ID: 922636892

View in Genome Browser
Species Human (GRCh38)
Location 1:227182787-227182809
Sequence CTGCTTGCCCACATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 11, 3: 66, 4: 409}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922636892_922636899 18 Left 922636892 1:227182787-227182809 CCACCCTCAATGTGGGCAAGCAG 0: 1
1: 0
2: 11
3: 66
4: 409
Right 922636899 1:227182828-227182850 ATTCTGCTTGCTGAGTCTTCTGG 0: 1
1: 0
2: 13
3: 76
4: 423
922636892_922636898 -8 Left 922636892 1:227182787-227182809 CCACCCTCAATGTGGGCAAGCAG 0: 1
1: 0
2: 11
3: 66
4: 409
Right 922636898 1:227182802-227182824 GCAAGCAGGTGTTAGAAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 223
922636892_922636897 -9 Left 922636892 1:227182787-227182809 CCACCCTCAATGTGGGCAAGCAG 0: 1
1: 0
2: 11
3: 66
4: 409
Right 922636897 1:227182801-227182823 GGCAAGCAGGTGTTAGAAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922636892 Original CRISPR CTGCTTGCCCACATTGAGGG TGG (reversed) Intronic
900331561 1:2137317-2137339 CCGCCCACCCACATTGAGGGTGG + Intronic
900650840 1:3729465-3729487 CTCCTTCCCCACACTGATGGTGG - Intronic
900879537 1:5370796-5370818 GTGCTCACACACATTGAGGGTGG - Intergenic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901478746 1:9509312-9509334 GTGCTCACCCAGATTGAGGGTGG - Intergenic
901653310 1:10755396-10755418 CTGAGTGCCCACAGTGAGAGAGG - Intronic
902037181 1:13466514-13466536 GTGCCTGCCCACATTGGGTGAGG + Intergenic
904323854 1:29714397-29714419 GTGCCTGTCCACATTGAGGGCGG - Intergenic
904651481 1:32009191-32009213 GCGCCCGCCCACATTGAGGGCGG - Intergenic
904906752 1:33902936-33902958 CTGCTTGCCCACCCTGGGGTTGG - Intronic
905084861 1:35363877-35363899 CAGCATGCCCACATTGGGGCAGG - Intronic
908604153 1:65776106-65776128 ATGCCCACCCACATTGAGGGGGG + Intergenic
908806363 1:67937123-67937145 GTGCCTGTCCACATTGAGGTTGG + Intergenic
909190139 1:72540481-72540503 GTGCCCACCCACATTGAGGGTGG + Intergenic
909388969 1:75095811-75095833 ATGCCCACCCACATTGAGGGTGG - Intergenic
909825839 1:80126436-80126458 GTGCCTGTTCACATTGAGGGTGG + Intergenic
910144569 1:84064791-84064813 GTGCCTGCCCACATTGAGAGTGG - Intergenic
911403671 1:97408728-97408750 GTGCCTACCCAGATTGAGGGTGG - Intronic
911476626 1:98381304-98381326 ATGCTTGCCCACATTGATGAGGG + Intergenic
912566087 1:110588344-110588366 GTGCCTGCCCACACTGAGGTCGG + Intergenic
912589561 1:110802494-110802516 CTGCTTGTCCAGAATGAGGGAGG - Intergenic
916400030 1:164437441-164437463 GTGCCTACACACATTGAGGGTGG - Intergenic
916472402 1:165137220-165137242 CTGAGTGCCCAGAATGAGGGAGG + Intergenic
917199956 1:172504122-172504144 TTCCTTGTCCACATGGAGGGTGG - Intergenic
918407032 1:184221726-184221748 GTGCCCACCCACATTGAGGGTGG - Intergenic
918711987 1:187742546-187742568 GTGCTCACCCAGATTGAGGGTGG - Intergenic
919125117 1:193383796-193383818 GTGCTCACCCAGATTGAGGGTGG + Intergenic
919310105 1:195896186-195896208 CTGCCTGCCCATATTAAGGGTGG + Intergenic
919398793 1:197082783-197082805 GTGCCCACCCACATTGAGGGTGG - Intergenic
919794336 1:201312119-201312141 CTGCGTGCACACATGGAGGCAGG - Intronic
920167537 1:204046226-204046248 CTGATAACCCACTTTGAGGGGGG - Intergenic
920798454 1:209163351-209163373 GTGCCTGCCCACATTGGGTGAGG - Intergenic
921216040 1:212937472-212937494 ATGCTTGCCCATATTGGGTGAGG + Intergenic
921910220 1:220540405-220540427 ATGCTTGCCCACATTGATGAAGG + Intronic
921940056 1:220829902-220829924 GTGCCCGCCCAGATTGAGGGTGG + Intergenic
922188585 1:223297466-223297488 CTTCCTGCCCACATTCAGGTGGG - Intronic
922316522 1:224447437-224447459 GTGCCCGCCCACATTGAGGGTGG + Intronic
922362710 1:224837954-224837976 ATGCTTGTTCACATTGAGGGAGG - Intergenic
922620868 1:226987320-226987342 CTGCTGCCCCACAGTGAGGGTGG + Exonic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
922882093 1:228988825-228988847 CTGCTGGTCCATAGTGAGGGTGG + Intergenic
923385548 1:233462206-233462228 GTGCCTGCCCACATTGAGGGTGG + Intergenic
1064402361 10:15032113-15032135 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1064513064 10:16116173-16116195 CTGCCTGCCCACATTGGTGAGGG + Intergenic
1066964901 10:42254263-42254285 GTGCCCACCCACATTGAGGGTGG - Intergenic
1067277635 10:44849328-44849350 GTGCCCACCCACATTGAGGGTGG - Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1068446772 10:57134977-57134999 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1068937434 10:62649775-62649797 GTGCCCGCCCACAATGAGGGTGG - Intronic
1069090914 10:64197473-64197495 CTGCTTCAGCATATTGAGGGAGG - Intergenic
1069119922 10:64556868-64556890 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1071248528 10:83791314-83791336 CTGCCTGCCTACACTGAGAGGGG - Intergenic
1071251919 10:83827379-83827401 GTGCCCACCCACATTGAGGGTGG - Intergenic
1072057251 10:91772236-91772258 GTGCCTGCCCAGATTAAGGGTGG - Intergenic
1072568440 10:96637743-96637765 ATGCCTGCCTACCTTGAGGGTGG - Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073675642 10:105644292-105644314 GTGCCCACCCACATTGAGGGTGG - Intergenic
1073827450 10:107340787-107340809 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1073873539 10:107894662-107894684 CTGCTTCCCCTCATGGTGGGAGG + Intergenic
1074010363 10:109472707-109472729 CTGCTTGCCCAGATTCGGAGTGG - Intergenic
1074464415 10:113668734-113668756 GTGCCGACCCACATTGAGGGTGG + Intergenic
1074822904 10:117194782-117194804 CTGCTTTCACACAATGAGGGCGG + Intergenic
1075165746 10:120066820-120066842 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1077468924 11:2747749-2747771 CTGGTTGCCCACAGGGAGTGGGG + Intronic
1078146606 11:8725970-8725992 ATGCCTGCCCACAGTGAAGGAGG + Intronic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1079210818 11:18459191-18459213 GTGCTCACCCAGATTGAGGGTGG - Intronic
1079537145 11:21527907-21527929 GTGCTCACCCAGATTGAGGGTGG + Intronic
1079584351 11:22107353-22107375 TTGCCTACCCACATTGAAGGTGG - Intergenic
1079748210 11:24160153-24160175 GTGCCCACCCACATTGAGGGTGG - Intergenic
1080411877 11:32032849-32032871 CTGCTTGCCCACATTCAATCAGG + Intronic
1080936736 11:36871392-36871414 GTGCCTGCCCCCATTGGGGGTGG + Intergenic
1081243460 11:40734905-40734927 GTTCTTGCGCACATTGCGGGTGG - Intronic
1081548874 11:44094253-44094275 CTGCTTCCCCACATCCAAGGGGG - Intergenic
1081556316 11:44165309-44165331 CTGCTTGTCCACAGAGAGGAAGG - Intronic
1082730055 11:56785136-56785158 GTGCCTGCCCCCATTGAGTGAGG + Intergenic
1082918855 11:58469806-58469828 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1083093455 11:60223626-60223648 GTGCTCTCCCAGATTGAGGGTGG - Intronic
1083790191 11:64979781-64979803 CTGGTTGCTATCATTGAGGGAGG + Intergenic
1084790957 11:71474923-71474945 CTGCGTTCCCACAGTGCGGGAGG + Intronic
1085247592 11:75116196-75116218 GTGCCCACCCACATTGAGGGTGG - Intronic
1085793833 11:79519002-79519024 CTTCTTGCAGACATTGAGGCAGG + Intergenic
1085891456 11:80584776-80584798 GTGCCTGCCTGCATTGAGGGTGG + Intergenic
1085970080 11:81578659-81578681 ATGCCTGCCCACGTTGAGGGTGG - Intergenic
1085981880 11:81735152-81735174 GTGCTCACACACATTGAGGGTGG + Intergenic
1087286581 11:96270885-96270907 GTACCTACCCACATTGAGGGTGG - Intronic
1087575219 11:99981465-99981487 GTGCCTGCCTACACTGAGGGTGG + Intronic
1087731996 11:101789361-101789383 CTGCCCACCCACACTGAGGGTGG + Intronic
1087857009 11:103104173-103104195 ATGCCTGCCCACATTGATGAGGG + Intergenic
1087938592 11:104064994-104065016 GTGCTTACCCAGATTGAGGGTGG - Intronic
1088151472 11:106750318-106750340 ATGCTAACCCACACTGAGGGTGG + Intronic
1089627972 11:119763408-119763430 CTCCCTCCCCACATCGAGGGCGG + Intergenic
1089646732 11:119885317-119885339 CTCCAGGCCCACAGTGAGGGAGG + Intergenic
1090271528 11:125389450-125389472 CAGCTTGACCACCATGAGGGTGG - Intronic
1090426612 11:126611368-126611390 CTGCTTTCACTCTTTGAGGGTGG + Intronic
1090481256 11:127070689-127070711 GTGCCCACCCACATTGAGGGTGG + Intergenic
1090484744 11:127102852-127102874 ATGCTTGCCTACATTGGTGGGGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090907650 11:131091286-131091308 GTGCCTGCCCACATTGGTGGGGG - Intergenic
1091802312 12:3332134-3332156 GTGCCCACCCACATTGAGGGTGG + Intergenic
1091972013 12:4795474-4795496 GTGCCCGCCCAGATTGAGGGTGG + Intronic
1092077626 12:5686460-5686482 CTGTTTCCCCTCATTGAGGGAGG - Intronic
1093037462 12:14346349-14346371 GTGCCCACCCACATTGAGGGTGG - Intergenic
1093347222 12:18053140-18053162 TTGCTTTGCCAAATTGAGGGAGG + Intergenic
1094102092 12:26775665-26775687 GTGCCTGCCCAGATTAAGGGTGG - Intronic
1094604336 12:31937658-31937680 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1095106936 12:38245257-38245279 GTGCCTGCCTACATTGAGGAAGG + Intergenic
1095774257 12:45994875-45994897 GTGCCTGCCCACTTTGAGGGCGG - Intergenic
1096457137 12:51796944-51796966 GTGCCCACCCACATTGAGGGTGG + Intronic
1096896736 12:54828542-54828564 GTACTCACCCACATTGAGGGTGG + Intergenic
1097471251 12:59995009-59995031 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1098233819 12:68399031-68399053 TTGCTTGCTCACTCTGAGGGAGG + Intergenic
1098307233 12:69114454-69114476 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1098774982 12:74601030-74601052 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1098832377 12:75377690-75377712 GTACCTACCCACATTGAGGGTGG + Intronic
1100055516 12:90504304-90504326 ATGCCTGCCCACATTGATGAGGG + Intergenic
1100112247 12:91259875-91259897 CTGCTTTCACATAGTGAGGGTGG - Intergenic
1102303868 12:111790531-111790553 CAGGTTGGCCACATAGAGGGCGG - Exonic
1102476073 12:113189458-113189480 CTCCTTGCTCACCTGGAGGGTGG + Intronic
1102988282 12:117296390-117296412 GTGCCCACCCACATTGAGGGTGG - Intronic
1103228148 12:119305532-119305554 GTGCCTGCCCACACTGAGGATGG - Intergenic
1103241596 12:119417839-119417861 CTTCTTGCTGACATTCAGGGTGG - Intronic
1104133441 12:125916330-125916352 GTGCCCACCCACATTGAGGGAGG - Intergenic
1104263360 12:127205980-127206002 ATGCTCTCCCACATTGAGGGTGG + Intergenic
1104327177 12:127810699-127810721 GTGCCCACCCACATTGAGGGTGG + Intergenic
1104563476 12:129859593-129859615 GTGCCCGCCCACACTGAGGGTGG - Intronic
1105627833 13:22130522-22130544 CTGCATGCCCAAAATGATGGTGG + Intergenic
1105632269 13:22182102-22182124 GTGCCCGCCCAGATTGAGGGTGG + Intergenic
1105700398 13:22931593-22931615 ATGCTTGCTCACTTTGAGGAGGG + Intergenic
1105853165 13:24353637-24353659 ATGCTTGCTCACTTTGAGGAGGG + Intergenic
1107239334 13:38213093-38213115 GTGCCTGCCCAGATTGAGGGTGG - Intergenic
1107336974 13:39365482-39365504 ATGCTTGCCCAAATTGAATGAGG - Intronic
1108788207 13:53932747-53932769 CTGCTTGCCCATATTGTCAGAGG + Intergenic
1108805935 13:54156574-54156596 GTGCCCGCCCACATTGAGGGTGG - Intergenic
1109048199 13:57440253-57440275 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1109257054 13:60096610-60096632 GTGCCTGCCCATACTGAGGGCGG - Intronic
1109981505 13:69913931-69913953 GTGCTCACCCAGATTGAGGGTGG - Intronic
1110477136 13:75929321-75929343 ATGTTGGCCCACATTGTGGGTGG - Intergenic
1110541750 13:76713866-76713888 GTGCCCGCCTACATTGAGGGGGG - Intergenic
1110613397 13:77514161-77514183 GTGCCCACCCACATTGAGGGTGG + Intergenic
1110882399 13:80588157-80588179 GTGCCCACCCACATTGAGGGTGG - Intergenic
1111182402 13:84686488-84686510 GTGCTCACCCACATTGAGAGTGG - Intergenic
1113090367 13:106611784-106611806 GTGCCTACCAACATTGAGGGTGG - Intergenic
1115865442 14:37741687-37741709 CTGCTTCCCACCATTAAGGGAGG - Intronic
1116130490 14:40850344-40850366 GTGCCTACTCACATTGAGGGTGG - Intergenic
1116778806 14:49212897-49212919 ATGCCTGCCCACTTTGAGGGTGG - Intergenic
1117305682 14:54471042-54471064 GTGCTTACCCACACCGAGGGTGG + Intergenic
1118792211 14:69105548-69105570 ATGCCTGCCCACATTAAAGGCGG - Intronic
1119195089 14:72711905-72711927 CTCCTTGCCCAGTTTGGGGGTGG + Intronic
1119907325 14:78317619-78317641 ATGCTTGCCCACATTGGGGAGGG + Intronic
1120362194 14:83518714-83518736 GTGCCTGCCCACACTGAGGGAGG + Intergenic
1121097087 14:91224972-91224994 CTGCATGCCCACTTTCTGGGAGG + Exonic
1121663920 14:95657649-95657671 GTGCCCGCCCACATTGAGGAGGG - Intergenic
1121785111 14:96652626-96652648 ATGCCTGCCCACATTGATGAGGG + Intergenic
1122206960 14:100152459-100152481 GTGCTGGCCCACATTGTGGGCGG - Intronic
1123831759 15:24146314-24146336 CTGCCTTCCCCCATTGAGGGTGG + Intergenic
1123836734 15:24202325-24202347 CTGCCTTCCCCCATTGAGGGTGG + Intergenic
1123837847 15:24214087-24214109 GTGCCTACCCACATAGAGGGTGG + Intergenic
1123845951 15:24302100-24302122 CTGCCTTCCCCCATTGAGGGTGG + Intergenic
1123847383 15:24316386-24316408 GTGCCTACCCACATAGAGGGTGG + Intergenic
1123864988 15:24509810-24509832 CTGCCTTCCCCCATTGAGGGTGG + Intergenic
1123866378 15:24523455-24523477 GTGCCTACCCACATAGAGGGTGG + Intergenic
1123873364 15:24598443-24598465 GTGCTTACCCACATAGAGGGTGG + Intergenic
1123996071 15:25718816-25718838 CTCCTTGCCCACATGGACGGTGG + Intronic
1124644402 15:31426819-31426841 GTGCCTGCCCACAGTGAGGGTGG - Intronic
1126318511 15:47396665-47396687 GTGCTCACCCAGATTGAGGGTGG + Intronic
1126846262 15:52763196-52763218 CTGCTTGCCCACCCTCATGGAGG - Intronic
1127209985 15:56764258-56764280 CTGCTGACCCACATTCAGGAAGG - Intronic
1127238764 15:57087154-57087176 TTGATTGCCCACATTTTGGGAGG + Intronic
1128242262 15:66109064-66109086 CTGCTGGCACTCACTGAGGGTGG + Intronic
1128643129 15:69354794-69354816 GTGTCTGCCCACACTGAGGGTGG - Intronic
1128715938 15:69908080-69908102 CTGCTAGCCCACATGGGAGGAGG + Intergenic
1129077359 15:73008377-73008399 GTGCCTGCCCACATTGAGGGTGG + Intergenic
1130029265 15:80296727-80296749 ATGGCTGCCCACATTGAGGGTGG + Intergenic
1131295835 15:91148408-91148430 CTGTCTCCCCACATTGAGGCTGG - Intronic
1131563563 15:93464953-93464975 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1131896499 15:97037046-97037068 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1133328345 16:4956117-4956139 CTGCTGCCCAACATTGAGGGAGG - Intronic
1133925180 16:10186590-10186612 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1134192744 16:12135138-12135160 ATGCTTGCCCACATTGGTGAGGG + Intronic
1135977844 16:27122596-27122618 GTGCCCACCCACATTGAGGGTGG + Intergenic
1136251307 16:29007342-29007364 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1136730590 16:32408250-32408272 GTGCCCACCCACATTGAGGGTGG - Intergenic
1137816428 16:51402069-51402091 GTGCCCACCCACATTGAGGGTGG + Intergenic
1138750990 16:59420719-59420741 GTGCCTTCCCAGATTGAGGGTGG + Intergenic
1139048671 16:63096226-63096248 GTGCCCACCCACATTGAGGGTGG - Intergenic
1139312327 16:66038070-66038092 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1139761016 16:69185043-69185065 CTGCCTGCCCACATTGGTGAGGG - Intronic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1202995811 16_KI270728v1_random:109065-109087 GTGCCCACCCACATTGAGGGTGG + Intergenic
1203022498 16_KI270728v1_random:421407-421429 GTGCCCACCCACATTGAGGGTGG + Intergenic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1143343752 17:6234256-6234278 CTGGTTGTCCACATTCAGAGGGG + Intergenic
1143353474 17:6306976-6306998 GTGCCCACCCACATTGAGGGTGG - Intergenic
1143364890 17:6400593-6400615 GTGCCCACCCACATTGAGGGTGG - Intronic
1144209589 17:13003119-13003141 CTGAATGCCCACTTTGTGGGAGG - Intronic
1144228606 17:13176355-13176377 CTGAGTGGCCACAATGAGGGTGG - Intergenic
1144269943 17:13605827-13605849 GTGCCTGCCCACACTGAGGGTGG + Intergenic
1147167046 17:38599096-38599118 TTGCTTTGCCACATGGAGGGTGG - Intronic
1151045994 17:70919917-70919939 GTGGTCACCCACATTGAGGGTGG + Intergenic
1151858067 17:76737098-76737120 CAGGTTGTCCACCTTGAGGGAGG + Exonic
1152099258 17:78291613-78291635 CTGCCTGTCCGCATTGAGGAAGG - Intergenic
1152434744 17:80269171-80269193 CTGCCCACCCACATAGAGGGTGG + Intronic
1153526371 18:5998477-5998499 CTGCTTGCTCAGGCTGAGGGTGG + Intronic
1153983143 18:10329620-10329642 TTGCTTGAACACAATGAGGGCGG - Intergenic
1154256099 18:12782029-12782051 GTGCCTGCCCATGTTGAGGGTGG - Intergenic
1157064475 18:44331605-44331627 CTGCCCACCCACATTGAGGGTGG - Intergenic
1157335607 18:46734991-46735013 GTGCCTACCCACATTAAGGGTGG - Intronic
1157819023 18:50751924-50751946 CTCCTTCCCCACCTTGTGGGTGG - Intergenic
1157870626 18:51227116-51227138 GTGCCCACCCACATTGAGGGTGG + Intergenic
1158175870 18:54655026-54655048 CTGCCCACCCACATTGAGGGTGG + Intergenic
1158456060 18:57608845-57608867 GTGCCCACCCACATTGAGGGTGG - Intronic
1158762793 18:60410618-60410640 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1159126807 18:64233526-64233548 TTGCATGCCCACTTGGAGGGAGG + Intergenic
1159478007 18:68949137-68949159 GTGCTCACCCAGATTGAGGGTGG + Intronic
1159836768 18:73346103-73346125 GTGCCCACCCACATTGAGGGAGG + Intergenic
1160092229 18:75838315-75838337 ATGCCTACCCAGATTGAGGGTGG - Intergenic
1160262684 18:77309833-77309855 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1164566154 19:29327453-29327475 CTGAGTGCCCACATGAAGGGTGG - Intergenic
1164644720 19:29850015-29850037 ATGCTTGCCCACATTGGTGAGGG - Intergenic
1168238178 19:55076323-55076345 CTGGATGCCTGCATTGAGGGAGG + Intronic
925138450 2:1535154-1535176 GTGGTTGCCCACAATGGGGGGGG - Intronic
925428693 2:3772542-3772564 CTCCCTGCCCACATTCAGTGAGG - Intronic
926647214 2:15302784-15302806 GTGCTCACCCACATTGAGGGTGG - Intronic
927395560 2:22646624-22646646 ATGCCTGCCCACATTGGGGAGGG - Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928362670 2:30678466-30678488 CTTCTTCCCCACAGTGGGGGAGG + Intergenic
928415953 2:31091897-31091919 GTGCCCACCCACATTGAGGGTGG - Intronic
928699360 2:33883139-33883161 GTGCTCACCCACATTGAGTGTGG - Intergenic
928865981 2:35918294-35918316 GTGGTCACCCACATTGAGGGTGG + Intergenic
931124210 2:59255681-59255703 ATGTTTGTTCACATTGAGGGAGG + Intergenic
931209264 2:60177234-60177256 GTGCCTGCCCACATTGGGTGAGG - Intergenic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
931931812 2:67146391-67146413 CTGGTTGCTCATATTCAGGGGGG - Intergenic
932176896 2:69611167-69611189 GTGCCCACCCACATTGAGGGTGG - Intronic
932358959 2:71089487-71089509 AAGCTTGCCCACAGTGAAGGAGG + Intergenic
932867192 2:75356019-75356041 GTGCTTGCCCACATAGAGGGTGG + Intergenic
932920263 2:75905850-75905872 GTGCCTACCCACATTGTGGGTGG - Intergenic
932948935 2:76270312-76270334 CTGCTTGCACTCATAGTGGGAGG - Intergenic
933504430 2:83160003-83160025 GTGCCTACCCACATTAAGGGTGG + Intergenic
934315125 2:91910932-91910954 GTGCCCACCCACATTGAGGGTGG + Intergenic
934720170 2:96568631-96568653 CTGCTGGCTCAGGTTGAGGGTGG + Intergenic
935187333 2:100745976-100745998 GTGCCAACCCACATTGAGGGAGG + Intergenic
935341711 2:102064978-102065000 CTGATTGCCCATCATGAGGGTGG + Intronic
935526265 2:104171693-104171715 GTGCCCACCCACATTGAGGGTGG - Intergenic
935824950 2:106936650-106936672 GTGCCTACCCAGATTGAGGGTGG + Intergenic
937473450 2:122193061-122193083 CTGCATTCCCAGATTCAGGGTGG + Intergenic
937957525 2:127429968-127429990 GTGCCTGCCCACACTGAGGGCGG - Intergenic
938370563 2:130765805-130765827 CTGCCCACCAACATTGAGGGTGG + Exonic
939204386 2:139081215-139081237 ATGCTTGCCCACATTGGTGAGGG + Intergenic
940063556 2:149599934-149599956 GTATCTGCCCACATTGAGGGTGG + Intergenic
940357700 2:152763610-152763632 GTGCTCACCCACATTGTGGGTGG + Intergenic
940718502 2:157256272-157256294 GTGCCTGCCCACATTGGGTGAGG + Intergenic
941520611 2:166537398-166537420 GTGCCCACCCACATTGAGGGTGG + Intergenic
942987443 2:182160369-182160391 GTGCCTGCCCACATTGAGGGTGG - Intronic
943182630 2:184562435-184562457 GTGCTCACCCAGATTGAGGGTGG - Intergenic
943884978 2:193205024-193205046 GTGCCTACCCAGATTGAGGGTGG - Intergenic
944619394 2:201498498-201498520 GTGCCCACCCACATTGAGGGTGG + Intronic
944713263 2:202354883-202354905 GTGCCTACCCAGATTGAGGGTGG + Intergenic
946255247 2:218437230-218437252 CTGCTTCACCACAATGATGGGGG - Exonic
946307733 2:218865720-218865742 CTGCTCGCCCATATTGGGGTGGG - Intronic
946533809 2:220605437-220605459 GTGCTCACCCAGATTGAGGGTGG + Intergenic
946643117 2:221805208-221805230 TTGCCTACCCACACTGAGGGTGG + Intergenic
947015375 2:225613396-225613418 GTGCCCACCCACATTGAGGGTGG + Intronic
947969121 2:234307093-234307115 CTGTTTTCCCACCTTGGGGGTGG + Intergenic
948344701 2:237285943-237285965 GTGCCCACCCACATTGAGGGTGG - Intergenic
948581446 2:238989663-238989685 TTGCTCACCCACACTGAGGGTGG + Intergenic
948645089 2:239399736-239399758 CTGCTTGCTCTCCGTGAGGGAGG - Intronic
1169774712 20:9240005-9240027 GTGCCTGCCCAGATTGAGGGTGG + Intronic
1172532318 20:35641063-35641085 CTGCTAGGGCACATTGAGGTTGG - Intronic
1174853458 20:54019630-54019652 GTGCCCACCCACATTGAGGGTGG - Intronic
1175357052 20:58376699-58376721 ACCCTTGCCCACGTTGAGGGAGG - Intergenic
1175423641 20:58851223-58851245 CTGCGTGGCCACATGGATGGTGG + Intronic
1175848515 20:62073097-62073119 GTGCTCACTCACATTGAGGGTGG - Intergenic
1176415537 21:6472522-6472544 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1176587399 21:8601425-8601447 GTGCCCACCCACATTGAGGGTGG + Intergenic
1177964874 21:27715358-27715380 GTGCCTGCTTACATTGAGGGTGG + Intergenic
1178057713 21:28818111-28818133 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1178370700 21:32024915-32024937 GTGCCTACCCAGATTGAGGGGGG + Intronic
1178767251 21:35466104-35466126 GTGCCAACCCACATTGAGGGTGG - Intronic
1179691037 21:43080855-43080877 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1180270230 22:10578422-10578444 GTGCCCACCCACATTGAGGGTGG + Intergenic
1180541885 22:16456816-16456838 GTGCCCACCCACATTGAGGGTGG + Intergenic
1180868147 22:19131341-19131363 CTGCTGGCCCACATGACGGGGGG + Exonic
1184269952 22:43374378-43374400 GTGCCTGCCCACATTGGGGAGGG + Intergenic
1185054553 22:48572374-48572396 CTGCATGCCCACTTCCAGGGTGG - Intronic
949140018 3:620632-620654 GTGCCCACCCACATTGAGGGTGG - Intergenic
949293830 3:2497037-2497059 ATGCCTGCCCACATTGATGAGGG + Intronic
949445166 3:4127418-4127440 GTGCCTGCCCAAATTAAGGGTGG - Intronic
949637271 3:5996530-5996552 GTGCCTACCCAGATTGAGGGTGG + Intergenic
950588960 3:13921621-13921643 GTGCTCACCCAGATTGAGGGTGG - Intergenic
950733358 3:14981952-14981974 GTGCTTTCTCAGATTGAGGGTGG + Intronic
950740336 3:15045855-15045877 CTGCCTCTCCTCATTGAGGGAGG - Exonic
951400678 3:22228727-22228749 GTGCTTACCCAGATTGAGAGTGG - Intronic
951471795 3:23064297-23064319 GTGCCCGCCCACATTGAAGGTGG - Intergenic
952903461 3:38124897-38124919 ATGCCTGCCAACACTGAGGGCGG + Intronic
953157533 3:40388075-40388097 CTGCTTGCTCACATGGTTGGCGG - Exonic
953160264 3:40412855-40412877 CTGGTTGACCACATTGAATGTGG + Intronic
953444204 3:42948773-42948795 GTGCTCACCCACATTGAGGGTGG + Intronic
