ID: 922634354

View in Genome Browser
Species Human (GRCh38)
Location 1:227151083-227151105
Sequence TAGAGAAGGATGGTGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922634354_922634360 -6 Left 922634354 1:227151083-227151105 CCAGTCCCCACCATCCTTCTCTA 0: 1
1: 0
2: 6
3: 47
4: 513
Right 922634360 1:227151100-227151122 TCTCTAAAATTTTTTCATCTTGG 0: 1
1: 3
2: 6
3: 63
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922634354 Original CRISPR TAGAGAAGGATGGTGGGGAC TGG (reversed) Intronic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900332028 1:2140054-2140076 TAGAGAGTGAGGGTGGGGAAGGG + Intronic
900373405 1:2342527-2342549 TAGAGACGCAGGGTGGGGCCTGG + Intronic
900492548 1:2959552-2959574 TTGAGAAGGATGCTGGGTTCCGG + Intergenic
900708204 1:4093939-4093961 CAGAGAAGGAAGGTGGGTGCTGG - Intergenic
901155867 1:7137809-7137831 GAGAGAAGGGATGTGGGGACAGG - Intronic
901580950 1:10242909-10242931 TTGAGAAGGATGGCAGGGAAAGG + Intronic
902922105 1:19672213-19672235 GAGAGAAGGATGGATGGGAGTGG - Intronic
903291406 1:22316488-22316510 TACAGAAGGCTGGTGGTGGCGGG - Intergenic
903367705 1:22815247-22815269 TAGAGATGGAAGGTGGGGGGTGG + Intronic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
904022185 1:27475523-27475545 TAGATAAGGATGGTCAGGAAAGG - Intronic
904486277 1:30826313-30826335 TAGAGGAGGATGGAGAGGGCTGG + Intergenic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
905841526 1:41184004-41184026 TAGAGATTGATGGTGGTGATGGG + Intronic
905908577 1:41638451-41638473 AAGAGATGGATGGTGGTGATGGG + Intronic
905941580 1:41867480-41867502 TAGAGAGGGAAGGTGGGGAGGGG - Intronic
905942895 1:41878535-41878557 TATAGATTGATGGTGGGGAGAGG + Intronic
906310142 1:44748103-44748125 TAGAGAGGGATGGCTGGGGCTGG + Intronic
906573309 1:46863186-46863208 TAAAGAAGCATGGTGAGGCCGGG + Intergenic
906651389 1:47515496-47515518 AAGGGAAGGATGGTGGGAAATGG + Intergenic
906662140 1:47590580-47590602 TAGAGAGGGAGGCTGGGGTCAGG + Intergenic
906703500 1:47877074-47877096 TAGGGAATAATGATGGGGACAGG + Intronic
907409128 1:54272527-54272549 CTGAGAAGGTAGGTGGGGACAGG + Intronic
908424625 1:63994560-63994582 TGGAGAAGGCTTGTGGGGAAAGG + Intronic
908827528 1:68148066-68148088 TAGAAAATGATCTTGGGGACTGG + Intronic
909606238 1:77511408-77511430 TAAAGAAGGATGGAGGGCAAAGG + Intronic
909852467 1:80485891-80485913 TAGAGAGGGAAGGTTGAGACAGG + Intergenic
910216818 1:84851779-84851801 TAGAAAAGGAGGCTGGGAACAGG + Intronic
910501506 1:87896856-87896878 TAACGAATGATGGTGGGGATTGG + Intergenic
912478254 1:109956899-109956921 AAGTGAAGGATGGTGGGAATGGG + Intergenic
913222802 1:116672598-116672620 TAAAGACAGATGGTGGGGGCTGG - Intergenic
913533625 1:119750712-119750734 CAGAGAGAGAAGGTGGGGACAGG - Intronic
915162281 1:153929149-153929171 TGGAGAAGGTTGGTGGGGGAAGG + Intergenic
915274573 1:154779373-154779395 TGGAGTGGGAAGGTGGGGACGGG - Intronic
915310989 1:155005705-155005727 TGGGGGAGGAAGGTGGGGACAGG + Intronic
915994550 1:160550050-160550072 CAGGGAAGGATGGTGGGTAGAGG - Intronic
916068326 1:161154270-161154292 TAAGGAGGGATGGTGGGGAGAGG + Intronic
916160561 1:161908529-161908551 TAGAGAAACATGGAGGGGAGGGG - Intronic
916466141 1:165076344-165076366 TAGAGGAGGATAGTGGAGGCAGG + Intergenic
916572930 1:166042772-166042794 TAAAGAAGAATGGAGGGGTCTGG - Intergenic
917209038 1:172612733-172612755 TAGAGAAAGATGGGTGGTACTGG - Intergenic
917634170 1:176918894-176918916 TGGAGAAGGCTGGTGGGGTTGGG - Intronic
919857472 1:201715547-201715569 TAGAGAATGAGGCTGGGGGCAGG + Intronic
920214358 1:204351352-204351374 TAGAGAAGGTGGGAGGGGTCGGG - Intronic
920587216 1:207178005-207178027 TAGAAAAACATGGTGGGGAGTGG - Intergenic
921808011 1:219478095-219478117 TGGAGAATGAGGGTGGGGAGGGG + Intergenic
921835508 1:219774158-219774180 TAGAGAAGAGTGCTGGGGAAAGG + Intronic
921979719 1:221242686-221242708 TGGAGATGGATGGTGGCGATAGG - Intergenic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
922867604 1:228873534-228873556 GAGAGAAAGATGGAGGGGAATGG - Intergenic
923160074 1:231307854-231307876 TAGATAAGGCTGGTGGGGTTAGG - Intergenic
924091686 1:240507778-240507800 CAGAGAAGGAGGGTGGGGGTGGG + Intronic
924902660 1:248418192-248418214 CACAGGATGATGGTGGGGACAGG - Intergenic
1063107834 10:3009047-3009069 AAGGGAAGGCTTGTGGGGACGGG + Intergenic
1063507015 10:6608692-6608714 TGGAGACGGATGGTGGTGAGTGG + Intergenic
1063571404 10:7217233-7217255 TGGAGATGGATGGTGGTGATGGG + Intronic
1063592990 10:7410329-7410351 GAGAAAAAGATGGTGAGGACGGG - Intronic
1064667999 10:17677249-17677271 TTGGAAAGGATGGTGGGGAAAGG - Intronic
1065009526 10:21409019-21409041 TACAGAAGGATGATTGGGGCTGG - Intergenic
1065214006 10:23432347-23432369 TATAGAAGGAGGGTGGGGTGTGG + Intergenic
1065916755 10:30359548-30359570 AAAGGAAGGATGGTGGGGGCTGG - Intronic
1066502431 10:36007097-36007119 GAGAGAATGAGGGTGGGGAAAGG - Intergenic
1067056947 10:43058053-43058075 TGGAGAAGGAGGGAGGGGCCTGG - Intergenic
1067274249 10:44820188-44820210 TAGAGAAGGGTGGTGGAGTGGGG - Intergenic
1067682205 10:48448303-48448325 TAGAGCAGCATGGAGGGGAGCGG - Intronic
1067929848 10:50549538-50549560 CAGAGAGGGATGGTGGGGGAGGG + Intronic
1068897212 10:62219163-62219185 TAGAAATGGATGATGGAGACAGG + Intronic
1070508511 10:77138566-77138588 TGGAGAATGCTGGTGGGGCCTGG - Intronic
1072111337 10:92323024-92323046 TAAAGAAGGTGGCTGGGGACCGG - Intronic
1072435894 10:95414577-95414599 GTGAGAAGGATGGTGGCGTCTGG + Exonic
1072735941 10:97879841-97879863 AAGAGAAAGGGGGTGGGGACGGG + Intronic
1074122059 10:110499884-110499906 TAGAGAAGCATGGGGAGGAGAGG - Intronic
1075098972 10:119492643-119492665 TAGTGATGGATGGTGGGCTCTGG + Intergenic
1075193878 10:120337567-120337589 TGGGGAAGGATGTTGGGGACAGG + Intergenic
1075619243 10:123913801-123913823 GAAAGAAAGATGGTGTGGACTGG + Intronic
1076079394 10:127565128-127565150 TCGAGATGAATGCTGGGGACAGG - Intergenic
1077209994 11:1365998-1366020 GAGATAATGATGGTGGTGACAGG + Intergenic
1077280462 11:1742710-1742732 TGCATAAGGTTGGTGGGGACAGG + Intronic
1077432166 11:2521226-2521248 GAGAGCAGGATGGCGGGGCCGGG - Intronic
1078498127 11:11841405-11841427 TTGAGAGGGAGGGTGGGGAGAGG + Intronic
1078531614 11:12140870-12140892 TAGAGAAGGTTGGTGGGGGAAGG - Intronic
1078611651 11:12824763-12824785 TAGAGAGGGTTGATGGGGCCGGG + Intronic
1078787461 11:14508967-14508989 TAGACAAGCATTGTGAGGACTGG - Intronic
1079026367 11:16951015-16951037 AATAGAAGGATGTTGGGGACTGG - Intronic
1079992055 11:27256471-27256493 CAGAGGAAGATGGTGAGGACTGG - Intergenic
1080054823 11:27895671-27895693 TAGAAAAGTATGGTTGGGGCTGG - Intergenic
1080716753 11:34809925-34809947 TAAAAAAGGTTGTTGGGGACAGG + Intergenic
1081035753 11:38143826-38143848 TAGAGAAGGAAAGTAGGGAGAGG - Intergenic
1081199998 11:40204097-40204119 TAGAGATGGGTGGTGGGGGGCGG + Intronic
1081644151 11:44778166-44778188 TGGGGAAGGAAGGTGGGGAGAGG + Intronic
1082176699 11:49068468-49068490 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1083734392 11:64671253-64671275 TAGAGGGAGATAGTGGGGACGGG + Intronic
1084030493 11:66477941-66477963 TAGGGAAGGTTGCTGGGGCCTGG + Intergenic
1084190480 11:67496364-67496386 CAGAGAAAGATTGTGGGGTCAGG + Intronic
1084311219 11:68317387-68317409 TGGACAAGGGTGCTGGGGACTGG - Intronic
1085587606 11:77725144-77725166 TGGAGATGGATGGTGGTGATGGG + Intronic
1086035556 11:82410020-82410042 TAGAGAGGGCTGGTGGCTACTGG - Intergenic
1086689006 11:89767409-89767431 CAGAGCAGGAGGCTGGGGACAGG + Intergenic
1086716850 11:90072551-90072573 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1086944950 11:92835908-92835930 TGGGGAAGGATGGTGAGGAGGGG - Intronic
1087826411 11:102769228-102769250 CAGGGAAGGGTGGTAGGGACAGG - Intergenic
1088127373 11:106444925-106444947 TTAAAAAGGATGGTGGGGGCAGG - Intergenic
1090405337 11:126473059-126473081 GAGAAGAGGATGGTGGGGGCTGG - Intronic
1090451472 11:126810102-126810124 AAGTGAAGGATGATGGGGAGGGG + Intronic
1090964318 11:131584926-131584948 TAGGGAACGATGGTGGAGAAAGG + Intronic
1091035190 11:132226632-132226654 AAGAGAAAGATGGAGGGGAGGGG + Intronic
1091458032 12:622642-622664 TAGAGGATGAAGGTGGGAACTGG - Intronic
1092261473 12:6955481-6955503 TTGAGGTGCATGGTGGGGACCGG + Exonic
1092825706 12:12396453-12396475 TAGAGGAGCATGGTAGGGAATGG + Intronic
1093858859 12:24138583-24138605 TAGAGGAGGTTGGTGGGGGATGG + Intergenic
1094349215 12:29504608-29504630 TAGGGAAGGATGGGGGAGATAGG + Intronic
1095613014 12:44154086-44154108 TAGTGAAGGATCGTGGAGGCAGG - Intronic
1096239969 12:49954583-49954605 GAGAGAAGGGAGGTGAGGACAGG - Intronic
1096699153 12:53371098-53371120 GAGAGAAGGAGGGAGAGGACAGG - Intergenic
1096885241 12:54711909-54711931 TAGAGTAGAATGGTGGTTACGGG - Intergenic
1097888996 12:64758994-64759016 GGGAGGAGGGTGGTGGGGACCGG + Intronic
1098472201 12:70858262-70858284 TTGAGAAGGAAAGTGGGGAAAGG - Intronic
1100903887 12:99275333-99275355 CTGGGAAGGATAGTGGGGACAGG - Intronic
1101171482 12:102101162-102101184 AAGGGAAGGATGGGGGGGAGGGG - Intronic
1101745895 12:107541282-107541304 TACAGCAGGATGGTGGAGAAGGG + Intronic
1102961122 12:117093932-117093954 CAGACACGGATGGGGGGGACAGG + Intronic
1103944699 12:124519530-124519552 GAGAGAAGGCTGGTGTGGCCGGG + Intronic
1104849010 12:131862266-131862288 GACAGGAGGATGGTGGGGAGGGG + Intergenic
1104921460 12:132292770-132292792 AAGGGAAGGAGGGTGGGGAGAGG + Intronic
1105204060 13:18205137-18205159 AATAGAAGGATCTTGGGGACGGG - Intergenic
1105792152 13:23812301-23812323 AAGAGAAGGATGGATGGGAAGGG + Intronic
1106192603 13:27466751-27466773 ATGAGAAGGAGGGTGGAGACAGG + Intergenic
1106227978 13:27799355-27799377 AAGAGAAGGGTGGTGGTGGCGGG + Intergenic
1107045078 13:35985182-35985204 TGGAGAAGGATGATGTGGAAGGG - Intronic
1107949107 13:45446016-45446038 TTGAGAAGGCTGGTGGAGAGAGG - Intergenic
1108778325 13:53795152-53795174 TAGGGAAGGATAGTGGAGCCTGG + Intergenic
1112427031 13:99311933-99311955 GTGAGAAGGATGGCAGGGACTGG - Intronic
1112443130 13:99439558-99439580 TGTAGAAGGACGGTGGGCACTGG - Intergenic
1113266404 13:108622671-108622693 AAGAGAGGGATGGTGGGGGATGG + Intronic
