ID: 922640085

View in Genome Browser
Species Human (GRCh38)
Location 1:227221531-227221553
Sequence TAGTGGGAAGGGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2530
Summary {0: 1, 1: 3, 2: 9, 3: 187, 4: 2330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922640085_922640100 25 Left 922640085 1:227221531-227221553 CCACCCACCCTCCCTTCCCACTA 0: 1
1: 3
2: 9
3: 187
4: 2330
Right 922640100 1:227221579-227221601 TATTTCAACAGAAAAATAATAGG 0: 1
1: 0
2: 5
3: 81
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922640085 Original CRISPR TAGTGGGAAGGGAGGGTGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr