ID: 922636351

View in Genome Browser
Species Human (GRCh38)
Location 1:227176339-227176361
Sequence ATGTTAAGAATCAGAATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 387}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922636351 Original CRISPR ATGTTAAGAATCAGAATTCT TGG (reversed) Intronic
902317554 1:15634190-15634212 ATCTGATGAATCAGAATTGTCGG + Intronic
902535017 1:17114661-17114683 ATGTGATGAAACAGAGTTCTCGG + Intronic
902648862 1:17823430-17823452 ATCTTAAAAAGCAGAATTCCTGG - Intronic
903264380 1:22148519-22148541 ATGTGAACACCCAGAATTCTTGG + Intergenic
903508713 1:23857241-23857263 GTATTAACAATCTGAATTCTTGG + Intronic
903714114 1:25350728-25350750 TTGTTAAAACTCAGATTTCTGGG + Intronic
904091557 1:27948488-27948510 ATGCCATGAATCAAAATTCTTGG - Intronic
905953476 1:41972734-41972756 ATGTCAAGAACCAGAATGCTTGG - Intronic
908022656 1:59914590-59914612 ATGTTTACAAGCAGTATTCTTGG + Intronic
909095477 1:71281917-71281939 ATTTTAAGAATAATAATTTTTGG - Intergenic
909183673 1:72457477-72457499 ATTTAAAGAATTAGAATTATTGG + Intergenic
909905961 1:81195261-81195283 ATGTTAACATTAAGAAATCTGGG - Intergenic
910571397 1:88708762-88708784 ATGTTAAAAATCAGTGTTTTAGG - Intronic
912101261 1:106209074-106209096 TTGTTAAGATTGGGAATTCTAGG - Intergenic
912236289 1:107854846-107854868 ATGTTAAAATACAGAATTTTAGG - Intronic
912841358 1:113042311-113042333 GTGTTAAGAATGCAAATTCTTGG + Intergenic
913444236 1:118932801-118932823 ATGTTAGGACACACAATTCTTGG - Intronic
913505277 1:119511104-119511126 ATGTATAGAATCATAATTTTGGG - Intronic
914942933 1:152038312-152038334 GTATTAAGAATCAGAAGACTTGG + Intronic
916024197 1:160819897-160819919 AGGTTTGGAATCAGTATTCTGGG - Intronic
916417772 1:164608915-164608937 TTGTTAAGTATAAGAATTCCAGG + Intronic
916896197 1:169164801-169164823 ATCCTAAGAAGTAGAATTCTGGG + Intronic
917429272 1:174948728-174948750 ATCTTCTGAATCAGAATTTTAGG + Intronic
919029560 1:192223802-192223824 ATAATTAGATTCAGAATTCTGGG + Intergenic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920597750 1:207290278-207290300 ATGTTAAGACCCAGTTTTCTAGG - Intergenic
921300083 1:213743810-213743832 GAGTTAGGAATCAGAATTTTTGG + Intergenic
922144469 1:222925781-222925803 ACCTTCAGAATCAGAATTCTGGG + Intronic
922636351 1:227176339-227176361 ATGTTAAGAATCAGAATTCTTGG - Intronic
923322894 1:232853445-232853467 ATTTTAAGGGTGAGAATTCTTGG + Intergenic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
924506683 1:244692589-244692611 CTGCTAAGAATCAGAAAGCTGGG - Intronic
1062863565 10:829851-829873 GTGTCAAGAATCATTATTCTAGG - Intronic
1063819423 10:9818063-9818085 ATGTCAAGAATCATATTTATTGG + Intergenic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064880553 10:20048167-20048189 ATGTTAAATATCAAAATTTTTGG + Intronic
1065297050 10:24286718-24286740 ATGGTAAAAATCCTAATTCTGGG + Intronic
1068025284 10:51635095-51635117 ATGTTAAGAAAAAGAATGCCTGG + Intronic
1068451733 10:57198143-57198165 TTGTTAAAACTGAGAATTCTGGG + Intergenic
1069125517 10:64628024-64628046 ATCTTAAAATACAGAATTCTAGG - Intergenic
1071045091 10:81363583-81363605 ATGGAAAGAATCAGAATTTCTGG + Intergenic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1073629511 10:105134506-105134528 ATGTAAAGACTCAGTATTCAAGG - Intronic
1073963440 10:108960672-108960694 ATTTTAAAAATCAGAATTTTTGG + Intergenic
1074683641 10:115936786-115936808 TTGTCAAGTATCAGAATTGTTGG + Intronic
1075079435 10:119373234-119373256 ATGTTAAAACACAGATTTCTGGG + Intronic
1075397135 10:122135430-122135452 ATGGAAAGACTCAGAACTCTGGG + Intronic
1076223822 10:128757446-128757468 ATATTAGGGAACAGAATTCTTGG + Intergenic
1076398626 10:130161556-130161578 ATGGAAAGATTCCGAATTCTTGG + Intronic
1077708645 11:4513771-4513793 ATGTACATAATCATAATTCTGGG + Intergenic
1077831000 11:5870243-5870265 ATTTTAAGAAGTAGAAATCTTGG - Intronic
1077899927 11:6479943-6479965 ATGTTCAGAAACAGGAATCTTGG - Intronic