953508877 3:43515280-43515302 AGGCTCACCCACATTGAGGGAGG - Intronic
954877091 3:53809256-53809278 CAGTTTGCCCACGTTGAGGGCGG + Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
956320510 3:67991469-67991491 GTGCCCACCCACATTGAGGGTGG - Intergenic
957712275 3:83877041-83877063 GTGCCCACCCACATTGAGGGTGG - Intergenic
959310182 3:104726162-104726184 GTGCCTACCCATATTGAGGGTGG + Intergenic
959339648 3:105112819-105112841 GTGCTCACCCATATTGAGGGTGG + Intergenic
961041751 3:123683010-123683032 CTGCTTGCCCTCCATGAGGAAGG - Intronic
961649797 3:128411587-128411609 CTGCCTGCCCACATGGAGTGAGG + Intergenic
963314412 3:143743623-143743645 GTGCCTGCCCACAGTGAGAGTGG + Intronic
963538638 3:146559994-146560016 GTGCTCACCCAGATTGAGGGTGG + Intergenic
963766759 3:149344708-149344730 CTGCTTGACCACATTGAAAATGG + Intergenic
964076420 3:152698126-152698148 GTGCCTACCCACATTAAGGGTGG - Intergenic
964201536 3:154122714-154122736 CTGCTTCCCCACTTTGAGGGCGG - Exonic
964626050 3:158761182-158761204 CTACTTGCCCACTTTGGGTGTGG + Intronic
965145714 3:164899617-164899639 GTGCCTGACCACATTGAGGGTGG + Intergenic
965736340 3:171824792-171824814 GTGCCCACCCACATTGAGGGTGG + Intergenic
966262994 3:178002264-178002286 CTGCATCCCCACATTGCAGGAGG + Intergenic
967602068 3:191401867-191401889 GTGCTCCCCCATATTGAGGGTGG + Intergenic
967760355 3:193217323-193217345 GTGCCCACCCACATTGAGGGTGG + Intergenic
967931349 3:194692777-194692799 CTGCTTGCACTCATGGCGGGAGG + Intergenic
967954700 3:194869267-194869289 GGGCTTGCCAACACTGAGGGAGG + Intergenic
970084666 4:12333247-12333269 GTGCCTGCCAAGATTGAGGGTGG + Intergenic
970717317 4:18941413-18941435 GTGCCTCCCCAGATTGAGGGTGG - Intergenic
971456590 4:26850938-26850960 GTGCCTGCTCACATTGAGGGTGG - Intergenic
971947495 4:33300080-33300102 ATGCCTGCCCACGTTGAGGGTGG + Intergenic
971981986 4:33763519-33763541 GTGCCTACCCACATTGAGGGTGG - Intergenic
972614860 4:40688254-40688276 ATGTTTGCCCACATTGGGAGGGG - Intergenic
972964742 4:44495547-44495569 GTGCCTACCCAGATTGAGGGTGG + Intergenic
973060242 4:45715394-45715416 TTGCTTACCCCCATTGAGGAGGG - Intergenic
974345794 4:60679508-60679530 GTGCCTGCCCAGATTGAGAGTGG + Intergenic
974975770 4:68889095-68889117 GTGCCTGCCCACATTGAGGGTGG + Intergenic
975225837 4:71870817-71870839 CTGCCTGCCCACATTAACGGCGG + Intergenic
975235452 4:71990177-71990199 GTGCCCACCCACATTGAGGGTGG - Intergenic
977203954 4:94148956-94148978 GTGCCCACCCACATTGAGGGTGG - Intergenic
977553105 4:98463195-98463217 CTGCCTACCCAGATTGAGGGTGG - Intergenic
977871676 4:102097861-102097883 GTGCCCACCCACATTGAGGGTGG - Intergenic
977985339 4:103376064-103376086 GTGCTCACCCACATTGAAGGTGG - Intergenic
979148852 4:117281310-117281332 GTGCATCCCCTCATTGAGGGTGG + Intergenic
979441669 4:120757605-120757627 ATGCCTGCCCACATTGGGTGAGG - Intronic
979889068 4:126066419-126066441 GAGACTGCCCACATTGAGGGTGG + Intergenic
979917484 4:126454232-126454254 TTGTTTACCCACACTGAGGGTGG - Intergenic
980001312 4:127492122-127492144 CTGCTTGCCTACATTGAAAGAGG + Intergenic
980575779 4:134682363-134682385 AAGCTTGCCCATAGTGAGGGAGG + Intergenic
980933929 4:139208221-139208243 GTGCCCACCCACATTGAGGGTGG + Intergenic
981135553 4:141207074-141207096 GTACTCACCCACATTGAGGGTGG + Intronic
981679308 4:147376845-147376867 TTCCCTGCCCACATTGAGGATGG + Intergenic
981885169 4:149665769-149665791 GTGCCTACCCAGATTGAGGGTGG - Intergenic
982162551 4:152584705-152584727 GTGCCCACCCACATTGAGGGTGG + Intergenic
983049117 4:163023401-163023423 GTGCCTGCCCAGATTAAGGGTGG - Intergenic
983228391 4:165106503-165106525 GTGCTTGCCCATATTGAGGGTGG - Intronic
983235841 4:165178551-165178573 CTGCCTGGTCACATTGAGGGTGG - Intronic
984717784 4:182942037-182942059 GTGCCTGCTCACACTGAGGGTGG - Intergenic
984726666 4:183028437-183028459 GTGCCCACCCACATTGAGGGTGG + Intergenic
985199245 4:187467152-187467174 GTGCTTGCCCACATTGGTGAGGG + Intergenic
986760748 5:10877472-10877494 GTGCCTACCCACATTGAGGGAGG + Intergenic
986921133 5:12683415-12683437 ACGCCCGCCCACATTGAGGGTGG - Intergenic
987738062 5:21870351-21870373 GTCCCTGCCCTCATTGAGGGTGG - Intronic
987915286 5:24205024-24205046 GTGCTCGCCCAGATTGAAGGTGG - Intergenic
988258518 5:28851567-28851589 CTGCCTACCCACATTGAAGATGG - Intergenic
988361040 5:30236991-30237013 GTGCATCCCCACACTGAGGGTGG - Intergenic
989384643 5:40843181-40843203 CTGCTTGCCCCCATAGATTGAGG - Exonic
990282915 5:54270892-54270914 GTGCCTGCCCACATTGAGGGTGG - Intronic
990618736 5:57536907-57536929 GTGCTTACCCAGTTTGAGGGTGG + Intergenic
990833838 5:59991969-59991991 GTGCCTACCCACATGGAGGGTGG - Intronic
992103109 5:73426390-73426412 GTGCCTGTCCACATAGAGGGTGG - Intergenic
992769325 5:80032780-80032802 GTGCCTACCCAGATTGAGGGTGG + Intronic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
995287920 5:110413126-110413148 ATGCCCACCCACATTGAGGGTGG - Intronic
995654655 5:114411742-114411764 GTGCTCACCCACGTTGAGGGTGG + Intronic
995775017 5:115715832-115715854 ATGCTTGCCCAGATTAGGGGAGG + Intergenic
996810796 5:127514640-127514662 CTGCTTGCCTGCTTTGTGGGTGG - Intergenic
996976500 5:129440693-129440715 GTGCCTGCCCACATTGAGGGCGG + Intergenic
997001909 5:129771561-129771583 CAGCTTGCCTATTTTGAGGGCGG + Intergenic
997338545 5:133124544-133124566 GTGCCTGCCCACATTGGGTGAGG + Intergenic
997730505 5:136169319-136169341 GTGCCTACCCAGATTGAGGGTGG + Intronic
998514981 5:142744631-142744653 ATGCCTGCCCACATTGATGAGGG - Intergenic
998763420 5:145457399-145457421 TTGCTTTCCAACATAGAGGGTGG - Intergenic
999576092 5:152978972-152978994 GTGCCCACCCACATTGAGGGTGG - Intergenic
1000223757 5:159238287-159238309 GTGCTCACCCACATTGAGGGTGG + Intergenic
1000225529 5:159257631-159257653 GTGCCTGCCCACATTGCGGGTGG - Intergenic
1000423382 5:161062431-161062453 GTGTTTGCCCACCCTGAGGGTGG + Intergenic
1000598858 5:163248236-163248258 GTGCACACCCACATTGAGGGTGG - Intergenic
1001796468 5:174506376-174506398 GTCCTTGCCCACAGGGAGGGAGG + Intergenic
1003659032 6:8043190-8043212 CTCCCTGCCCAAAATGAGGGTGG + Intronic
1003772695 6:9324306-9324328 ATGCTTTCCCTCATTGTGGGTGG + Intergenic
1005581743 6:27241749-27241771 CTGCTTGCACACACAGAGGAGGG - Intergenic
1005857485 6:29873532-29873554 CTACTTTCACACAATGAGGGCGG + Intergenic
1006302946 6:33203793-33203815 CTGATTGCCCACCTTGAGTGAGG + Exonic
1006976666 6:38108684-38108706 GTGCCTACCCACATTGAGGGTGG + Intronic
1009631064 6:66201797-66201819 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1010325927 6:74561880-74561902 CTGCCCACCCACATTGAGGGTGG - Intergenic
1010629449 6:78180048-78180070 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1011324455 6:86134168-86134190 GTGCCCACCCACATTGAGGGTGG + Intergenic
1012096836 6:94972800-94972822 GTGCCCACCCACATTGAGGGTGG + Intergenic
1012720508 6:102736686-102736708 GTGCCCACCCACATTGAGGGTGG - Intergenic
1012730794 6:102877161-102877183 GTGCCTACCCACATTAAGGGTGG - Intergenic
1013851363 6:114520060-114520082 GTGCCTAACCACATTGAGGGTGG + Intergenic
1013887489 6:114987937-114987959 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1013968187 6:115982101-115982123 ATGCTGGCCCACATTGATGAGGG - Intronic
1014715196 6:124856727-124856749 ATGCTGGCCCACATTGATGAGGG - Intergenic
1015095130 6:129407122-129407144 GTGCCCACCCACATTGAGGGTGG + Intronic
1015378999 6:132545444-132545466 ATGGTTGCCCACATTGAGCAAGG + Intergenic
1016629710 6:146214095-146214117 GTGCCTGGCCACTTTGAGGGTGG + Intronic
1017053290 6:150414192-150414214 GTGCCTGCCCAGATTGAGGGTGG - Intergenic
1017357643 6:153528484-153528506 GTTCTTTCCCAGATTGAGGGTGG + Intergenic
1017395860 6:153999313-153999335 GTGCTTGCCCAGATTAAGGGTGG + Intergenic
1017618983 6:156275509-156275531 GTGCTTGTTCACATTGAGAGGGG - Intergenic
1017744582 6:157435330-157435352 GTGCTTGCACACATGGAGGGAGG + Intronic
1018269855 6:162065443-162065465 GTGCCTACCCACATTGAGGATGG + Intronic
1018606585 6:165603882-165603904 CTGCTTCAGCAAATTGAGGGTGG - Intronic
1019027801 6:168985801-168985823 GTGCTTCCCCCCATTGAGGGTGG - Intergenic
1019085504 6:169471909-169471931 CTGCTTCCTCACATGGCGGGAGG + Intronic
1020623710 7:10551079-10551101 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1020751713 7:12148938-12148960 ATGCCTCCCCACAGTGAGGGTGG + Intergenic
1020978144 7:15033358-15033380 GTGCCTACCCACCTTGAGGGTGG - Intergenic
1021367226 7:19794963-19794985 GTGCCCACCCACATTGAGGGTGG - Intergenic
1022979245 7:35588665-35588687 GTGCCCACCCACATTGAGGGTGG - Intergenic
1024087790 7:45911053-45911075 ATGCCTGCCCACATTGGGGAGGG + Intergenic
1024568564 7:50705186-50705208 CTGCTTCCCCCCATTGTGAGTGG - Intronic
1026140719 7:67704044-67704066 GTGCCCACCCACATTGAGGGTGG + Intergenic
1027692844 7:81369876-81369898 GTGCTCACCCATATTGAGGGTGG - Intergenic
1027794874 7:82679764-82679786 GTGCTCACCCACATAGAGGGTGG - Intergenic
1027922875 7:84418514-84418536 GTGCCCACCCACATTGAGGGTGG - Intronic
1027942511 7:84702212-84702234 GTGCCTGCCCAGACTGAGGGTGG + Intergenic
1029040290 7:97566016-97566038 GTGCTTGTCCACATTCAGGGTGG + Intergenic
1029573200 7:101385079-101385101 GTGCCCACCCACATTGAGGGTGG + Intronic
1030157286 7:106467987-106468009 GTGCCTGCCCACATTGGGTGAGG + Intergenic
1030708745 7:112723891-112723913 GTGCCCACCCACATTGAGGGTGG + Intergenic
1031512252 7:122665181-122665203 CTGCTTGCCCACATGCAGACAGG - Intronic
1031636539 7:124108050-124108072 GTGCTTGCCCACACCGAGGGTGG - Intergenic
1032697678 7:134351552-134351574 CTGCCTGTCCTCATTGATGGGGG - Intergenic
1033487955 7:141809994-141810016 CTGCCCACCCACATTGGGGGTGG + Intergenic
1034824791 7:154251834-154251856 GTGCCCACCCACATTGAGGGTGG + Intronic
1036032293 8:4987737-4987759 GTGCCCACCCACATTGAGGGAGG - Intronic
1036491392 8:9229329-9229351 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1037777132 8:21842907-21842929 CTGCTTTATCTCATTGAGGGAGG - Intergenic
1038746782 8:30261742-30261764 GCGTCTGCCCACATTGAGGGTGG - Intergenic
1039313765 8:36349166-36349188 ATGCCCGCCCACAGTGAGGGTGG - Intergenic
1043001795 8:74768657-74768679 GTGTCTACCCACATTGAGGGTGG + Intronic
1045342919 8:101270373-101270395 GTGCCTGCCCACATTGATGAGGG - Intergenic
1046647915 8:116805822-116805844 GTGCCCACCCACATTGAGGGTGG + Intronic
1047102936 8:121699084-121699106 CTGGCTGCCCACATTGCTGGTGG - Intergenic
1047160236 8:122369963-122369985 CTGCCCACCCACATTGAGGTTGG + Intergenic
1048180380 8:132189078-132189100 CTGCTTCCCCACATCCAGGCTGG + Intronic
1048908405 8:139110690-139110712 GTGCCTACCCACATTGAGGGTGG + Intergenic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1050498275 9:6267064-6267086 GTGCCTACCCACATTGAGGGTGG - Intergenic
1050665874 9:7936240-7936262 ATGGTTGCCCACACTGAGGAAGG + Intergenic
1052561265 9:30087514-30087536 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1053095836 9:35327600-35327622 GTGCCCACCCACATTGAGGGTGG + Intronic
1055515630 9:77030484-77030506 GTGCCCGCCCACATCGAGGGTGG - Intergenic
1055648743 9:78386458-78386480 CAGCTTGCTCACATGTAGGGCGG - Intergenic
1056499441 9:87193435-87193457 CTGTTTGCCCATATTCATGGAGG + Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058071954 9:100610234-100610256 GTGCCTACTCACATTGAGGGTGG + Intergenic
1059192704 9:112342026-112342048 ATGCCTGCCCACATTGGGTGAGG - Intergenic
1061226565 9:129284065-129284087 CTGCCTGTCCACACTGAGTGCGG + Intergenic
1061522251 9:131125678-131125700 CTGCTTCGACACACTGAGGGCGG + Exonic
1062179230 9:135181838-135181860 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1203617359 Un_KI270749v1:79607-79629 GTGCCCACCCACATTGAGGGTGG + Intergenic
1186288222 X:8068718-8068740 GTGCTCATCCACATTGAGGGTGG - Intergenic
1188127766 X:26391330-26391352 GTGCCCGCCCACATTGATGGTGG + Intergenic
1188387192 X:29575564-29575586 GTGCCCACCCACATTGAGGGTGG + Intronic
1188647611 X:32590500-32590522 GTGCCCACCCACATTGAGGGTGG - Intronic
1189297951 X:39931993-39932015 CTGCCTGCCCACCTTGAGAGTGG - Intergenic
1190793294 X:53719868-53719890 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1190881267 X:54494506-54494528 CTGCTTCCCCAAACTGAGGCTGG - Intronic
1191178517 X:57534021-57534043 GTGCCCACCCACATTGAGGGTGG - Intergenic
1191631559 X:63327411-63327433 ATGCCTTCCCACATTGATGGTGG - Intergenic
1192412582 X:70947489-70947511 GTGCCTGCCTACATTGAGGGTGG - Intergenic
1192996479 X:76518089-76518111 CTGCCCACCCAGATTGAGGGTGG - Intergenic
1194079659 X:89444180-89444202 GTGTTTGCCCATGTTGAGGGTGG + Intergenic
1194521400 X:94922593-94922615 GTGCTCACCCACATTGAGGGTGG - Intergenic
1194591053 X:95800261-95800283 GTGCCCACCCACATTGAGGGTGG - Intergenic
1195164935 X:102210017-102210039 GTGCCTGCCCACATTAACGGTGG - Intergenic
1195193923 X:102477074-102477096 GTGCCTGCCCACATTAACGGTGG + Intergenic
1195309195 X:103614441-103614463 GTGCCTACCCAGATTGAGGGTGG - Intronic
1196018473 X:110964765-110964787 CAGTCTGCCCACAATGAGGGTGG + Intronic
1197114431 X:122816485-122816507 ATGCCTACCCACACTGAGGGTGG + Intergenic
1198047412 X:132916549-132916571 GTGCTCACCCAGATTGAGGGTGG - Intronic
1198709192 X:139482931-139482953 GTGCTTGCCCACATTGAAGGTGG - Intergenic
1199155885 X:144548854-144548876 GTGCCTGCCCAAATTGAAGGTGG - Intergenic
1199520108 X:148725490-148725512 CTGCTTGCCCACAAAGTTGGAGG - Intronic
1199785268 X:151099556-151099578 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1200432281 Y:3099484-3099506 GTGTTTGCCCATGTTGAGGGTGG + Intergenic
1201182796 Y:11365742-11365764 GTGCCCACCCACATTGAGGGTGG + Intergenic
1201389228 Y:13479432-13479454 CAGCTTGCCCACGTTGATGACGG - Intronic