1113267841 13:108639225-108639247 TAAATCAGGAGGGTGGGGACAGG + Intronic
1113387136 13:109859150-109859172 TGGAGAGGGATGGTGGTGATGGG + Intergenic
1113396596 13:109953921-109953943 TAGAGAACAATAGAGGGGACTGG + Intergenic
1113888170 13:113671888-113671910 GGCAGAAGGAAGGTGGGGACTGG - Intronic
1113998013 14:16104053-16104075 TAGAGTAGAATGGTGTGGAATGG - Intergenic
1114260567 14:21033407-21033429 ATGAGAAGGCTGGTGGGGATGGG + Exonic
1114848842 14:26358285-26358307 TAGAGTAGAATGGTGGTTACCGG + Intergenic
1115295577 14:31822031-31822053 TAGGGAAGGGTAGTGGGGTCGGG + Intronic
1117370495 14:55074040-55074062 TAGAGAAAGAGGGTTGGAACAGG + Intergenic
1117580048 14:57143008-57143030 TAGAGACGGTTGGTGGGGAGGGG - Intergenic
1117684657 14:58240829-58240851 TAGAGACGGTAGTTGGGGACGGG - Intronic
1117709846 14:58516200-58516222 TAGAGAAAGATTGTGGGGAAAGG + Intronic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1118755541 14:68840696-68840718 TAGAGACAGATGGTGGTGATTGG + Intergenic
1119184575 14:72630870-72630892 TAAAGAAGGATGCTAGAGACAGG + Intronic
1119217066 14:72877072-72877094 TAGTGAATGAAGGAGGGGACAGG + Intronic
1119368274 14:74114341-74114363 TAGAGTAGGATGGTAGAGAGAGG + Intronic
1119747574 14:77055141-77055163 TAGAGAAATATGGTGGGGAGAGG + Intergenic
1119833399 14:77724506-77724528 TTGGGAAGGATGTTGGGGACAGG - Intronic
1119850127 14:77861143-77861165 TAAAGAAGCATTGTGGGGGCAGG - Intronic
1120236304 14:81895259-81895281 TAGAGTAGAATGGTGGTTACAGG - Intergenic
1121231380 14:92361344-92361366 TAGAGAAGCAAGGTTGGGAAGGG + Intronic
1121396928 14:93633490-93633512 TAGAAAGGGATGGTAGAGACCGG - Intronic
1121806138 14:96825070-96825092 TTGAGAAGGTTGGAGGGGATGGG + Intronic
1122916701 14:104862551-104862573 TGGAGATGGATGGTGGTGATGGG - Intergenic
1123035872 14:105471722-105471744 TAGAGTTGGCTGGTGGGGGCTGG - Intergenic
1125603980 15:40929808-40929830 GAGGGAAGGAGGGAGGGGACCGG - Intronic
1125670622 15:41469818-41469840 TAAAAAAGGAACGTGGGGACGGG - Intronic
1126683196 15:51224146-51224168 TAGGGAAGGGTGGTGGCGAGGGG - Intronic
1127936507 15:63645006-63645028 TGCAGAAGGATGGTGGGAGCAGG - Exonic
1128552967 15:68609984-68610006 AAGAGAAGGAGGGTGGGTAGAGG - Intronic
1128661774 15:69506593-69506615 TAGAGAAGAAGGCTGGGGGCTGG - Intergenic
1128679484 15:69637647-69637669 TTCAGAAGAATAGTGGGGACTGG + Intergenic
1128980726 15:72183919-72183941 CAGGGATGGATGGTGAGGACAGG + Intronic
1129475034 15:75779344-75779366 TGGAGGAGGATTGTGGGGAGAGG - Intergenic
1129633418 15:77288405-77288427 TAGAGAAGTATGCTGTGGTCAGG - Intronic
1129776268 15:78238521-78238543 GAGTGAAGGATGGTGGGGAGAGG - Intronic
1129838815 15:78730946-78730968 TGGAGGAGGATTGTGGGGAGAGG - Intergenic
1130268822 15:82432768-82432790 TGGAGAAAGATTGTGGGGAGGGG - Intronic
1130603141 15:85291649-85291671 TGGAGAAGGAGGAGGGGGACTGG + Intergenic
1131080054 15:89527121-89527143 AAGAGAAGGATGGTGGGGAGGGG + Intergenic
1131382121 15:91972823-91972845 TAGAAAAGGACAGTGGGGCCGGG + Intronic
1131682788 15:94741728-94741750 GGGACAAGGATGATGGGGACAGG - Intergenic
1132874524 16:2130436-2130458 CAGAGATGGATGATGGGGAGGGG - Intronic
1133121742 16:3612572-3612594 TAGAGACGGGCGGTGGGGGCGGG + Intronic
1133489011 16:6249106-6249128 TTGAGTAGGTTGGTGGGGAGGGG - Intronic
1134004548 16:10809449-10809471 TAGAAAAGGTTGGTGGGAAACGG + Intronic
1134075849 16:11290746-11290768 TAGAGGAGGATGGTGAGGAGTGG + Intronic
1134186032 16:12085621-12085643 TAGAGAAGTAGGGTGGGGGCTGG - Intronic
1134553469 16:15149269-15149291 CAGAGATGGATGATGGGGAGGGG - Intergenic
1136154428 16:28373735-28373757 AAGAGAAGGGTGGGGGGGAACGG - Intergenic
1136208662 16:28741529-28741551 GAGAGAAGGGTGGGGGGGAACGG + Intergenic
1137352221 16:47723479-47723501 TTGAAAAGGATGGAGGGCACTGG - Intergenic
1138732034 16:59206091-59206113 AAGATAAGGAAGCTGGGGACCGG + Intergenic
1139393026 16:66617846-66617868 AAGAGTGGGATGCTGGGGACAGG - Intronic
1139652469 16:68369395-68369417 CAGAGGAGGGAGGTGGGGACAGG + Intronic
1139781880 16:69358439-69358461 TAGAAAACGATGTTGGGGCCAGG - Intronic
1140914658 16:79483061-79483083 TAGGGAGGGATGGAGGGGAGAGG - Intergenic
1140974545 16:80046334-80046356 AAGATAAGGTTGGTGGGGGCAGG - Intergenic
1141196180 16:81863126-81863148 TGGAGATGGATGGTGGTGACGGG - Intronic
1142735303 17:1894601-1894623 TGGAAAAGGATGGTGGTGACAGG - Intronic
1143975416 17:10825724-10825746 TAGAGATGGATGCTGAGTACAGG - Exonic
1144566319 17:16362468-16362490 TGGAGAGGGATGGTGGTGATGGG + Intergenic
1146064695 17:29625028-29625050 AAGAGAAGGAGGGTGGGGGTAGG - Intergenic
1146447788 17:32946451-32946473 TAGACAAGAATGGTGAGGAGAGG + Intergenic
1146827239 17:36033433-36033455 TGGAGCAGCATGGTGGGGAAGGG - Intergenic
1147177866 17:38667806-38667828 TAGACAAGGGTGGAGGGGTCAGG + Intergenic
1147199383 17:38789772-38789794 TTGAGAGGGATGCTGGGGGCAGG + Intronic
1147571698 17:41575540-41575562 TGGAGAAGGTGGGTGAGGACAGG - Intergenic
1148323011 17:46768883-46768905 TAGAGAAGGCTGGAGGGAAGGGG - Intronic