1078531457 11:12139639-12139661 ATACTAAGAATGAGAATTCCTGG - Intronic
1080090629 11:28344332-28344354 ATATTAAGAATCCTAATTCGAGG - Intergenic
1080126767 11:28744067-28744089 ATTTTAAGAAACAGAAATCTGGG - Intergenic
1080226808 11:29971042-29971064 ATGGTAATAATTATAATTCTAGG + Intergenic
1080506615 11:32920600-32920622 ATGTTAAAAATCAGATTTATCGG + Intronic
1082121131 11:48380930-48380952 ATGTTATGAAATAGAATTCCAGG + Intergenic
1082252719 11:49999717-49999739 ATGTTATGAAATAGAATTCCAGG - Intergenic
1082555128 11:54555180-54555202 ATGTTATGAAATAGAATTCCAGG + Intergenic
1085067704 11:73512657-73512679 ATTTTAAGGGTCAGAATTCTGGG - Intronic
1086326241 11:85702914-85702936 ATGTTAAGATAGAGAATTTTAGG + Intronic
1086405928 11:86498989-86499011 ATATTAATAATCATGATTCTGGG + Intronic
1087693300 11:101347029-101347051 ATGTTAACAATGAGAAGTGTAGG + Intergenic
1088077378 11:105867375-105867397 ATGTTAGGACTCAGAATTTTTGG + Intronic
1090369838 11:126241859-126241881 ATCTTAAAAATCAGGCTTCTAGG + Intronic
1090620742 11:128558948-128558970 ATGTCAAGTATCAGAGTTGTAGG + Intronic
1091137780 11:133207622-133207644 ATGATTAGAATCAGAATTTGAGG - Intronic
1091855081 12:3732922-3732944 ATGGTAAGAATCGGAGTTCCTGG - Exonic
1091958568 12:4670606-4670628 ATGTATAGATTCAGAATTCTGGG - Intronic
1092250235 12:6891047-6891069 ATGTTTAAAACCAGGATTCTCGG + Intronic
1092669253 12:10843847-10843869 ATGTTAAGGAGCAGAATCATTGG + Intronic
1093096482 12:14977675-14977697 ATTTTAAAACTCAGAAATCTAGG - Intronic
1093175968 12:15913810-15913832 TTGTTAAAACTCAGAATGCTGGG - Intronic
1093270771 12:17058042-17058064 TTGTAAAGAATCAGGATACTGGG - Intergenic
1093752781 12:22819794-22819816 ATTTTAATAATCAGATGTCTAGG + Intergenic
1094096609 12:26712320-26712342 ATGTTAACACACAGAATTCGTGG - Intronic
1094735240 12:33226938-33226960 ATGTTAAGCATCAAAATTTCAGG + Intergenic
1094792022 12:33926466-33926488 TTGTTAAAAATGAAAATTCTAGG - Intergenic
1095427374 12:42091770-42091792 AGTTTAAGAAACAGATTTCTGGG + Intronic
1095581160 12:43801208-43801230 TTGTTAAGAATCAAAATTCACGG + Intronic
1096332041 12:50722106-50722128 GTGTAAAGATTCAAAATTCTGGG + Intronic
1097932883 12:65209551-65209573 ATGTTAAGGATCAGAACACATGG - Intronic
1098190739 12:67945730-67945752 ATGTTAAGAAGCTGGATTTTTGG - Intergenic
1098679516 12:73333906-73333928 ATGTTAAGAAACAGCTTTGTTGG + Intergenic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1099465255 12:82977716-82977738 ATGTATAGAAGGAGAATTCTTGG - Intronic
1100068672 12:90683041-90683063 ATGTGCAAATTCAGAATTCTAGG - Intergenic
1100533640 12:95484181-95484203 ATTTTATGAATCAGAATTTTGGG + Intronic
1101061188 12:100974134-100974156 ATGTTAAAAATGAAAATTCTTGG - Intronic
1102941595 12:116947346-116947368 GTGTTAACAAGGAGAATTCTAGG + Intronic
1104097479 12:125570778-125570800 ATTTTAAAAATCAGAAGTCAAGG + Intronic
1104373665 12:128245732-128245754 ATGTGATGAATGAGAGTTCTTGG + Intergenic
1104522145 12:129485790-129485812 AGGTAAGGATTCAGAATTCTTGG - Intronic
1105391577 13:19983926-19983948 ATGTTAAGAATAAAAATTCCTGG - Intronic
1105556904 13:21455948-21455970 ATGGTAAGAATTGGAATTCAAGG - Intronic
1105831550 13:24166667-24166689 ATGTTAAAAAACAGATTGCTGGG - Intronic
1106740552 13:32636067-32636089 AAATTAAGAATCAGAATACTAGG - Intronic
1106765908 13:32913766-32913788 ATGTAAAGAGACAGATTTCTGGG + Intergenic
1107161533 13:37234657-37234679 ATGTTAAAAAACAGAAATCCTGG + Intergenic
1107251046 13:38363622-38363644 ATGTAATAAATCAGAATTCAAGG - Intergenic
1107329374 13:39282361-39282383 ATGTGAAGTTTCAGAATTCAAGG - Intergenic
1107574394 13:41702129-41702151 ATGTTAAGAATATTAGTTCTGGG + Intronic
1107785216 13:43948972-43948994 ATGTTAATAATCAGAAAACTGGG + Intergenic
1108316192 13:49240062-49240084 ATGTTAAAACCCAGATTTCTGGG - Intergenic
1109266262 13:60204136-60204158 ATTTTAGAATTCAGAATTCTTGG + Intergenic
1109351164 13:61183173-61183195 ATTTTAAAAATCAGAATTCTTGG + Intergenic
