923236044 1:232034070-232034092 TTGTAAGGGATCCTACAGGCAGG + Intronic
923737311 1:236622806-236622828 TAGTATTGGAAACTGGAGGAAGG + Intergenic
924005036 1:239599840-239599862 TTGTATGGGTACTCAGAGTATGG + Intronic
1063286703 10:4696199-4696221 TAGCATGGGAAACAAGAGGATGG - Intergenic
1063556581 10:7086011-7086033 TTGTATGAGAACCTAGAAACTGG + Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067302445 10:45024412-45024434 GTGTATTGGAATCAAGAGGAAGG + Intergenic
1068653757 10:59553575-59553597 TTGTGTTGGAACAGAGAGGAGGG - Intergenic
1069021639 10:63494972-63494994 TTGTATGGAAGCTTATAGGAGGG - Intergenic
1072438859 10:95436653-95436675 TTTTCTGGTAACCAAGAGGAAGG - Intronic
1072792065 10:98325432-98325454 TTATATGGGTTCCTATAGGAAGG - Intergenic
1073366864 10:102950094-102950116 TGCTATGGGCACCCAGAGGAAGG + Intronic
1074320479 10:112397496-112397518 TTGGGTGGGCAGCTAGAGGACGG - Intronic
1074428208 10:113370672-113370694 TGGTGTTGGAACCTGGAGGATGG + Intergenic
1075434041 10:122418817-122418839 TTGTATGGGATCTTTGAGAAGGG + Intronic
1080320738 11:31006354-31006376 CTCTATGGGAATCTATAGGAAGG - Intronic
1084193521 11:67509880-67509902 ATGCATTGGAACTTAGAGGAAGG + Intergenic
1084901252 11:72311574-72311596 TACTATGGGAGCTTAGAGGAAGG + Intronic
1084905359 11:72341904-72341926 TTTGATGGGATCCTAGAGGTAGG + Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1088079338 11:105891686-105891708 TAGTTTGAGAACCCAGAGGAGGG - Intronic
1088564382 11:111152469-111152491 TGCTATGGGACTCTAGAGGAGGG + Intergenic
1090469720 11:126969402-126969424 TGCTATGGGAACTCAGAGGAGGG + Intronic
1091133483 11:133166526-133166548 TGTTATGGGAACACAGAGGAAGG + Intronic
1095188937 12:39233655-39233677 TTGTAGAGGAACCTGGTGGAAGG + Intergenic
1096537387 12:52283940-52283962 AGGAATGGGAACCTAGAGGGAGG + Intronic
1097341777 12:58446829-58446851 TAGTATAGGAACCCTGAGGAAGG - Intergenic
1099405761 12:82260288-82260310 TTGTATGGTAGCCCAGAGCATGG - Intronic
1100161160 12:91862536-91862558 TTTTTTGTGAACCTAAAGGAAGG - Intergenic
1100476074 12:94936477-94936499 TTTGATGGGAAACTAGAGGCTGG + Intronic
1102284114 12:111641338-111641360 TAGTTTGGGAACCTGGAAGAAGG + Intergenic
1102677388 12:114668000-114668022 TTCTTTGGAAACCCAGAGGAGGG + Intergenic
1107716092 13:43200813-43200835 CTGTATGGGAGCATAGAGAATGG + Intergenic
1107988727 13:45798488-45798510 TTGTAGGGGAACGTTCAGGATGG + Intronic
1108223889 13:48267517-48267539 TTCTATGGGGAGCTAAAGGAAGG - Exonic
1108503678 13:51090306-51090328 ACCCATGGGAACCTAGAGGATGG - Intergenic
1110939196 13:81328347-81328369 TGGTGGGGGAACTTAGAGGATGG - Intergenic
1111751113 13:92333368-92333390 TTTTATCAGAACCTAGGGGAAGG + Intronic
1116205392 14:41858907-41858929 TTGTATGGGAACCATTTGGAAGG - Intronic
1116615028 14:47124732-47124754 ATGTTTGGGACACTAGAGGAAGG + Intronic
1117525379 14:56597025-56597047 TTGGATGAGAACCTAGAGAAGGG + Intronic
1120242925 14:81971066-81971088 GTTTATGGGTCCCTAGAGGAAGG + Intergenic
1120603824 14:86546511-86546533 TTGGATGGGAAAATAGATGAAGG + Intergenic
1121259616 14:92556521-92556543 TTGCATGGGAAGATAGATGATGG + Intronic
1122207754 14:100156678-100156700 ATGGAGGGGAACCCAGAGGAGGG + Intronic
1125804042 15:42477440-42477462 TAATATGGGAAACTAGAGGTGGG - Intronic
1128340860 15:66821690-66821712 GTGTCTGGGAACCTCAAGGAGGG + Intergenic
