ID: 922633420

View in Genome Browser
Species Human (GRCh38)
Location 1:227138499-227138521
Sequence TTCTGGGGCACTTTATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922633420_922633425 11 Left 922633420 1:227138499-227138521 CCAGGAGATAAAGTGCCCCAGAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 922633425 1:227138533-227138555 AAAAAGAGAGCGTTATCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 182
922633420_922633428 29 Left 922633420 1:227138499-227138521 CCAGGAGATAAAGTGCCCCAGAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 922633428 1:227138551-227138573 GAAGGAATAAAAGGTCCATAGGG 0: 1
1: 0
2: 3
3: 16
4: 239
922633420_922633427 28 Left 922633420 1:227138499-227138521 CCAGGAGATAAAGTGCCCCAGAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 922633427 1:227138550-227138572 AGAAGGAATAAAAGGTCCATAGG 0: 1
1: 0
2: 1
3: 18
4: 294
922633420_922633426 20 Left 922633420 1:227138499-227138521 CCAGGAGATAAAGTGCCCCAGAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 922633426 1:227138542-227138564 GCGTTATCAGAAGGAATAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922633420 Original CRISPR TTCTGGGGCACTTTATCTCC TGG (reversed) Intronic
902866731 1:19284809-19284831 TTCTGGGGCACTCTAGGCCCCGG - Intronic
903221283 1:21870948-21870970 TTCTGGGGTTCGCTATCTCCTGG - Intronic
907468205 1:54653489-54653511 TTCTGGGCCACTGCATCTCTAGG + Exonic
907919525 1:58899482-58899504 TTACAGAGCACTTTATCTCCTGG + Intergenic
912726233 1:112061137-112061159 ATGTTGGGCACTGTATCTCCTGG + Intergenic
915149507 1:153818775-153818797 TTCTAGGGCACATTACCTTCTGG + Exonic
917168768 1:172145247-172145269 TCCTGTGGCACTTTATTTTCTGG + Intronic
920042993 1:203116097-203116119 TTGGGGGGCTCCTTATCTCCTGG - Intronic
921658503 1:217769783-217769805 TTCTGGGGTACTATATCTGAGGG + Intronic
922204053 1:223431238-223431260 TTCTGGGGCATTTGGACTCCAGG + Intergenic
922633420 1:227138499-227138521 TTCTGGGGCACTTTATCTCCTGG - Intronic
924269311 1:242316356-242316378 TACTGGAGCACATTCTCTCCTGG + Intronic
1065133785 10:22648610-22648632 TTCTTATGCAGTTTATCTCCAGG + Intronic
1066654110 10:37683281-37683303 TTCAGGGGCACATATTCTCCTGG - Intergenic
1066715589 10:38282411-38282433 TACTGGAGCACATTCTCTCCTGG - Intergenic
1070275254 10:74999780-74999802 CTCTGGGGCACTGAATCTCTGGG - Intronic
1072294447 10:93995419-93995441 TTCTGCAGCATTTTTTCTCCAGG + Intronic
1078780664 11:14436066-14436088 TTCTTGGGAATTTCATCTCCAGG - Intergenic
1081611182 11:44564605-44564627 TTTTGGGCCACTTTTTCTTCAGG + Intronic
1084326531 11:68403556-68403578 TGCTGGGGGACTTCATCTACTGG + Exonic
1084428062 11:69096375-69096397 TTCTGGAGCCCTTTACCTGCAGG + Intergenic
1086025454 11:82284879-82284901 TTCTGGGGTACCTAATCTGCAGG + Intergenic
1088411563 11:109539846-109539868 TTCCAGGGCACTTTATCTCATGG + Intergenic
1089252917 11:117178383-117178405 CCCTGGGCCACTTTTTCTCCGGG - Intergenic
1089538335 11:119174154-119174176 TCCTGGGTTACTTTAACTCCTGG + Intronic
1090383604 11:126343858-126343880 TTCTGGGATACTTTCTCTCTGGG + Intronic
1090767718 11:129891364-129891386 TTCTGGCGGTCTTTATCTGCAGG - Intronic
1092026446 12:5244867-5244889 TTGTGGAGCACTTTGTCTCTGGG - Intergenic
1097261124 12:57720787-57720809 TTCTGGGCCTCTTCAGCTCCCGG - Exonic
1101765283 12:107692442-107692464 TTCAGGGTCATTTTATTTCCAGG + Intronic
1103127316 12:118435224-118435246 CTCTTGGGAACGTTATCTCCTGG + Intergenic
1104746645 12:131215107-131215129 TTCTGGGCCAGTTTGTCTCTGGG - Intergenic
1104785914 12:131447807-131447829 TTCTGGGCCAGTTTGTCTCTGGG + Intergenic
1105014421 12:132777448-132777470 TGCTGGGGCGCTTTCTCTCTTGG + Intronic
1107403985 13:40095880-40095902 TTCTGTGGCACTTTGTCTGCAGG + Intergenic
1107420347 13:40240179-40240201 ATCTGGGGCACTGGAGCTCCAGG - Intergenic
1113183386 13:107658020-107658042 TTTGGAGGCACTTTGTCTCCTGG + Intronic
1115131797 14:30062741-30062763 TTCTGCTGCATTTGATCTCCTGG + Intronic
1116069754 14:40028762-40028784 ATCTGGGTCACTTTATATCTAGG + Intergenic
1118151970 14:63199481-63199503 TTCTGGGGCACTTAACCTGAAGG + Intergenic
1127517454 15:59710108-59710130 TTCTTGGGCACTTTAGTCCCTGG + Intergenic
1129067136 15:72914707-72914729 TTCTTGGGCACTCTTTGTCCTGG + Intergenic
1131506423 15:93024042-93024064 TTCTGTGGCTCTTTTTCTCATGG + Intronic
1132619292 16:856749-856771 TTCTCGGGTACTTTGTCTGCAGG - Intronic
1136282891 16:29224288-29224310 TTCTGGGCAACTTTTTTTCCTGG + Intergenic
1139353277 16:66351219-66351241 TGCTGGGACCCTTTATCTCCTGG - Intergenic
1140526203 16:75624941-75624963 TTCTAGGGTTCTTTATCTCAGGG + Intergenic
1141661595 16:85444527-85444549 TTCTGGGGCATTCTGTTTCCTGG + Intergenic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142087269 16:88190184-88190206 TTCTGGGCAACTTTTTTTCCTGG + Intergenic
1152375942 17:79919093-79919115 TTCAGGGGCCCTTGAACTCCAGG - Intergenic
1154000030 18:10474815-10474837 TTGTGGGGCATTTTCCCTCCAGG - Intronic
1155454644 18:25998140-25998162 TTCTGGACCACCTTGTCTCCTGG - Intergenic
1156385950 18:36605402-36605424 TTCTGTGGCATTTGATGTCCAGG + Intronic
1166934934 19:46326045-46326067 TTCAGGAGCACCTTATCTGCTGG + Intronic
1168357839 19:55713547-55713569 GCCAGGGGCACTTTCTCTCCTGG - Intronic
1168641125 19:58032434-58032456 TCCTGGGACTCTTAATCTCCAGG + Intergenic
927318515 2:21715391-21715413 TTCTGAGGAACTTTAAATCCAGG - Intergenic
927481482 2:23457441-23457463 TTCTGGGGCCCTTCCCCTCCAGG + Intronic
929986748 2:46741698-46741720 TTCTGGGGCATTTAATATTCTGG - Intronic
933038837 2:77434632-77434654 TTATGGAGAACTTTCTCTCCAGG + Intronic
937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG + Intergenic
937853930 2:126659303-126659325 TTCTGGGGCACGTTTCCTCACGG - Intronic
947285265 2:228507159-228507181 TTCAGGGGCCCTTTATTTGCTGG + Intergenic
947859393 2:233348121-233348143 TTCTGGGACTCTCCATCTCCAGG - Intergenic
948666761 2:239539708-239539730 CTCTGTGGCACTTTACCCCCTGG + Intergenic
1172656900 20:36543045-36543067 TTCTCGGGAACTTTGACTCCTGG - Intronic
1172746051 20:37209965-37209987 TTCTGGGGTGCTTTATCTATAGG - Intronic
1174276424 20:49407813-49407835 TTCTGGGCCACTCTGGCTCCTGG + Intronic
1175383235 20:58577796-58577818 TTCTGGGCCTCTTTCTCTCCTGG - Intergenic
1178165322 21:29968152-29968174 CTCTGGGGCACTTTTTCATCAGG + Intergenic
1181802155 22:25354717-25354739 TGCTGGGGGACTTCATCTACTGG - Exonic
1184990043 22:48161357-48161379 TTCTGTGGCTCTTTATCTCTGGG - Intergenic
952012822 3:28920396-28920418 TTGGGTGGCAGTTTATCTCCTGG - Intergenic
952029888 3:29128978-29129000 TTTTGGGGGAGGTTATCTCCAGG + Intergenic
960479995 3:118176255-118176277 TTCTGGTTCAATTTATCTACTGG - Intergenic
960639018 3:119809751-119809773 TTCAGGGACACTTCCTCTCCAGG - Intronic
962088779 3:132220878-132220900 TTTTGGTGCAGTTTATCTCCTGG - Intronic
966483876 3:180446153-180446175 TTTTGAAGCACTTTATCTCTAGG - Intergenic
969323379 4:6426467-6426489 GTCTGGGGCTCTGTCTCTCCTGG - Intronic
972811998 4:42599757-42599779 TCTTAGGGCACTTTATTTCCTGG - Intronic
977566849 4:98589294-98589316 TTATGGGTCAATTAATCTCCTGG + Intronic
985200316 4:187477935-187477957 TGCTGGGGAATTTTATATCCAGG - Intergenic
986129245 5:4911763-4911785 TTCTGGCTCATTTTCTCTCCTGG - Intergenic
987688477 5:21235647-21235669 TTCTTGTTCATTTTATCTCCAGG - Intergenic
988047338 5:25973362-25973384 TTCTGGCTCTCTTTTTCTCCTGG + Intergenic
991118466 5:62982377-62982399 TTCTGGCTCCCTTTTTCTCCTGG + Intergenic
992745358 5:79815366-79815388 ATCTGGGGCAGTTTATCTGCTGG - Intergenic
993921712 5:93813250-93813272 TTCTTTGCCACTTTATCTCAAGG - Intronic
997285326 5:132673839-132673861 TTGTGAGGCATTTTTTCTCCTGG + Intergenic
998007803 5:138668660-138668682 TTCTGGGACACCTTATCTCAGGG + Intronic
1001685985 5:173595490-173595512 ATTTGGGGCTATTTATCTCCCGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003715058 6:8636860-8636882 TTCTGGAGCAATTAATTTCCTGG + Intergenic
1006797912 6:36742820-36742842 TTCTGGGGCACGTGCCCTCCTGG + Intronic
1007601695 6:43086118-43086140 TTCAGGGCCACTGTCTCTCCTGG + Intronic
1007745993 6:44043219-44043241 CTCTGTGGCACTTTGTCTCCTGG - Intergenic
1008664597 6:53703683-53703705 TTCTGGGGACATTTACCTCCCGG + Intergenic
1012433522 6:99190873-99190895 TTCAGGGGCACTAGATGTCCTGG + Intergenic
1013191073 6:107804461-107804483 TTCTGGCCCACATTCTCTCCTGG - Intronic
1013214338 6:108014003-108014025 TTCTGAGGCACTCTATCTGCAGG - Intergenic
1015428416 6:133100464-133100486 TTCTGGGGGACTTGATCTATTGG + Intergenic
1016244141 6:141962984-141963006 TTCAGCAGCACTTTATCTCTTGG - Intergenic
1016914549 6:149232842-149232864 CTCTGGGGCACTTTCTCTGGAGG - Intronic
1019406017 7:884477-884499 TGCGGGGGCACTTTCTCTCTTGG + Intronic
1022031252 7:26493455-26493477 CTCTGGGGCACTTTAGGTACAGG + Intergenic
1023858602 7:44201982-44202004 TTCTGGGGCGCTTTAATTGCTGG + Intronic
1028749434 7:94366082-94366104 TTCTGGGGCAGTTTCTCAACTGG + Intergenic
1029505888 7:100963909-100963931 TTCTGGGGCCATTTATCTGGAGG + Intronic
1030758947 7:113326277-113326299 TCCAGGGGCAATTCATCTCCAGG + Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1037499543 8:19471832-19471854 TTCTGGGGCTGTTGATCACCTGG - Intronic
1038252097 8:25914411-25914433 ATCCAGGGCACTTCATCTCCAGG - Intronic
1041346848 8:56908026-56908048 CTCTGGGCCACTTTATATTCTGG + Intergenic
1044717081 8:95110309-95110331 TTGTGGAGCTCTTTATCTACAGG + Intronic
1045268354 8:100640655-100640677 TAGTGCGGCACTTTATCTCTGGG + Intronic
1047886355 8:129254245-129254267 TCCTGGGGCAGTGCATCTCCAGG - Intergenic
1048191203 8:132290957-132290979 TTCCATGGCACTGTATCTCCTGG - Intronic
1048451451 8:134537410-134537432 ATCTGGGCCACCTTATGTCCAGG - Intronic
1049858497 8:144880443-144880465 TTCTGGGGCACAGGATCTGCAGG + Exonic
1053170675 9:35878967-35878989 TTCTAGGGCTCTTTATTGCCTGG + Intergenic
1057531870 9:95856051-95856073 CTCTGGCCCAGTTTATCTCCTGG + Intergenic
1059528598 9:115015597-115015619 TTCAGGGGCCCATTAACTCCTGG - Intergenic
1060196902 9:121629635-121629657 GTCTGGGGCACTCTGGCTCCAGG + Intronic
1060522039 9:124299475-124299497 TCCTGGGGCTCTTTATACCCTGG + Intronic
1060561485 9:124548646-124548668 TCCTGGGGCACTTTTTACCCTGG + Intronic
1060876511 9:127087727-127087749 TTTTGTGGCACTTGTTCTCCAGG + Exonic
1185839068 X:3371780-3371802 TTCTGGGGCCCTTTTTCTAAGGG - Intergenic
1186485639 X:9932498-9932520 GTCTGTGGCCCTGTATCTCCTGG - Exonic
1192110467 X:68358750-68358772 TTCTTGGCCACTTTATTTGCTGG + Intronic
1193729321 X:85083129-85083151 GTCTGGTGCCCTTTATCTTCTGG + Intronic
1202018112 Y:20433899-20433921 TTCTGGGGCACTGTGGTTCCTGG - Intergenic