1109491502 13:63106623-63106645 ATGTAAAGAATCCTATTTCTTGG + Intergenic
1109492604 13:63122289-63122311 ATGTTAGTTATCAGATTTCTAGG - Intergenic
1109631098 13:65047351-65047373 AGTATAAGAATCAGAATTCTAGG - Intergenic
1109865503 13:68258571-68258593 ATGTTATGAAACAGAATTCCAGG - Intergenic
1110118245 13:71846702-71846724 ATTTTCAGAATGAGATTTCTTGG + Intronic
1110178366 13:72585121-72585143 ATATTTGGAATCAGAATACTTGG - Intergenic
1110619660 13:77581230-77581252 ATGTTTAGAATGAGCAATCTAGG - Intronic
1110984640 13:81951138-81951160 ATGATGAGAATGAGAATTTTAGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115550220 14:34498425-34498447 ATTTTAATAATCATAATTCAAGG - Intergenic
1115834630 14:37386631-37386653 AGGTTAAGAACCTGTATTCTAGG + Intronic
1115891297 14:38032379-38032401 ATGTTAAGTATAAAAAATCTGGG - Intronic
1115951969 14:38731676-38731698 ATGTTAAGACCCAGAATTTTTGG - Intergenic
1116166845 14:41344626-41344648 ATATTAAAAATGAAAATTCTTGG - Intergenic
1117852381 14:59988479-59988501 TCCTTAAGAATCAGGATTCTTGG - Intronic
1118047087 14:61982154-61982176 ATTTTATGACTGAGAATTCTAGG + Intergenic
1118494113 14:66291275-66291297 CTGTTAAATATCAGGATTCTGGG - Intergenic
1119329494 14:73783505-73783527 ATGGTAAGGATCAAACTTCTAGG - Intronic
1120325206 14:83015210-83015232 AAGTTAAGTAACATAATTCTGGG + Intergenic
1120929010 14:89828511-89828533 ATGTTAGGGATCATAGTTCTGGG - Intronic
1121016792 14:90553760-90553782 ATGTTAAGCAGCAGAATTCAGGG - Intronic
1121518693 14:94570808-94570830 ATGTTCAAAACCAGAATTCCTGG + Intronic
1121702375 14:95964374-95964396 AGGTTAAGAATCACTATTCTAGG - Intergenic
1123005629 14:105321703-105321725 ATGTTTAGAATTGTAATTCTAGG + Intronic
1202840515 14_GL000009v2_random:116764-116786 ATGTTATGAAATAGAATTCCAGG - Intergenic
1202909892 14_GL000194v1_random:106957-106979 ATGTTATGAAATAGAATTCCAGG - Intergenic
1124039905 15:26091839-26091861 ATATTATGAAATAGAATTCTAGG + Intergenic
1124796058 15:32781099-32781121 ATGTTAATAGTTATAATTCTAGG + Intronic
1125298553 15:38229586-38229608 ATGTGAAGACTCAGAATTCTTGG + Intergenic
1130311707 15:82761809-82761831 ATTTGAAAAATCAGAATGCTGGG - Intronic
1131721762 15:95176763-95176785 ATCTTAAAAATCACAAGTCTTGG - Intergenic
1131762207 15:95636527-95636549 ATGCTAAGAGTCAGAACTCTGGG - Intergenic
1132134046 15:99315461-99315483 ATGGTGGGAAACAGAATTCTAGG + Intronic
1132211446 15:100026085-100026107 ATGGTAGGAGTCAGAATTGTTGG - Intronic
1133630479 16:7615626-7615648 ATATTAAGAATCACTAATCTAGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1135337121 16:21611924-21611946 ATGCTAAGAACCAGATTTCCAGG - Intronic
1136089046 16:27905218-27905240 CTGTTAAGAAACAGAGTACTGGG - Intronic
1138046382 16:53729576-53729598 ATGTTAAAATTCAGACTCCTGGG + Intronic
1138054784 16:53821215-53821237 GTGTTCAGAAACAGAGTTCTTGG + Intronic
1140160407 16:72485225-72485247 ATGTTAAAAATGACACTTCTTGG - Intergenic
1140296774 16:73716594-73716616 GTGTTCAGAGTAAGAATTCTGGG - Intergenic
1141065136 16:80908162-80908184 TTGTTAACAGTCAGGATTCTAGG - Intergenic
1142877195 17:2858605-2858627 ATCTTAAAGATAAGAATTCTTGG + Intronic
1143855895 17:9848661-9848683 TTGTTAAGTATTTGAATTCTTGG - Intronic
1144185012 17:12789042-12789064 AAATTAAGAATCAGACTTCTGGG + Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1144718541 17:17451334-17451356 ATGTTAAAACACAGAATGCTGGG - Intergenic
1145011179 17:19368946-19368968 GTGTTAAGAAACAGAACTCATGG - Intronic
1146884577 17:36462574-36462596 ATTTTAAGAATCCTGATTCTGGG + Intergenic
1148657976 17:49302586-49302608 ATGTTAATAATTACATTTCTGGG - Intronic
1149126110 17:53235531-53235553 ATGTTAAGAAACAATATTGTTGG + Intergenic
1150864299 17:68833470-68833492 TGGTTAAAAGTCAGAATTCTTGG + Intergenic
1151033268 17:70767244-70767266 ATCTTAAAAATCAGAAATTTGGG - Intergenic
1151035646 17:70795809-70795831 ATGTTAATAGTCAGCATTATAGG + Intergenic
1151878681 17:76881635-76881657 CTGTTAAAATTCAGATTTCTGGG - Intronic
1152155023 17:78627266-78627288 ATGTTAAGGATGAAAATTCAGGG + Intergenic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1153622473 18:6991688-6991710 ATATTAAGAAGTAGAATTATTGG - Intronic
1155905943 18:31451522-31451544 ATCTTTAGAAAAAGAATTCTAGG + Intronic
1157444473 18:47734467-47734489 ATTTGAAGAAACTGAATTCTTGG + Intergenic
1157679725 18:49595331-49595353 TAGTTTGGAATCAGAATTCTTGG + Exonic
1158925301 18:62251671-62251693 ATTTTAAGAATCAGATTTTTTGG - Intronic
1159713764 18:71796424-71796446 ATGCTCAGGATCAGAATGCTGGG + Intergenic
1159860348 18:73641187-73641209 TTGTTAAGAATCAAGATTCCTGG + Intergenic
1159935058 18:74358766-74358788 ATGCCAAGAATCATATTTCTAGG + Exonic
1160320904 18:77893738-77893760 AAGTTAAAAATAAGAATTCTGGG - Intergenic
1165719396 19:38068327-38068349 ACGTTAAGAATCTGATTTTTCGG - Intronic
925203382 2:1987149-1987171 ATTCAAAGAATCAGAATTTTAGG + Intronic
926187133 2:10699485-10699507 ATGTTAACAACCAGAGTGCTGGG + Intergenic
927120505 2:19956392-19956414 AAGGTAAGAGTCAGACTTCTTGG + Intronic
927597137 2:24406745-24406767 ATGCACTGAATCAGAATTCTTGG + Intergenic
927790352 2:26004686-26004708 ATGTTAAGAAACAGAACACAAGG + Intergenic
928330897 2:30357103-30357125 GTTTTAAGAATCAGAAATCAGGG + Intergenic
928351694 2:30562575-30562597 ATGTCAGGACTCAGAACTCTTGG + Intronic
928499096 2:31869355-31869377 ATGGTAAGAGTCAGAAGTTTCGG - Intronic
928626716 2:33147353-33147375 TGATTCAGAATCAGAATTCTGGG + Intronic
929955294 2:46453604-46453626 ATGTTAAGAACCTGAAGACTAGG - Intronic
930831041 2:55743487-55743509 ATGTGAAGAAACAATATTCTGGG - Intergenic
930950770 2:57142014-57142036 ATTTTTAGAATCAGAATTTCTGG - Intergenic
931059252 2:58508634-58508656 ATGTTCAGAATAAGACTTTTAGG + Intergenic
931206252 2:60148768-60148790 TTGTTAAAACTCAGATTTCTGGG - Intergenic
931378575 2:61731102-61731124 TTCTTGAGAATCAGGATTCTTGG + Intergenic
932029722 2:68171391-68171413 ATATCAAGAAGCAGAACTCTGGG - Intronic
933285585 2:80381416-80381438 ATGTTAAGAATTAAAGTGCTTGG + Intronic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
934090584 2:88547279-88547301 ATGTTGACAATGAGAACTCTAGG - Intergenic
934533783 2:95115312-95115334 CTTTTAAGAATCAGATTTTTAGG + Intronic
934961149 2:98674950-98674972 ATGTTGACCATCAGAAGTCTGGG - Intronic
936479274 2:112870126-112870148 AACTTAAGAATCAGATTGCTTGG + Intergenic
936834030 2:116684907-116684929 CTGTTAGGAATCAGAATTTTGGG - Intergenic
937011137 2:118563733-118563755 TTGTTAAGAATGCAAATTCTTGG - Intergenic
937929344 2:127192463-127192485 ATGTGAAGATACATAATTCTGGG - Intronic
939487421 2:142832292-142832314 ATGTAATGAATCACAATTATAGG - Intergenic
940283889 2:152014428-152014450 ATCTAAAGAATCATAATTTTTGG + Intronic
940421561 2:153485001-153485023 ATTTTAAAAATCATAACTCTTGG - Intergenic
940561786 2:155306656-155306678 ATGTTAAGAATACAAATTCTTGG + Intergenic
940600054 2:155847507-155847529 CTGTTGATAATCAAAATTCTTGG - Intergenic
941152262 2:161929363-161929385 ATGTTTTAAATCAGAATTATAGG + Intronic
941575163 2:167220938-167220960 ATGCAAATATTCAGAATTCTAGG - Intronic
941674113 2:168325453-168325475 ATGTTAAGGATCTAAAATCTTGG - Intergenic
942100687 2:172580001-172580023 ATTTTAAAAATAAGGATTCTTGG - Intronic
942118989 2:172758161-172758183 ATGTTTAGGATAAGAATTCCTGG + Intronic
942271929 2:174284813-174284835 AACTGAAGATTCAGAATTCTAGG - Intergenic
942843833 2:180399271-180399293 ATGTTAAGAATACATATTCTAGG + Intergenic
943332999 2:186583023-186583045 AGGTTAAGAATAAAAATTTTTGG + Intergenic
943557406 2:189422343-189422365 ATTTTAAGAAACAGAAATTTTGG + Intergenic
943672132 2:190674355-190674377 ATCTAAAGAAACAGAAGTCTAGG - Intronic
943916197 2:193635591-193635613 ATTTTTAGAATCAGAATTGGAGG - Intergenic
944181810 2:196903982-196904004 ATGTTAAGAGTCAGTCTGCTAGG - Intronic
944289886 2:197993367-197993389 TTGTTGAGCATCAGCATTCTTGG + Intronic
944311780 2:198241659-198241681 TTGTTAAAATTCAGATTTCTGGG + Intronic
945523352 2:210857752-210857774 ATGTTAAGAATGAGCAGTCTTGG - Intergenic
945889649 2:215415144-215415166 ATGTGAAGAATAATAATTATCGG - Intronic
946638108 2:221753067-221753089 AGGTAAATAATCAGAATTCATGG - Intergenic
946917000 2:224533418-224533440 ATGTGTAGAGTCAGAATTCAAGG + Intronic
1169547059 20:6661080-6661102 ATCTTTAGAATCAGTAATCTGGG - Intergenic
1170630157 20:18058336-18058358 TTATTAATAATCAGAATCCTTGG - Intronic
1172751362 20:37253431-37253453 CTGTTAAAATTCAGATTTCTGGG + Intronic
1174033027 20:47645970-47645992 ATGTGAAGAATCAAATTGCTGGG + Intronic
1174374554 20:50117038-50117060 ATGGTTAGAATTAGAATCCTGGG + Intronic
1174514366 20:51080157-51080179 AGGTTAAGAATAGGAATGCTGGG - Intergenic
1174662940 20:52230541-52230563 AAGTAAAGATTCAGAATACTTGG + Intergenic
1174945520 20:54980963-54980985 ATGTTCAGAATCATAACCCTAGG + Intergenic
1175508866 20:59507901-59507923 ATAATTAGATTCAGAATTCTTGG + Intergenic
1176629244 21:9121661-9121683 ATGTTATGAAATAGAATTCCAGG - Intergenic
1176788202 21:13285211-13285233 ATGATAAGAATAAGACTTATAGG + Intergenic
1177051476 21:16240187-16240209 AAGTTGAGAATCAGAATGCCTGG + Intergenic
1177366032 21:20138220-20138242 TAGTTAAAAAACAGAATTCTGGG - Intergenic
1178197638 21:30366753-30366775 ATGTGAAGATTCAGATTTCAGGG - Intronic
1178575290 21:33782723-33782745 ATCTTAAGAATGTTAATTCTTGG + Intronic
1179513922 21:41893401-41893423 ATGCCAAGAATTAGAATTTTAGG - Intronic
1179637499 21:42722799-42722821 ATTTTTAGAATCAGAATTATGGG + Intronic
1182331921 22:29557047-29557069 TTGTTAAGAATGACAAATCTCGG - Intronic
950458733 3:13108378-13108400 ATTTCAAGAAGCAGAATTATGGG + Intergenic
951035343 3:17926359-17926381 ATGTTAAAATGCAGATTTCTAGG + Intronic
951436379 3:22670039-22670061 AGGGAAAGAATGAGAATTCTTGG + Intergenic
952193106 3:31044546-31044568 ATGTTATGAAATAGAATTCCAGG - Intergenic
953102638 3:39844625-39844647 ATGAGAAGAAGCAGAAATCTAGG + Intronic
953441328 3:42920619-42920641 ATGTTATGAAATAGAATTCCAGG + Intronic
953583240 3:44175987-44176009 TTTTTAAGGATCAGAAATCTGGG - Intergenic
954252219 3:49376826-49376848 TTGTAAAGAAACAGCATTCTTGG + Intronic
954276663 3:49546535-49546557 TTGTAAAGAAACAGCATTCTTGG - Intergenic
954686951 3:52376288-52376310 GTGTGAAGAATCAGAACTCCAGG + Intronic
954808781 3:53235417-53235439 TTGTTAAGAAACAGAGGTCTAGG + Intronic
954821939 3:53337169-53337191 ATATTAAAAATGAGAAGTCTTGG - Intronic
955572710 3:60325034-60325056 ATATTAAGAATGAAAATTCCAGG - Intronic
956314409 3:67918049-67918071 ATGTAAACAATCAGAATCCATGG - Intergenic
956352900 3:68357694-68357716 ATAACAAGAATCAGAATGCTTGG - Intronic
956365035 3:68491884-68491906 TTGTTAAGATGCAGATTTCTGGG - Intronic
956554696 3:70506275-70506297 ATGTTAATAATCACGATTCTAGG - Intergenic
956742611 3:72286900-72286922 ATGACATTAATCAGAATTCTTGG - Intergenic
956878383 3:73486417-73486439 CTTTTAAGAATCATAATGCTTGG - Intronic
957095578 3:75774324-75774346 ATGTTATGAAATAGAATTCCAGG - Intronic
957196643 3:77077426-77077448 TTATAAATAATCAGAATTCTAGG + Intronic
957545100 3:81626866-81626888 TTCTTTAGAATCAAAATTCTTGG - Intronic
958784230 3:98579922-98579944 CTCTTAAGTATCAGAATTCAGGG + Exonic
958980711 3:100715870-100715892 AAGTTAAAAATCTGAATTGTAGG - Intronic
960289264 3:115863615-115863637 ATGTTAACAATCTTACTTCTGGG + Intronic
962216846 3:133529997-133530019 TTGTTAAGATGCAGAGTTCTGGG - Intergenic
962581610 3:136803116-136803138 AAATCAGGAATCAGAATTCTTGG - Intergenic
962585948 3:136843021-136843043 ACTTTAAAAATCAGAGTTCTGGG + Intronic
962974196 3:140431856-140431878 AAATTAAGAATCATAATCCTTGG + Intronic
964086917 3:152830284-152830306 AAGTTAAGAATAAGTATTCAAGG - Intergenic
964477227 3:157107954-157107976 CTGCTAAAAATCAGATTTCTTGG - Intergenic
965883295 3:173413299-173413321 ATTTTAAAAATGAGACTTCTCGG + Intronic
966215278 3:177495695-177495717 ATGTTAAGAAATAGAATTCTGGG + Intergenic
966424518 3:179766791-179766813 AGGTTAAGAACAAGGATTCTGGG - Intronic
966426485 3:179785684-179785706 TTGTGAACAATCAGGATTCTGGG + Exonic
967798215 3:193622515-193622537 AAATTAAGAATCAGACTGCTGGG - Intronic
969194462 4:5549659-5549681 GTATTTGGAATCAGAATTCTGGG - Intronic
970034796 4:11720964-11720986 ATGTGAACTATCAGAATTCAAGG - Intergenic
970037985 4:11761449-11761471 ATGTGAATAATCAGAATTCAGGG - Intergenic
970482801 4:16494601-16494623 CTGTTAAGCCTCAGATTTCTGGG - Intergenic
972013538 4:34215129-34215151 ATTTTAGGAAACAGAATTCCAGG - Intergenic
972094921 4:35336305-35336327 ATGTTTTGAATCAGAATTGATGG + Intergenic
974661756 4:64899770-64899792 ATGTTAAGAATGCCAACTCTTGG - Intergenic
975063536 4:70035217-70035239 CTGTTAAGAGACAGAGTTCTGGG + Intronic
975942737 4:79667754-79667776 ATGTGAAGAATCCAAATTCTAGG + Intergenic
976657227 4:87501846-87501868 TAGTTAAATATCAGAATTCTGGG + Intronic
976766272 4:88601704-88601726 ATATTAAGAATCACTGTTCTAGG - Intronic
976972549 4:91123696-91123718 GTGTAAAGAATTAGAATTATGGG - Intronic
977287123 4:95121657-95121679 ATGTTAACAATGAGAAATCTAGG + Intronic
977314721 4:95431320-95431342 CTGTTAAAACTCAGATTTCTAGG + Intronic
977797864 4:101190272-101190294 ATTTTAAGAATAATAATTCTGGG + Intronic
977954056 4:103006839-103006861 ATGTGATGAATCACAATTATTGG - Intronic
979488964 4:121302485-121302507 ATGTTAAACAGCACAATTCTTGG + Intergenic
979840159 4:125429052-125429074 ATGAGAAGAGTCAGAATACTAGG - Intronic
980554878 4:134390422-134390444 ATGATAATAATCTGACTTCTTGG + Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
981223322 4:142262402-142262424 ATGTCAGGAATAAGAATTCTAGG - Intronic
981559934 4:146036706-146036728 ATCTAAACAATCAGAATTCTAGG + Intergenic
983852012 4:172592555-172592577 TTGTTAAAATTCAGAATCCTTGG - Intronic
984110772 4:175610787-175610809 ATGTTAAAAATCACAATAATTGG - Intergenic
985497827 5:219308-219330 ATCTTAAGAATCGGCCTTCTAGG + Intronic
985891897 5:2722421-2722443 AAATTAAGAATAAGAATTTTTGG - Intergenic
986500903 5:8399180-8399202 ATGTTGAGAAAGAGAATTTTTGG + Intergenic
986994701 5:13593664-13593686 TATTTAAGAATCAGATTTCTAGG - Intergenic
988125263 5:27024671-27024693 ATGTAGATAATTAGAATTCTTGG - Intronic
990077005 5:51859512-51859534 ATGTTAAGCATCATTATTGTGGG + Intergenic
990081854 5:51926854-51926876 ATATTATGAAACAGAATTCCAGG - Intergenic
990584303 5:57195435-57195457 ATGTTAAGAATAAAATTTCTAGG - Intronic
991439877 5:66635765-66635787 ATGTTAAGAATCCCCAATCTTGG - Intronic
991973601 5:72164390-72164412 ATTTTTAGCATCAGAATTTTGGG + Intronic
991986122 5:72288517-72288539 GTGATAAGGATTAGAATTCTTGG - Intronic
992635652 5:78723707-78723729 ATTTTAAGAATCAGAAATCTAGG + Intronic
992905437 5:81340658-81340680 CTGTTAAGAATCATACTTTTGGG - Intronic
993248640 5:85485875-85485897 ATATTATGAAATAGAATTCTAGG - Intergenic
993745347 5:91590503-91590525 ATATTATGAAACAGAATTCCAGG + Intergenic
993764326 5:91836805-91836827 ATGTTAAAACTCAGAATTCGTGG - Intergenic
993835840 5:92818950-92818972 ATGTTAAAATGCAGATTTCTAGG + Intergenic
994012057 5:94916537-94916559 ATTTTCAGAATCAAAGTTCTGGG + Intronic
994125453 5:96164960-96164982 ACGTGAAGAATGGGAATTCTGGG + Intergenic
994219686 5:97181435-97181457 ATGTTTGGGAGCAGAATTCTGGG + Intronic
995434118 5:112116434-112116456 ATGTTTCTAATCAGAATGCTGGG + Intergenic
995558975 5:113360444-113360466 ATGTTAGGAATAAAAATTATGGG - Intronic
996015903 5:118533981-118534003 AAATTAAGATTCAGAATGCTTGG + Intergenic
996158852 5:120137448-120137470 ATGCTAAGCATCTGAATTCTTGG - Intergenic
996268079 5:121567523-121567545 ATATTCAGAATCAGAATTGTTGG - Intergenic
996370224 5:122745550-122745572 ATGAAAAGAACCAGAATCCTTGG - Intergenic
996478946 5:123951547-123951569 ATGTTAAATATCAGGATTATTGG - Intergenic
997119647 5:131161300-131161322 ATGTTAAAAATTTGTATTCTGGG + Intronic
998654629 5:144163235-144163257 ATGTTAAGAAAAAAAATTATTGG + Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
999263659 5:150252890-150252912 TGGTTAAGAACCAGAGTTCTGGG - Intronic
999626289 5:153524018-153524040 ATGTACTGAATCAGAATTCCTGG + Intronic
999803690 5:155062027-155062049 ATGTTTAGAAAGATAATTCTGGG - Intergenic
999875904 5:155805473-155805495 ATGTTAATAATAAATATTCTGGG + Intergenic
999894226 5:156011736-156011758 ATGTTTAAAAATAGAATTCTGGG - Intronic
1000255450 5:159534163-159534185 ATGTTAAGAACCAGCAGTCCTGG + Intergenic
1000380539 5:160625205-160625227 GTGTTAAGATTATGAATTCTAGG - Intronic
1000670044 5:164050188-164050210 ATGTACAAAATCATAATTCTAGG - Intergenic
1000722327 5:164723922-164723944 ATTTTAACAATCTGAATTTTAGG - Intergenic
1000750406 5:165088634-165088656 AGTTTAAGAAGCAGCATTCTAGG + Intergenic
1000852419 5:166356742-166356764 ATATTAAAAATCACAATTCCAGG + Intergenic
1004200555 6:13543796-13543818 TTGTTAAGACCCAGATTTCTAGG - Intergenic
1004558337 6:16721848-16721870 CTTTTGAGAAACAGAATTCTTGG + Intronic
1004773962 6:18821406-18821428 AAGTTGAAAATCAGTATTCTGGG + Intergenic
1004863406 6:19830180-19830202 ATGTTAAAAATCACAATTAAAGG - Intergenic
1004987372 6:21097933-21097955 ATGTCAATATTCAGAATTTTTGG + Intronic
1005424394 6:25686227-25686249 ATATTAAGGAGCAGAATTTTTGG + Intronic
1006413649 6:33890746-33890768 ATGTTAAGATACAGAACTGTGGG - Intergenic
1006765660 6:36503552-36503574 ATGATTAGAATGAAAATTCTTGG - Intronic
1007669880 6:43543163-43543185 ATGTTAAAAGTCAGAATAGTGGG + Intronic
1008470904 6:51883551-51883573 ATGTTAAGCACTAGAGTTCTTGG - Intronic
1009501835 6:64423551-64423573 ATGTTAAGAAACCAAATTCTTGG + Intronic
1010464552 6:76151561-76151583 ATGTGATGATTCAGAAATCTAGG - Intergenic
1011254147 6:85403944-85403966 ATGTTATGAATTAGTATTCAAGG + Intergenic
1011398163 6:86932304-86932326 ATGAAAAGAAAAAGAATTCTTGG - Intergenic
1012251111 6:96982203-96982225 AGATTAATAAACAGAATTCTTGG - Intronic
1012533881 6:100272098-100272120 TTTTTAAAAATCATAATTCTGGG + Intergenic
1013136965 6:107291664-107291686 ATTTTTAAAAACAGAATTCTAGG - Intronic
1014751203 6:125258464-125258486 ATGTTTAGAAACTGAATCCTGGG - Intronic
1015610524 6:135012803-135012825 CTGTTAATAATCACAAATCTTGG - Intronic
1016090466 6:139971832-139971854 ATTCTAAGAAGCAGAATACTTGG + Intergenic
1016755651 6:147682630-147682652 ATTTTAAAAATCAAAATTATAGG + Intronic
1017109351 6:150917912-150917934 AATTTAAAAATCAGAATACTTGG + Intronic
1017591549 6:155983528-155983550 ATGTTAAGAATGCAAATTCCTGG + Intergenic
1017708480 6:157146234-157146256 ATGTAAAGTATCAAAATTGTTGG - Intronic
1017859481 6:158382171-158382193 ACCTTAAGAAACAGATTTCTGGG + Intronic
1018562930 6:165121078-165121100 AGGTGAAGAATCAAAATTCCCGG + Intergenic
1020418998 7:7978312-7978334 ATGTAGAGAATCATAATTATGGG - Intronic
1020700414 7:11474966-11474988 ATTTCAATAAGCAGAATTCTGGG + Intronic
1023557987 7:41443238-41443260 ATGAGAAAAATCAGAACTCTTGG - Intergenic
1023833100 7:44051671-44051693 ATGTTTAAAATCAGAGTCCTGGG - Intronic
1024304343 7:47914634-47914656 AGGTTGAGGATCAGGATTCTGGG - Intronic
1024820142 7:53318985-53319007 ATATTAAAAATCATAAATCTGGG + Intergenic
1027427613 7:78077330-78077352 TTGTAAAGAATCTGAACTCTTGG - Intronic
1027667984 7:81062783-81062805 ATGTAGAGTATCAGAATACTTGG - Intergenic
1027736464 7:81938622-81938644 TTTTTTTGAATCAGAATTCTGGG - Intergenic
1027816771 7:82983470-82983492 TTGTTAAGAATTAGAAATTTGGG + Intronic
1028172571 7:87616194-87616216 ATCTTAAATATCAGTATTCTGGG + Intronic
1029455953 7:100672635-100672657 ATGTTAAGTCTCACAATACTGGG - Intergenic
1031856672 7:126930765-126930787 ATATTCATAGTCAGAATTCTTGG + Intronic
1032593696 7:133217695-133217717 ATTTTAAAAAACAGAATTCAAGG - Intergenic
1032931126 7:136672634-136672656 ATATTAAAAAACAGAAATCTTGG - Intergenic
1035065474 7:156101160-156101182 AGGTTAAGATTCAATATTCTTGG + Intergenic
1035326414 7:158068809-158068831 AAGTTAAGAATGAGAAGTCATGG - Intronic