1132023370 15:98383911-98383933 TGGTCTGGGAACTAAGAGGAAGG - Intergenic
1132777661 16:1604708-1604730 GGGGATGGGAACCTGGAGGAGGG + Intronic
1133497413 16:6332228-6332250 TTGTATGGCAACGTAGAAGGCGG + Intronic
1137366536 16:47864384-47864406 TTGTATTGGAAAGGAGAGGAAGG + Intergenic
1140143006 16:72277324-72277346 TTGAATGATAACCTAGATGATGG + Intergenic
1141184870 16:81779690-81779712 TTGAATGGGGACCGGGAGGAAGG + Intronic
1142543947 17:685406-685428 TTGTATGGGTACCCAAAGTATGG - Intronic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1144167335 17:12625375-12625397 TAGTATGGGAGGCCAGAGGATGG - Intergenic
1147056925 17:37841897-37841919 GTGTATCGGAAACTCGAGGAAGG - Intergenic
1149892075 17:60399032-60399054 TGTTATGGGAACCTAGAGTAGGG + Intronic
1151157693 17:72138104-72138126 TTGTTTGGGAACCAACAGCATGG + Intergenic
1203167358 17_GL000205v2_random:110129-110151 TTGTATGGGGAGCAAGAGGGAGG - Intergenic
1155645568 18:28073299-28073321 TTGTATGGGAACCTTGACAATGG - Intronic
1157345144 18:46822730-46822752 TTATATGAGAAACTGGAGGAAGG + Intronic
1158416778 18:57255803-57255825 TTGTATGGCAACCTCCAGGAAGG + Intergenic
1160064363 18:75561411-75561433 TTGTATCAAGACCTAGAGGAGGG - Intergenic
1161110080 19:2464290-2464312 TTGTATGGCATGCTAGAGGATGG + Intergenic
1164839396 19:31381080-31381102 GTGGATGGGGGCCTAGAGGAAGG - Intergenic
1166921185 19:46230174-46230196 GTGTTTGGGAAGCTGGAGGAGGG + Intronic
927558455 2:24051790-24051812 CTCTATGGGATCCTGGAGGAGGG - Intronic
929892159 2:45927286-45927308 TGGTATTGGAACCTAGAGAAGGG + Intronic
936912151 2:117604274-117604296 ATGTATGGGAAGCCAGCGGATGG + Intergenic
937430368 2:121832863-121832885 TTCTATGGGATCCAGGAGGAGGG + Intergenic
939983764 2:148811126-148811148 TAGTCAGGGAACCCAGAGGATGG - Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
946101368 2:217327506-217327528 TACTATGGGAACATAGAAGAGGG + Intronic
948369549 2:237479886-237479908 TTGTAAGGGTGCCAAGAGGAAGG - Intergenic
1172560097 20:35880226-35880248 TTGCACGGGAACCTGAAGGATGG + Intronic
1174774570 20:53332005-53332027 GTGAATGGGACCCCAGAGGAGGG - Intronic
1175038849 20:56026591-56026613 GTGTGTTAGAACCTAGAGGATGG + Intergenic
1176404401 21:6349006-6349028 TTGTATGGGGAGCAAGAGGGAGG + Intergenic
1176432756 21:6640098-6640120 TTGTATGGGGAGCAAGAGGGAGG - Intergenic
1176756244 21:10727793-10727815 TTGAATGGAAACCTAGAGATTGG - Intergenic
1178128199 21:29539455-29539477 TTGTATGGGCACTTAAAGTATGG + Intronic
1178357778 21:31923039-31923061 GTGTAGGGGAACAGAGAGGAAGG + Intronic
1180021108 21:45127674-45127696 CTGAGTGGGAACCTGGAGGAAGG - Intronic
1181159957 22:20953975-20953997 TTGTATGGGAGCCTAGTGCTTGG + Intergenic
1181803068 22:25359724-25359746 TTGCATCAGAACCTGGAGGAAGG - Intronic
1182124995 22:27809897-27809919 ATGGACGGGAACCTAGAGGCAGG + Intergenic
1184610408 22:45599602-45599624 TTTTAAGGGAGCCTAGAAGAGGG - Intronic
1184970713 22:48018004-48018026 TTCTTAGGGAACCAAGAGGAAGG - Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
949926066 3:9042829-9042851 CGGTTTGGGAACCCAGAGGAGGG - Intronic
950103423 3:10372829-10372851 TTGTTTGAGAGCCTAGAAGAAGG - Intronic
953310239 3:41870582-41870604 CATTATGGGAAACTAGAGGAAGG - Intronic
953641533 3:44712547-44712569 CTCTATGGGACCCTAGAAGAAGG - Intergenic
953709800 3:45260422-45260444 AGCTATGGGAGCCTAGAGGAAGG - Intergenic
955203719 3:56876253-56876275 CAGTCTGGGAACCTAGAGGCAGG + Intronic
955562746 3:60209949-60209971 TGGGGAGGGAACCTAGAGGATGG + Intronic
956610903 3:71121854-71121876 TACTTTGGGAACCTGGAGGATGG - Intronic
959738106 3:109684654-109684676 TTGTATGGGTACTTAAAGTATGG + Intergenic
960800111 3:121530207-121530229 TTGTATGGGCACCCAAAGTATGG - Intronic
961356453 3:126342996-126343018 TTGTCTGGGAAACCGGAGGAGGG + Exonic
961701542 3:128748522-128748544 GTGTATAGGAAACTGGAGGAAGG - Intronic
962461896 3:135621818-135621840 ATGTGTGGGAGCTTAGAGGAGGG - Intergenic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
967391658 3:188962051-188962073 TGGTAAGGGAACACAGAGGAAGG + Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
971308706 4:25505820-25505842 TTCTGTGGGGACCCAGAGGAAGG - Intergenic
971443952 4:26721978-26722000 TACTATGGGAGTCTAGAGGAAGG - Intronic
972035491 4:34514483-34514505 TACCATGGGAACTTAGAGGAAGG - Intergenic
972599511 4:40559670-40559692 TTGGGTGGGACCTTAGAGGATGG - Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
974874712 4:67689053-67689075 TTGTATGGGTACCCAAAGTATGG - Intronic
975594889 4:76040660-76040682 TTGTGTATGACCCTAGAGGAGGG + Intronic
976476566 4:85490647-85490669 TTGTTTGGGAGCTTTGAGGAAGG + Intronic
976869536 4:89774359-89774381 TGCTATGGGAACCAAGAGGAAGG + Intronic
978468080 4:109030619-109030641 CTGTATGGGAACTTTGAGGTAGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
984196071 4:176659708-176659730 TGTTATTGGAAGCTAGAGGAAGG - Intergenic
986638587 5:9849592-9849614 AAGTCTGGGAACCCAGAGGAGGG - Intergenic
989182722 5:38594828-38594850 CTCTGTGGAAACCTAGAGGAAGG - Intronic
990893308 5:60671266-60671288 TTGAGTGGAAACCTAGAAGATGG - Intronic
991398515 5:66229466-66229488 TTGTATGGGTACCCAAAGTATGG - Intergenic
991510125 5:67366732-67366754 TGATATGGAAACCTAAAGGAGGG - Intergenic
992533053 5:77670911-77670933 TCCTATGGGAGCCCAGAGGAAGG - Intergenic
996860750 5:128063058-128063080 TGGTTTGGGAAGCTAGAGGTGGG + Intergenic
998349329 5:141490759-141490781 GTGTATGTCAACCCAGAGGATGG + Exonic
999233395 5:150076206-150076228 TTGGGTGGGAACCTGGAGGCTGG - Intronic
999320921 5:150614553-150614575 TTGTATGGCAAGCCAGAGGTAGG - Intronic
1001102817 5:168828240-168828262 TGGAATCGGAACCTAGGGGAAGG + Intronic
1005069247 6:21849343-21849365 TAGTAGAGGAACGTAGAGGAGGG + Intergenic
1005385795 6:25283008-25283030 AGGTATGGGAGCATAGAGGAGGG + Intronic
1006745095 6:36336121-36336143 TTGGATGGGAATGTAGAGGCTGG - Intronic
1008659814 6:53655154-53655176 TTGAATGGGCTCCTAGAGGGAGG - Exonic
1012546727 6:100427763-100427785 TGGTATAGGAACTCAGAGGAAGG - Intronic
1016273901 6:142325291-142325313 TCCTATGGGAACCCGGAGGAAGG - Intronic
1018465916 6:164044847-164044869 CTGTATGGGAACAAAAAGGAAGG + Intergenic
1020556656 7:9679005-9679027 TTGTATGTGCAACTATAGGAAGG + Intergenic
1022659744 7:32355619-32355641 TGCTAAGGGAACTTAGAGGAGGG - Intergenic
1024368163 7:48547679-48547701 TTGTATGGGTACCCAAAGTATGG - Intronic
1024743188 7:52377257-52377279 TGGTTTGGGAACCAAGAGGGTGG + Intergenic
1024841517 7:53592507-53592529 TGGTATGAGAACATACAGGAGGG - Intergenic
1024857725 7:53801047-53801069 TTGTCTGGGAACCAAGAACACGG + Intergenic
1026911710 7:74094966-74094988 TTGTCTGGGAGCCTAGGGGAAGG - Intronic