1148347006 17:46910057-46910079 TAGAGTAGGAAGGGGGGCACTGG + Intergenic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149523346 17:57335157-57335179 CAGACAGGGATGGTGGGGGCTGG - Intronic
1149664397 17:58355612-58355634 TTGAGAAGGAAGATGGGGGCTGG + Intronic
1150277547 17:63909627-63909649 AAGACAAGGCTGGTGGGCACTGG + Intronic
1151345763 17:73500352-73500374 TGGAGAAGGATGGAGGAGAATGG - Intronic
1151510729 17:74557875-74557897 TAGAGGAGGCTGGAGGGGAGAGG + Intergenic
1151555536 17:74844661-74844683 TGGAGCAGGATGGTGGGGCGGGG + Intronic
1152157790 17:78646236-78646258 TAGCGAAGGGTGGTGGGACCTGG + Intergenic
1152277759 17:79368104-79368126 TAATAAAGGATGGTGTGGACAGG - Intronic
1152569981 17:81117524-81117546 GGGAGAGGGATGGTGGGGAAGGG - Exonic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152866440 17:82726550-82726572 TGGAGAAGGAGTCTGGGGACAGG + Exonic
1153087627 18:1306453-1306475 CAGGGAAGAATGGTGGGGAAAGG + Intergenic
1154306408 18:13233935-13233957 CAGACAAGGATGCTGGTGACTGG - Intronic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1155359138 18:24982623-24982645 AAGTGAAGGATGTTGGGGATGGG + Intergenic
1155441663 18:25868841-25868863 TAGGGAAGGATTGTGGAAACGGG - Intergenic
1155546179 18:26918299-26918321 TTGAAAAGGATGGTGTGGAGAGG + Intronic
1155577489 18:27263907-27263929 TGCAGAAGGATGGTGGAGACTGG - Intergenic
1155593227 18:27452509-27452531 AAGAAAAGGAAGCTGGGGACTGG - Intergenic
1156453322 18:37279021-37279043 TGGAGGAGGAGGGTGGGCACGGG - Intronic
1156620938 18:38850827-38850849 TGGAGAAGGAGGGTGGAGAGTGG - Intergenic
1156966474 18:43100172-43100194 TAGAATAGGCTGGTGCGGACAGG + Intronic
1156969163 18:43134020-43134042 TAGAGAATGAGGGTGGGGTATGG + Intergenic
1157324217 18:46657389-46657411 GAGAGAGGGCTGGTGGGGAGGGG - Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1157605171 18:48921927-48921949 CAGAGAGGGTTAGTGGGGACAGG + Intronic
1158626461 18:59075948-59075970 TAGAGAATGATGGTGATGATTGG + Intergenic
1158878029 18:61751725-61751747 CAGAGAAGGCCGGTGGGGAGAGG + Intergenic
1160301599 18:77686696-77686718 TGGAGAATGAGGCTGGGGACAGG - Intergenic
1160676386 19:393594-393616 TGGAGAAGGATGGTGGGGATAGG + Intergenic
1160676431 19:393771-393793 ATGGGAAGGATGGTGGGGATAGG + Intergenic
1160676465 19:393926-393948 TGGAGAAGGATGGTGGGGATAGG + Intergenic
1160682623 19:418711-418733 GAGTGACGGCTGGTGGGGACAGG + Intronic
1160686129 19:437672-437694 TAGAGAAGGATGGAGCTGGCGGG - Intronic
1160928766 19:1559939-1559961 TACAGAAGAATGGAGGGGACTGG - Intronic
1161362155 19:3856538-3856560 GAGAGAATGTTGATGGGGACAGG - Intronic
1161566834 19:5007101-5007123 TCACGAGGGATGGTGGGGACAGG - Intronic
1161605022 19:5210091-5210113 GAGAGTCAGATGGTGGGGACTGG - Intronic
1162185737 19:8903534-8903556 TAGAGAAGGAGGGAGGAGACTGG + Intronic
1162186113 19:8906346-8906368 TAGAGAAGGAGGGAGGAGACTGG + Intronic
1162187031 19:8913826-8913848 TAGAGAAGGAGGGAGGAGAGTGG + Intronic
1162405285 19:10469432-10469454 TGGAGAAGGGGGGAGGGGACAGG - Exonic
1162582693 19:11540274-11540296 TAGACAAGGATGGAGGGGCAGGG + Intronic
1163570828 19:18081390-18081412 CAGAAAAGGATGCTGGGGGCTGG - Intronic
1164158499 19:22611034-22611056 GAGAGAAGGAGGGTGGGCAGGGG + Intergenic
1164559124 19:29276507-29276529 CAGTGAGGGATGGTGGTGACTGG - Intergenic
1164617765 19:29677019-29677041 TAGAGGAGGCTGGTGGTGGCCGG - Intergenic
1165104411 19:33460583-33460605 TAGAGCAGGGGGGTGGGTACGGG - Intronic
1165268246 19:34679481-34679503 CAGAGAAGGAAGGTGGGATCAGG - Intronic
1165326343 19:35116534-35116556 GAGAGGAGAATGGTGGGGAAAGG - Intronic
1165649117 19:37469983-37470005 GAGAGGAGGATTGTGGGGTCAGG + Intronic
1165698785 19:37921383-37921405 TAGAGATGGTTGATGGGAACAGG + Intronic
1165779484 19:38423939-38423961 GAGACAAGGATGGTGGGAGCAGG + Intronic
1165786331 19:38463944-38463966 GAGAGAAGGATGGAGGGGACAGG + Intronic
1165843479 19:38803483-38803505 CAGAGATGGATGGTGGGGAGGGG - Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
1167679849 19:50912549-50912571 TGGAGAGTGATGGTGGGGGCGGG + Intergenic
1167705124 19:51077550-51077572 AAGATCAGGATGCTGGGGACTGG + Intronic
1167798253 19:51724605-51724627 CAGAGATGGATTCTGGGGACAGG - Intergenic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
925188819 2:1867008-1867030 TAGAGAGGGATGGGGGAGAGAGG + Intronic
926025178 2:9536596-9536618 TGGTGCAGGATAGTGGGGACGGG - Intronic
926937605 2:18102113-18102135 TAGAGCTGGATGGTGGTGATGGG - Intronic
927138529 2:20114441-20114463 TGGAGAAGGATGATGGTGAGTGG - Intergenic
928144846 2:28764098-28764120 TAGAGAAAGATGGGGAGGAAAGG + Intronic
928409876 2:31046790-31046812 CAGTGAAGAATGGTGGGCACTGG - Intronic
928985528 2:37177512-37177534 GAGAGTAGGATGGTGGTTACAGG + Intronic
929860331 2:45671583-45671605 GAGAGAAGGCTGGTGGGGGGAGG - Intronic
929973663 2:46609695-46609717 GAGAGAGGGAGGGTGGGGAAGGG + Intronic
930030623 2:47056211-47056233 AAAAGAAGGAAGGTGGGGAGAGG - Intronic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
933205435 2:79502050-79502072 CAGTGAAGCATGGTGGGGATAGG - Intronic
933679328 2:85085475-85085497 CTGGGAAGGTTGGTGGGGACAGG - Intergenic
933679339 2:85085547-85085569 CTGGGAAGGTTGGTGGGGACAGG - Intergenic
934119438 2:88825780-88825802 TGGAGATGGATGGTGGTGACGGG - Intergenic
935173183 2:100626592-100626614 TAGAGATGGGAGGTGGGGAAGGG - Intergenic
936089128 2:109489610-109489632 CAGAGAAGGATGCTGCTGACGGG - Intronic
936162909 2:110098303-110098325 TGGAGATGGATGGTGGTGATGGG - Intronic
936478781 2:112866005-112866027 TCGAGGAGGAGGGTGGGGAATGG - Intergenic
938383868 2:130851159-130851181 TTGAGAAGGGTGGTTGGGATAGG + Intronic
939076619 2:137610044-137610066 TAGAAGAGGATGCTGGGGATGGG + Intronic
939972781 2:148680923-148680945 TAGAGAAGGATATTTGGGAGAGG + Intronic
940468479 2:154063062-154063084 TACAGAAGGGTGTTGGGGAGAGG + Intronic
940656143 2:156489882-156489904 TAGTGAAGGAAGGAGGGGAGGGG - Intronic
941052081 2:160746487-160746509 TGGAGAAGGATTGAGTGGACAGG - Intergenic
942169227 2:173273625-173273647 TAAAGAAGGAAGGTGAGGCCGGG + Intergenic
942670888 2:178375716-178375738 TAAAGAAGGATGAAGGGGTCGGG - Intronic
942862091 2:180627114-180627136 AAGAGAAGCAAGGTGGGGAGAGG - Intergenic
943189966 2:184663432-184663454 TTGAGAAGGGTGGTAGGGATGGG + Intronic
944678241 2:202052381-202052403 GAGAGAAGGAAGGTAGAGACTGG + Intergenic
946226296 2:218265733-218265755 GAGAGAAAGACGGTGGGGAGAGG + Intronic
946230103 2:218286004-218286026 TAGAGAAGAATGGAGGGTAAGGG + Intronic
946412014 2:219520162-219520184 TGGAGAAGGAGGGTCGGGAGGGG - Intronic
946626757 2:221620442-221620464 TAGAGATGGATGGTAGTGATGGG - Intergenic
946990608 2:225325510-225325532 AAGGGAAGGATAGTGGGGGCAGG - Intergenic
947432915 2:230046364-230046386 AAGAGAAGGATGGTGGGCTCGGG - Exonic
947497884 2:230651904-230651926 TGGAGATGGATGGTGGTGATGGG - Intergenic
948616337 2:239201649-239201671 TTGAGAAGGGAGGTGGGGCCTGG - Intronic
948891981 2:240911667-240911689 GAGAGTAGGATGGTGGGGGCTGG - Intergenic
948916333 2:241036503-241036525 CTGAGAGGGATGGAGGGGACGGG + Intronic
1169105310 20:2989484-2989506 TAGGCAAGGGTGGTGGGGACAGG + Intronic
1169248792 20:4044744-4044766 GAGATAGGGCTGGTGGGGACTGG + Intergenic
1169565641 20:6850855-6850877 TAGAAAAGGATGGTAAGGGCTGG - Intergenic
1172301314 20:33852468-33852490 GAGAGATGGAGGGTGGGGGCGGG + Intronic
1173135513 20:40435345-40435367 TAGGGAAGGAAGGTGGAGTCTGG + Intergenic
1173164355 20:40676138-40676160 TAGAGGAATAGGGTGGGGACTGG + Intergenic
1173216858 20:41093435-41093457 GAGGGAAGGATGGTTGGGAAAGG - Intronic
1174189939 20:48733325-48733347 TGGAGATGGAAGGTGGGGTCAGG - Intronic
1175501844 20:59456337-59456359 TGGAGAAGGGTGCTGGGGAGAGG - Intergenic
1176161281 20:63650206-63650228 AGGGGAAGGATGGTGGGGAGGGG - Intronic
1176214052 20:63939937-63939959 AGGAGGAGGGTGGTGGGGACGGG + Exonic
1176284409 21:5011900-5011922 GAGACAGGGGTGGTGGGGACAGG - Intergenic
1176359486 21:5982944-5982966 TAGGGAGGGATGGTGGAGGCAGG + Intergenic
1176713913 21:10332942-10332964 AATAGAAGGATCTTGGGGACAGG + Intergenic
1179581184 21:42345203-42345225 TAGAGAGGAATGGTGGGCAATGG + Intergenic
1179707259 21:43188834-43188856 TTAAGAAGGGTGGTGGGGGCGGG - Intergenic
1179764032 21:43555606-43555628 TAGGGAGGGATGGTGGAGGCAGG - Intronic
1179872772 21:44251575-44251597 GAGACAGGGGTGGTGGGGACAGG + Intronic
1181002824 22:19995842-19995864 TAGGGAAGGGTGGAGGGGAAAGG - Intronic
1181810425 22:25400660-25400682 TGGACAAGGGTGCTGGGGACTGG + Intronic
1181895056 22:26099875-26099897 TAGGAGATGATGGTGGGGACAGG - Intergenic
1182001261 22:26921754-26921776 AAGAGAAGAAGGGTGAGGACTGG - Intergenic
1182254693 22:29030122-29030144 TGGAGCAGGAGGGTGTGGACAGG + Intronic
1183032275 22:35115168-35115190 TAGAAAAGGAAGGTGGTGGCTGG + Intergenic
1183189775 22:36314383-36314405 TTGAGAAGGAGGGTGGGGCAGGG + Intronic
1183351161 22:37335377-37335399 TGGAGTGGGATGGAGGGGACAGG - Intergenic
1183387778 22:37525054-37525076 GAGAAAGGGAAGGTGGGGACAGG - Intergenic
1183502458 22:38189026-38189048 TGGAGAGGGATGGTGGGGGATGG + Intronic
1183502474 22:38189066-38189088 TGGAGAGGGATGGTGGGGGATGG + Intronic
1183502529 22:38189216-38189238 TGGAGAGGGATGGTGGGGGATGG + Intronic
1183581680 22:38730199-38730221 TGGAGAAAGATGCTGGGGAGAGG - Intronic
1183586881 22:38757941-38757963 TAGAGATGGGTGGTGGGGGGGGG - Intronic
1183661959 22:39226402-39226424 TGGAGAGGCCTGGTGGGGACTGG + Intronic
1184381489 22:44147495-44147517 TAGACAAGGAGTGTGGGAACAGG + Intronic
1184970833 22:48018808-48018830 GAGAGGATGATGGTGGGGCCAGG + Intergenic
1185092101 22:48781458-48781480 GAGAGATGCATGGTGGGGATGGG + Intronic
1185142166 22:49108590-49108612 GAGAGAAGGACTGTGGGGGCCGG - Intergenic
1185179114 22:49349164-49349186 TAGAATAGGTTGGTAGGGACCGG - Intergenic
1203304865 22_KI270736v1_random:102132-102154 TAGAGTGGAATGGTGTGGACTGG + Intergenic
949512879 3:4782126-4782148 TGGAGTAGGCTGTTGGGGACTGG + Intronic
950242323 3:11382473-11382495 TATTGAAGGATGGTGGGGAGAGG + Intronic
950383589 3:12638030-12638052 AAGAGAAGAATGATGGGGAAGGG - Intronic
950983117 3:17330508-17330530 TTGAGAATGATGGTGGGAAATGG - Intronic
951419744 3:22470425-22470447 GAGAGAAGGATGGTGGTGCCAGG + Intergenic
951697232 3:25457874-25457896 CACAGAAGGAAGGTGGGGAGCGG - Intronic
953418420 3:42736113-42736135 CAGAGAAGGAAGTTGAGGACAGG - Intronic
954422017 3:50423832-50423854 CAGAGATGGGAGGTGGGGACAGG + Intronic
954436965 3:50501384-50501406 TAGAGAATGAGGGTGGGGGTGGG - Intronic
954462080 3:50632961-50632983 TGGAGGAGGGTGTTGGGGACTGG + Intronic
954573851 3:51663851-51663873 GAGAGAAGGAGGGTGGGTAGGGG + Exonic
954609238 3:51935490-51935512 CAGAGCAGGATAGTGGGGATAGG + Intronic
954894691 3:53965578-53965600 CAATGTAGGATGGTGGGGACGGG - Intergenic
955227165 3:57070170-57070192 TGGAGAAGTGTGGTGGGAACTGG - Intronic
955339359 3:58113124-58113146 TGGAGATGGATGGTGGTGATGGG - Intronic
955579804 3:60406662-60406684 TAGAGAAGGATGGTGGGGGGTGG + Intronic
955660455 3:61293459-61293481 GAGAGGAGGATGGAGGGGAGGGG + Intergenic
956084294 3:65593391-65593413 TTGTGAAGGATGGGGGGGAAAGG + Intronic
960029410 3:113042331-113042353 GAGAAAAGGGTGCTGGGGACTGG - Intergenic
960822882 3:121752956-121752978 AAAAGAGGGATGGTGGGGAAAGG + Intergenic
960822912 3:121753058-121753080 AAGAGAGGGAAGGTGGGGATAGG + Intergenic
961126707 3:124425118-124425140 TAGAGAAGGGTAGAGGGGAGGGG + Intronic
961390006 3:126546809-126546831 TAGAGAAGTAGGGAGGAGACAGG - Intronic
963275599 3:143326634-143326656 TAGAGAAGGTAGTTGGGGAAGGG - Intronic
963563722 3:146900997-146901019 GAGAGAAGGAGGGAGGGGAAAGG + Intergenic
963838097 3:150077590-150077612 AAGAGAAGGGTGGGGAGGACAGG - Intergenic
964078076 3:152716320-152716342 TACAGAGGGACGGTGGCGACTGG - Intergenic
964159585 3:153630879-153630901 TAGAGAAGGATGATTGGGGTGGG + Intergenic
964487896 3:157205289-157205311 CAGAGGAGGTGGGTGGGGACTGG - Intergenic
965559091 3:170044777-170044799 CAGAGAAGGATGGGGGAGAGGGG - Intronic
965729717 3:171758429-171758451 GAGAGACAGATGGTGGGGAAAGG - Intronic
966604156 3:181805303-181805325 TAGGGAAGGAAGGTTGGGACTGG + Intergenic
967356543 3:188578253-188578275 AAGAGAAGGAAAGTGGGGAAAGG - Intronic
968213604 3:196869155-196869177 TAGAGGAGGGTGCTGGGGAGGGG + Intronic
968745238 4:2356494-2356516 CAGAGATGGACGGTGGGCACTGG + Intronic
968769127 4:2492597-2492619 GGAAGATGGATGGTGGGGACAGG + Intronic
969317740 4:6392113-6392135 CAGAAATGGATGGTGGTGACAGG + Intronic
969376111 4:6764327-6764349 GAGAGAGAGATGGTGGGGAGTGG + Intergenic
969598117 4:8160200-8160222 GAGAGAAGGATAGAGGGGAGGGG + Intergenic
970086093 4:12347838-12347860 TAGAGAAGGATCCTGAAGACTGG - Intergenic
971055717 4:22910542-22910564 GAGACAAAGATGGTGGGGAGAGG + Intergenic
971095933 4:23403245-23403267 TAGAGGAGAATGGTAGGGAGAGG - Intergenic
975547127 4:75571299-75571321 GAGAGGAGGAGGGTGGGGATGGG - Intergenic
976352068 4:84070874-84070896 AAGAAAAGGATGCTGGGGAAAGG + Intergenic
977820198 4:101462385-101462407 AAGGGAAGGATGATGGGGAGGGG + Intronic
978036144 4:103997495-103997517 AAAAAAAGGATGGTGGGGAAGGG - Intergenic
978495090 4:109350444-109350466 TAGGGATGGAAGGTGGGGATGGG - Intergenic
979075936 4:116270623-116270645 CAGAGAAGAATAGTGGGGAGAGG - Intergenic
979327270 4:119394792-119394814 AAGAGAAGGATGGGTGGAACAGG - Intergenic
979712990 4:123802822-123802844 GAGAGAAGAATGGTGTGGAGAGG - Intergenic
979973680 4:127169149-127169171 TAGAGAAGTAGGGTGGAGAGAGG - Intergenic
981039226 4:140207452-140207474 CTGAGAAGGGTAGTGGGGACAGG - Intergenic
981089628 4:140719451-140719473 CAGAGAAGGAAGCTGGGCACTGG + Intronic
983093618 4:163536851-163536873 TATTGAAGGATGGTGTGGGCAGG - Intronic
983245154 4:165279480-165279502 AAGAGAAGGATGGGTGGAACAGG - Intronic
983259418 4:165439344-165439366 TAGAAGAAGATGGTGGGGAGGGG + Intronic
985009528 4:185568337-185568359 TAGAGCAGGATGGTGGCGAATGG + Intergenic
985117252 4:186604704-186604726 AAGAGAAGAAAGGTGGAGACGGG + Intronic
985809939 5:2075504-2075526 TGGAGCAGGGTGGAGGGGACGGG + Intergenic
986466916 5:8034932-8034954 AAAGGAAGAATGGTGGGGACAGG + Intergenic
987398894 5:17454240-17454262 TAAAGGAGGCTGGTGGGAACTGG + Intergenic
988334393 5:29887272-29887294 TAGAGAAGTATGGTGGGTTTTGG - Intergenic
988801470 5:34699984-34700006 GAGATAAGGAGGGTGGGGAGAGG + Intronic
989540177 5:42609262-42609284 GAGAGAGGCATGGAGGGGACAGG + Intronic
990980022 5:61593903-61593925 TATAGAAGGATGGTGGAGCAGGG - Intergenic
991655825 5:68902837-68902859 TAGAGCAGAGTGGTGGGTACTGG + Intergenic
992089760 5:73306514-73306536 TAGAGGAGCATGGTGGGGCCAGG + Intergenic
992260203 5:74962173-74962195 AATAGTGGGATGGTGGGGACTGG + Intergenic
992738799 5:79751801-79751823 TAGTGAAGAATGGAGGGGGCAGG + Intronic
992894389 5:81233981-81234003 AAGGTAAGGATGGTGGGGAGGGG - Intronic
993168231 5:84384051-84384073 AAGAGGAGGACGGTGGGGAGCGG - Intronic
995481324 5:112595926-112595948 TGGAGAAGGATGATGGGGCAGGG - Intergenic
995609194 5:113890921-113890943 TAGAGAAGGATCAAGGGCACAGG - Intergenic
996050624 5:118928947-118928969 TAGAGAAGAATAGTGAGGATTGG - Intronic
997233629 5:132260091-132260113 TAGAGAAGCAGAGTGGAGACAGG + Intronic
997950016 5:138235014-138235036 TTGAGAAGGATGGAGTGGAGGGG - Intergenic
