ID: 922640085 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:227221531-227221553 |
| Sequence | TAGTGGGAAGGGAGGGTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2530 | |||
| Summary | {0: 1, 1: 3, 2: 9, 3: 187, 4: 2330} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922640085_922640100 | 25 | Left | 922640085 | 1:227221531-227221553 | CCACCCACCCTCCCTTCCCACTA | 0: 1 1: 3 2: 9 3: 187 4: 2330 |
||
| Right | 922640100 | 1:227221579-227221601 | TATTTCAACAGAAAAATAATAGG | 0: 1 1: 0 2: 5 3: 81 4: 1000 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922640085 | Original CRISPR | TAGTGGGAAGGGAGGGTGGG TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||