1028255359 7:88589402-88589424 TTTTAAGGGAGCATAGAGGAAGG - Intergenic
1030595866 7:111538058-111538080 TTTTATGGGAACACATAGGAAGG - Intronic
1033500456 7:141943846-141943868 GTGCATGAGAACCTAGGGGATGG + Intronic
1034083178 7:148299376-148299398 TTGCATCAGAAACTAGAGGAGGG + Intronic
1034090871 7:148362907-148362929 TTGTATGGGTACTCAAAGGACGG - Intronic
1034362845 7:150515837-150515859 TTATAAGGGAACCGTGAGGAGGG - Intronic
1034596052 7:152193237-152193259 AGGTATGGGAATCTATAGGAAGG - Intronic
1034719058 7:153271334-153271356 TGGGATGGGAACCTACAGAATGG + Intergenic
1036450873 8:8866260-8866282 CTGAATGGGAACCTAGAACAGGG + Intronic
1036956472 8:13193059-13193081 TTGGATAGGAACAGAGAGGAGGG - Intronic
1037139630 8:15504509-15504531 CTGTTTGGCAACCTAAAGGAAGG - Intronic
1038884268 8:31646306-31646328 GTCCAAGGGAACCTAGAGGAGGG + Intronic
1039014315 8:33129178-33129200 TGTTCTGGGAACCCAGAGGAGGG - Intergenic
1040039245 8:42898996-42899018 TTGTATGGGCACTCAGAGTATGG + Intronic
1041782792 8:61596111-61596133 TTGTCTGGGAACCTGGAGATTGG + Intronic
1042744497 8:72092550-72092572 TTCTTTGGGAACCTTGATGATGG + Intronic
1043150560 8:76709687-76709709 TTTTGTGGGAACCTAAAGGAAGG + Intronic
1043255252 8:78128105-78128127 CTGTATGGGATCCTCCAGGAAGG - Intergenic
1043912445 8:85878586-85878608 TATTATGGGAACCCAGAGGAGGG - Intergenic
1044534730 8:93345682-93345704 GTTTATGGGAGCATAGAGGAGGG - Intergenic
1044757689 8:95482057-95482079 TAGTATATGAACCTAGAAGAAGG - Intergenic
1045060418 8:98406057-98406079 TACAATGGGAACATAGAGGAGGG - Intronic
1045949997 8:107840730-107840752 TTGTGTGGGCACATAGTGGAGGG - Intergenic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1048478297 8:134763303-134763325 TTGTAGGGGAACCGAGTGAAAGG - Intergenic
1049250788 8:141588002-141588024 GTGTATGGAAAGCCAGAGGAGGG + Intergenic
1049688416 8:143948493-143948515 TGGGATGGGAAGCTAGGGGAAGG - Intronic
1055040374 9:71864544-71864566 ATATATGGAAGCCTAGAGGAAGG - Intronic
1058027599 9:100159214-100159236 TGGTATGGAAAGATAGAGGAAGG + Intronic
1062712177 9:137981848-137981870 TTTCATAGGAAACTAGAGGAAGG - Intronic
1203438780 Un_GL000195v1:168572-168594 TTGTATGGGGAGCAAGAGGGAGG + Intergenic
1186348782 X:8722019-8722041 TTGTATGAGATCTCAGAGGAGGG - Intronic
1186798184 X:13066785-13066807 TACTATGAGAGCCTAGAGGAGGG - Intergenic
1186964769 X:14775318-14775340 TTGTATTGAAAGATAGAGGAAGG - Intergenic
1187510222 X:19910892-19910914 TATTCTGGGAACCCAGAGGAGGG + Intergenic
1187939915 X:24371582-24371604 TTGTATGTGAACCTGGAGTCTGG - Intergenic
1195713514 X:107795488-107795510 TTGTATGGGTACCTGAAGCATGG - Intergenic
1195738092 X:108033994-108034016 TTGTCTGGCAACTCAGAGGAAGG + Intergenic
1196242570 X:113360505-113360527 TGGGGAGGGAACCTAGAGGATGG - Intergenic
1197243067 X:124140222-124140244 GTTTATGGGAACCTTGAGTAAGG - Intronic
1197528437 X:127592148-127592170 TTTTATGGGAATTCAGAGGAGGG - Intergenic
1197766370 X:130061701-130061723 TGCTGTGGGAACCCAGAGGAGGG + Intergenic
1198799643 X:140435540-140435562 TTTTAGGGGAACCCAGAGGATGG + Intergenic
1198890304 X:141387351-141387373 TTCTATAGGAAGGTAGAGGAAGG - Intergenic
1198981588 X:142403645-142403667 TGCTATGGGAACCCAAAGGATGG - Intergenic
1202015132 Y:20398198-20398220 TGGCATGAGAACCTAGAGCAAGG - Intergenic