997985928 5:138501680-138501702 TGGAGAAGGCTGGAGGAGACTGG + Intergenic
998164767 5:139836727-139836749 GAGAGGAGGCTGGTGGGGAAAGG + Intronic
1000569587 5:162895577-162895599 TAGAGCAGCATGGTGAGCACTGG - Intergenic
1001469540 5:172001098-172001120 TAGAGAAGAAAGATGGGGAGGGG - Intronic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1001764198 5:174232465-174232487 AAGAGAAGCAAGTTGGGGACAGG + Intronic
1002815942 6:680445-680467 TGGAGAAGGGTGGAGGGGCCAGG + Intronic
1003043930 6:2715314-2715336 TGGAGATGGATGGTGCTGACGGG + Intronic
1003129671 6:3385149-3385171 TGGAGATGGATGGTGGTGAGGGG + Intronic
1003769401 6:9281327-9281349 TATAGAAGGATAGTGGGGGGTGG + Intergenic
1004461723 6:15842868-15842890 TAGAGAAGGATGAAGGGAAAGGG - Intergenic
1004693447 6:18012198-18012220 TAGAGAAGGTCAGTGGGGAGTGG - Intergenic
1005207016 6:23416115-23416137 AAGAGAAAGATGATGGAGACTGG + Intergenic
1006387613 6:33740155-33740177 TAGGGAAGGATGCTGGGCAAGGG - Intronic
1006682651 6:35808153-35808175 TCAAGAATGATGGTGGGGGCAGG + Intronic
1007433043 6:41787400-41787422 GGGAGGAGGATGGTGGGGACGGG - Intronic
1007526721 6:42502370-42502392 TAGAGGAAGATGATGGGGATGGG + Intergenic
1007646931 6:43390135-43390157 TAGAGCAAGATGGTGGGGGAGGG - Intergenic
1007762202 6:44139667-44139689 GAGAGGATGATGGTGGGGTCAGG - Intronic
1007923826 6:45635023-45635045 CACAGAAGGCTGGTGGGAACCGG + Intronic
1007967640 6:46016398-46016420 GAGAGTAGGGTGCTGGGGACGGG + Intronic
1008124186 6:47650030-47650052 GAGAGGAAGATGGTTGGGACTGG + Intergenic
1008680750 6:53869292-53869314 AAGAGGGGGATGGTGGGGTCTGG + Intronic
1009918822 6:70030874-70030896 GAGAGCAGGATGGCTGGGACAGG - Intronic
1010285348 6:74070758-74070780 TAGAGAAAGAGGGTGGGAAGAGG - Intergenic
1011237592 6:85234369-85234391 GAGAGAAAGATGGAGGGGAAAGG + Intergenic
1011637567 6:89388402-89388424 TGGAGATGGATGGTGGTGAGGGG + Intronic
1011819598 6:91235748-91235770 TAGAGAAGGATGGAGGAGTCGGG - Intergenic
1012902035 6:105017736-105017758 TAGAGAAGGAGGGGAGGGAGAGG + Intronic
1014472673 6:121835495-121835517 GTGAGTAGGAGGGTGGGGACCGG + Intergenic
1015375911 6:132510072-132510094 CAGAGAAGGATGGCGGGAAGGGG + Intronic
1016054589 6:139565998-139566020 TAAATAAGGATGGTGGGGGAGGG - Intergenic
1016460354 6:144275020-144275042 AAGTGGAGGGTGGTGGGGACAGG - Intergenic
1016726301 6:147372727-147372749 AAGACAAGGATGGTAGTGACTGG - Intronic
1017035367 6:150262421-150262443 TGAAGAAGGAGGGTGGGGAAGGG - Intergenic
1017901699 6:158723619-158723641 TGGAGATGGATGGTGGTGACAGG - Intronic
1018137384 6:160790474-160790496 GTGAAAAAGATGGTGGGGACAGG + Intergenic
1018711738 6:166502118-166502140 TGGAGATGGACGGTGGGGATGGG + Intronic
1019186320 6:170222715-170222737 TGGAAAAGGAGGGTGGGGTCAGG - Intergenic
1019187778 6:170230949-170230971 TAGGGAAGGAGGGTGGAGTCTGG + Intergenic
1019335719 7:481620-481642 GAGGGGAGGAGGGTGGGGACAGG - Intergenic
1020005054 7:4778511-4778533 TGGAGAAGGAAGGCGGGGCCGGG + Intronic
1020535392 7:9389827-9389849 TAGAGATGGGGGGTGGGGATGGG + Intergenic
1020648387 7:10843982-10844004 TAGAGATAGATGTTGGGGAAGGG + Intergenic
1021126457 7:16855580-16855602 AAGAGAAGGGGGCTGGGGACAGG + Intergenic
1021709926 7:23405910-23405932 TGGAGAAGAATGCTGTGGACAGG + Intronic
1021847429 7:24776440-24776462 TCGAGGAGGATGGTGGACACGGG - Intergenic
1022104746 7:27189748-27189770 TTGAGAAGGACAGTGGTGACTGG - Intergenic
1022153317 7:27632899-27632921 GACTGGAGGATGGTGGGGACTGG - Intronic
1022593762 7:31691623-31691645 GAAAGATGGAGGGTGGGGACGGG + Intronic
1022970983 7:35517138-35517160 TAGAGAAGGAGGCTAGGGATGGG - Intergenic
1023092769 7:36632254-36632276 TGGATATGGATGGTGGGGACAGG - Intronic
1023460107 7:40386936-40386958 TAAGGGATGATGGTGGGGACAGG - Intronic
1024063410 7:45715162-45715184 AAAATAAGGATGATGGGGACGGG + Exonic
1024225717 7:47325365-47325387 TGGAGAAGGCAGGTGGGTACCGG - Intronic
1026527372 7:71166503-71166525 TAAAGAGGGATGGCAGGGACAGG - Intronic
1026779982 7:73259664-73259686 GAAAGAAGGAAGGAGGGGACCGG + Intergenic
1026864757 7:73816706-73816728 TAGAGAGAGTTGGTGGGGAGTGG + Intronic
1026987698 7:74565055-74565077 TGCAGAGGGATGGGGGGGACTGG + Intronic
1027020835 7:74813082-74813104 GAAAGAAGGAAGGAGGGGACCGG + Intronic
1027067189 7:75132847-75132869 GAAAGAAGGAAGGAGGGGACCGG - Intronic
1027627730 7:80565249-80565271 TGGAGAAGACTGGTGGGGATAGG + Intronic
1028417325 7:90595188-90595210 GAGAGAAGGAAGGTGGGGGAGGG - Intronic
1028778898 7:94712969-94712991 TGGAGATGGATGGTAGGGACAGG + Intergenic
1029189150 7:98759730-98759752 GATAGAAGGTTGGTGGGGACTGG + Intergenic
1029290416 7:99498352-99498374 TGGAGAAGGATAGAGGGGAAGGG + Intronic
1029467392 7:100734796-100734818 GAGAGAAGGATTGAGGGGTCAGG + Intronic
1029495090 7:100892295-100892317 GAGAGAAGGCTGGGGAGGACAGG - Intronic
1030133133 7:106219998-106220020 TAGAGGAGGAAGGTGAGGAAAGG + Intergenic
1030423130 7:109334626-109334648 CAGAGAAGGAGGGGAGGGACAGG - Intergenic
1030538017 7:110793044-110793066 GAGAGAAGAATGGTGGTTACTGG + Intronic