1035665111 8:1375051-1375073 ATGTTAAGAATCTAATTTCCTGG - Intergenic
1036163998 8:6414662-6414684 ATGTTGAGAAACAGAATTGCTGG + Intronic
1036566669 8:9944098-9944120 ATGTTAAGAATGACAACTTTGGG - Intergenic
1040994586 8:53389107-53389129 ATGTGAAGACTCAGAAATTTAGG + Intergenic
1041562618 8:59237184-59237206 ATTTTAACAAGCAGAAATCTAGG - Intergenic
1044270287 8:90234542-90234564 ATGCTAATAATCAGAAATCAGGG + Intergenic
1044512545 8:93099065-93099087 ACTTTAAGACACAGAATTCTGGG + Intergenic
1045437325 8:102176760-102176782 GTTTTAAAAATCAGAAATCTAGG - Intergenic
1045632413 8:104140962-104140984 ATTTTAAAAATCATAATTTTTGG + Intronic
1045734674 8:105280787-105280809 TTGATAAGACTAAGAATTCTAGG - Intronic
1046369821 8:113287898-113287920 CTTTTAATAATAAGAATTCTAGG - Intronic
1046484544 8:114869503-114869525 GTGTTAAGAATCAGAATTAAAGG - Intergenic
1046617640 8:116495048-116495070 GTGTTAAGAATCAGAAATTCTGG - Intergenic
1046742258 8:117842051-117842073 TTGTTAAAACACAGAATTCTGGG - Intronic
1047790440 8:128198239-128198261 CTGTTAAAACTCAGATTTCTGGG - Intergenic
1047810721 8:128405882-128405904 ATATGAAGAATAAGAAATCTGGG + Intergenic
1050877104 9:10651937-10651959 ATGGTAAGTATGAGGATTCTTGG - Intergenic
1051125994 9:13806434-13806456 ATCTTAAGAATCAGAATTCACGG - Intergenic
1051679910 9:19596466-19596488 ATGTGAAGATTTTGAATTCTTGG - Intronic
1051757391 9:20418399-20418421 GTATTAAAATTCAGAATTCTGGG + Intronic
1051786134 9:20745738-20745760 ATGTTAAGAATCTTATTTGTGGG + Intronic
1051891070 9:21943591-21943613 ATTTTAAGAATGAGAAAGCTCGG - Intronic
1052036955 9:23693597-23693619 ATGTGAAGACTCAGAATGCTGGG + Intronic
1052064897 9:24006108-24006130 ATGTTAACAATCATATTTATAGG + Intergenic
1052137330 9:24929118-24929140 ATGTTAAGGAACAAAAATCTTGG - Intergenic
1053179286 9:35954294-35954316 ATTTTAAAAATCACAGTTCTGGG - Intergenic
1055027234 9:71735483-71735505 ATATTAAGAATAAGAATTTGTGG + Intronic
1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG + Intronic
1057005200 9:91551228-91551250 ATTTTAAGAATGAGTTTTCTGGG - Intergenic
1057093894 9:92286775-92286797 AGGTTAAGAACCAGTTTTCTCGG + Intronic
1058727401 9:107817382-107817404 TGGTTAAGAATTAAAATTCTCGG + Intergenic
1059478272 9:114566962-114566984 ATTTAAAGAATCAGATTTCAGGG + Intergenic
1061336080 9:129937223-129937245 ATTTTCAGAAGCAGAATTTTTGG - Intronic
1203752086 Un_GL000218v1:89335-89357 ATGTTATGAAATAGAATTCCAGG - Intergenic
1186802463 X:13106851-13106873 AATTTAAGAATCAAAAATCTTGG - Intergenic
1186973871 X:14878225-14878247 ATGTTCAGAAACTGAATTATTGG + Intronic
1187032602 X:15503379-15503401 CTGTTAAGACTCAGATTTATGGG + Intronic
1187207806 X:17199340-17199362 ATATTAAGGACCAGAATTTTAGG - Intergenic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1192202611 X:69076404-69076426 ATGTTTAGAATCATGACTCTGGG + Intergenic
1193127687 X:77886735-77886757 ATGTTAAAATTCAATATTCTTGG - Intronic
1193365546 X:80628022-80628044 ATGCAAAGAATCAAAATTCAAGG - Intergenic
1193976728 X:88129454-88129476 ATGTTAAAAGTCATATTTCTAGG + Intergenic
1194117251 X:89918404-89918426 ATGTTAAGAGTAAGAAGTATAGG - Intergenic
1195633473 X:107086283-107086305 AATTTAAGAATCATCATTCTAGG - Intronic
1196149834 X:112361477-112361499 ATTTCAAGACTGAGAATTCTAGG + Intergenic
1197050407 X:122050655-122050677 ATGTGTAGAATCAAAATTCTTGG - Intergenic
1197278188 X:124504528-124504550 AATTTAAGAATCAGAAATCTGGG - Intronic
1197989390 X:132300902-132300924 ATGACCAGAATCAGAATTCCAGG + Intergenic
1199162113 X:144625324-144625346 AATTCAAGAATCAAAATTCTTGG - Intergenic
1199275767 X:145940156-145940178 ATGTATATAATCAGAAATCTGGG + Intergenic
1199590049 X:149459167-149459189 ATTTTATGAGTCAGAAATCTCGG - Intergenic
1199765778 X:150940865-150940887 ATTATAAGAATCAGGTTTCTTGG - Intergenic
1200470044 Y:3575563-3575585 ATGTTAAGAGTAAGAAGTGTAGG - Intergenic
1201165740 Y:11206971-11206993 ATGTTATGAAATAGAATTCCAGG - Intergenic