1032403269 7:131638337-131638359 TAGAGAGGGAGGCTGGGGAATGG - Intergenic
1033060803 7:138105151-138105173 AAAAGAAGGATGGTGGGAAAAGG - Intronic
1034762728 7:153688622-153688644 TAGAGCAGGAAGCTGGGGCCTGG - Intergenic
1034926962 7:155130128-155130150 CAGAGAAGGGTGGTGGGGATAGG + Intergenic
1034954058 7:155322449-155322471 CAGAGCAGCATGGTGAGGACAGG + Intergenic
1035393387 7:158520279-158520301 TAGAGCAGGAAGGTGTGGAAAGG + Intronic
1035814236 8:2521872-2521894 TTGGGAAGGATGGTGGAGACTGG - Intergenic
1037756019 8:21710528-21710550 TGGAGAAGGACGGTGGGGTCAGG - Intronic
1037771747 8:21805211-21805233 TAGACTAGGATGGAGGGGAGGGG - Intronic
1037911886 8:22748554-22748576 TACAGAAGAATGCTGGGGAGGGG - Intronic
1038038579 8:23705952-23705974 TAGGGAAGGGCGGTGGTGACTGG + Intronic
1038701702 8:29855231-29855253 AAGAGAGAGATGGTGGGGAGGGG - Intergenic
1039665648 8:39524017-39524039 TGGAGATGGATTGTGGAGACTGG - Intergenic
1039798099 8:40932635-40932657 AAGAGAAGGGAGGTGGGCACGGG - Intergenic
1039996289 8:42536725-42536747 TAGAGAATGCTGTTGGGGTCAGG - Intronic
1040699273 8:50041291-50041313 TGGAGATGAATGGTGGGTACAGG + Intronic
1040902800 8:52434023-52434045 AAGAGAAGTATGTTGGGGTCTGG - Intronic
1040920821 8:52614608-52614630 TAGAGAAGGGTGCTGGGGGAAGG + Intergenic
1041275902 8:56157295-56157317 GGGAGAAGGCTGGTGGGTACAGG + Intergenic
1041601537 8:59722951-59722973 TAAAGAAGGATGGTAGGAAAGGG + Intergenic
1042018017 8:64338614-64338636 TAGATAAGGATAGAGGGTACTGG - Intergenic
1042028338 8:64447508-64447530 TGGAGAGAGATGGTGGGAACTGG - Intergenic
1042224824 8:66507303-66507325 CAGTGAGGGATGGTGGGGAGAGG - Intronic
1042503248 8:69532814-69532836 GAGAGAAGGATGGGAGGGAAAGG - Intronic
1045718505 8:105077673-105077695 GAGAGAATGATGGTGTGGGCTGG + Intronic
1046322882 8:112600963-112600985 TATATAAGGATCGTGGGGACCGG - Intronic
1046882297 8:119322431-119322453 TAGAGAAGGATGGGGGGTTGTGG - Intergenic
1046890416 8:119416090-119416112 TGGAGGAGGATGGTGGGGAGTGG + Intergenic
1047916717 8:129591758-129591780 TAGAGAAGGCACATGGGGACAGG + Intergenic
1048021290 8:130541746-130541768 TGGAGAAGGGTGTTGGAGACAGG - Intergenic
1048033458 8:130654438-130654460 TAGTGAGGGATGCTGGGGGCAGG + Intergenic
1048078903 8:131103274-131103296 AAGAGAAGGATTGAGGGGAATGG - Intergenic
1048167207 8:132073708-132073730 TAGAGAAGGATGGATGGGGTGGG - Intronic
1048518585 8:135133409-135133431 CACAGAAGGAAGGTGGGGTCAGG - Intergenic
1048526933 8:135211741-135211763 TAGAGAAGGGAGGTGGGAAAAGG + Intergenic
1048766364 8:137848631-137848653 AAGAGAAGGATATTGGGGCCGGG + Intergenic
1049545063 8:143226743-143226765 CAGAGAAGGATGGAGAGGGCAGG - Intergenic
1050496062 9:6243751-6243773 TAAGGAATGATGGTGGGGACTGG + Intronic
1051161585 9:14214215-14214237 AAGAGCAGGCTGGTGGGGAAGGG - Intronic
1055157089 9:73077397-73077419 TAGAGAATGATAGTGGAGAAGGG + Intronic
1056930995 9:90877337-90877359 TAAAAAAGAATGGTGGGGGCTGG - Intronic
1058441056 9:105007588-105007610 GAGAGAAGGGTCGTGAGGACTGG + Intergenic
1185695678 X:2192704-2192726 TAGAGAGGGATGGTGGATCCCGG + Intergenic
1185911348 X:3983940-3983962 TGGAGAAGGATTGTGGCCACAGG - Intergenic
1185943568 X:4348767-4348789 AAGAGAAGGGAGGTGGGGACAGG - Intergenic
1186487346 X:9943609-9943631 TAGAGACGGATGGTGGTGACAGG + Intronic
1186874180 X:13800815-13800837 CAGAGAGGGTAGGTGGGGACTGG + Intronic
1186954303 X:14664802-14664824 AAGAGAAGGCTGGAGGGGAGGGG + Intronic
1187990078 X:24860930-24860952 GAGAGAGTGGTGGTGGGGACAGG - Intronic
1189226789 X:39419943-39419965 TGGAGGAGGATGGTGGGGGAGGG - Intergenic
1189546798 X:42050119-42050141 GAGAGGAGGAAGGTGGGGACAGG - Intergenic
1189884352 X:45525649-45525671 TAATGAGGGATGGTGGGGAGTGG + Intergenic
1190066668 X:47246082-47246104 TGGAGAGGGATGGTGGGGAAGGG - Intronic
1190472608 X:50798028-50798050 AAGAGAAGGAAGGAGGGGAGAGG + Intronic
1192182800 X:68926878-68926900 TGGAGGAGGAGGGAGGGGACTGG + Intergenic
1192552602 X:72066142-72066164 TGGGGAAGGATGATGGTGACTGG + Intergenic
1193048500 X:77077628-77077650 CAGAGAAGGATGTTGGGAACAGG + Intergenic
1193702002 X:84774377-84774399 TAGAGCAGGCTGGTGGGGAGAGG + Intergenic
1194413651 X:93583805-93583827 AAGAGAAGGAAGTTGGAGACAGG + Intergenic
1194662428 X:96641593-96641615 TAAAGAAGAATACTGGGGACTGG - Intergenic
1195019798 X:100815610-100815632 TGGAGATGAATGGTGGAGACTGG + Intergenic
1195123386 X:101780375-101780397 AAGAGAAGGATGGGTGGAACAGG - Intergenic
1195956878 X:110340645-110340667 TATAGATGGGTGGTGAGGACTGG + Intronic
1197963556 X:132032046-132032068 TAGTGAGGGGTGGTGGGGAGAGG - Intergenic
1197979172 X:132197759-132197781 TAGAGAAAGATTGAGGGGGCGGG + Intergenic
1198752830 X:139952570-139952592 TAAAAAAGGATTGTGGGGGCCGG - Intergenic
1199966429 X:152824437-152824459 CAGAGATGTATGGTGGGGAAGGG - Intergenic
1200179182 X:154140112-154140134 TGGAGACGGATGGTGGTGACTGG + Intergenic
1202048889 Y:20760697-20760719 CTGAGAAGGATGGTAGGGAAAGG + Intronic
1202379128 Y:24260982-24261004 GAGAGAAGGGAGGTGGGGCCGGG - Intergenic
1202491654 Y:25409139-25409161 GAGAGAAGGGAGGTGGGGCCGGG + Intergenic