ID: 922641740

View in Genome Browser
Species Human (GRCh38)
Location 1:227239250-227239272
Sequence TCTCCCTCACCACTGACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 479}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922641740_922641743 20 Left 922641740 1:227239250-227239272 CCAGGGGTCAGTGGTGAGGGAGA 0: 1
1: 0
2: 7
3: 52
4: 479
Right 922641743 1:227239293-227239315 ACAGAAGATTTCTAGGGCAGTGG 0: 1
1: 1
2: 28
3: 63
4: 366
922641740_922641742 14 Left 922641740 1:227239250-227239272 CCAGGGGTCAGTGGTGAGGGAGA 0: 1
1: 0
2: 7
3: 52
4: 479
Right 922641742 1:227239287-227239309 CAGAGCACAGAAGATTTCTAGGG 0: 1
1: 18
2: 176
3: 395
4: 878
922641740_922641741 13 Left 922641740 1:227239250-227239272 CCAGGGGTCAGTGGTGAGGGAGA 0: 1
1: 0
2: 7
3: 52
4: 479
Right 922641741 1:227239286-227239308 ACAGAGCACAGAAGATTTCTAGG 0: 1
1: 3
2: 43
3: 245
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922641740 Original CRISPR TCTCCCTCACCACTGACCCC TGG (reversed) Intronic
900228208 1:1542660-1542682 TCGCCATCTCCACTGTCCCCTGG + Intronic
900295143 1:1945274-1945296 TCTCCCCAAGCACTGACTCCTGG + Intronic
900365250 1:2309589-2309611 TCTCCGTCTCCCCTGCCCCCCGG - Exonic
900690283 1:3976742-3976764 TCTCTCTGCCCACTCACCCCTGG - Intergenic
900793796 1:4695489-4695511 TCTCCATCTCCACTCTCCCCTGG - Intronic
900902642 1:5527350-5527372 TCTTTCTCACTACTGTCCCCTGG - Intergenic
901019198 1:6247457-6247479 ACTCCCTCCCCAGTGAGCCCAGG + Exonic
901183793 1:7359217-7359239 GCTGGCTCCCCACTGACCCCTGG - Intronic
901527834 1:9835395-9835417 TCTCCCTCATCAGAGACCCAGGG - Intergenic
902375286 1:16027469-16027491 TCTCCCTCGCCCCGGCCCCCAGG - Intronic
903128040 1:21261016-21261038 TCTCCCTCACCTCAGTGCCCTGG + Intronic
903162769 1:21501212-21501234 TCTCCTTCACCCCTGACACAGGG - Intergenic
903313685 1:22482648-22482670 CCTCCCTCTCCTCTAACCCCTGG + Intronic
903649385 1:24913729-24913751 GCTCCTTTACCACTGTCCCCAGG + Intronic
903660346 1:24973302-24973324 TCTCCCTCACCCCTGCTTCCTGG - Intergenic
903741299 1:25560153-25560175 GCTGCCTCACCACCCACCCCAGG - Intronic
904088896 1:27930722-27930744 TCTGCTGCACCTCTGACCCCAGG + Intergenic
904238220 1:29127565-29127587 TCTGCCACCCCAGTGACCCCAGG - Intergenic
904952170 1:34251436-34251458 GGTCCCTGACCCCTGACCCCCGG + Intergenic
905279756 1:36841615-36841637 TCTCCATCACTCCTGTCCCCAGG + Intronic
905831034 1:41067636-41067658 CCTCCCTCCCCACTAATCCCTGG - Intronic
907239737 1:53074800-53074822 TCTCCCCCACCCCCGACCCAGGG - Intronic
907276851 1:53321538-53321560 TCTCGCTCCTCACTGCCCCCTGG + Intronic
909114264 1:71514405-71514427 GGTCCCTGACCCCTGACCCCCGG + Intronic
910242741 1:85105241-85105263 TCTCCCTCATCCCTGGCCCATGG - Intronic
911678425 1:100685690-100685712 TATCCCTGCCCACTAACCCCCGG + Intergenic
912918675 1:113843517-113843539 TCTCCCCTCCCACTGGCCCCTGG - Intronic
912959213 1:114180650-114180672 TCAGCCTCTCCCCTGACCCCTGG + Intergenic
913054840 1:115148506-115148528 GGTCCCTGACCCCTGACCCCCGG + Intergenic
915270157 1:154747992-154748014 TCTCCCTCACTTCTCACCACCGG + Intronic
916657980 1:166894464-166894486 CCTTCCTCCCCACTAACCCCTGG + Intergenic
917143327 1:171859953-171859975 TCTCCCTCTCGACTGAGCTCTGG - Intronic
917152845 1:171963360-171963382 TCTCCCTCTCCCCTAACCCCAGG - Intronic
918789042 1:188801697-188801719 TCTCCTTCTCCACTGAATCCTGG - Intergenic
918836600 1:189474049-189474071 GGTCCCTGACCCCTGACCCCGGG - Intergenic
920048969 1:203151945-203151967 TGCCCCTCACCACTGCCCCTGGG + Intronic
920571450 1:207021120-207021142 TCTCAGTCTGCACTGACCCCAGG - Exonic
921218979 1:212959980-212960002 TCTCTGTCACCAAGGACCCCAGG + Intronic
921802638 1:219418806-219418828 TCTCCATCTCCTCTCACCCCTGG + Intergenic
922237754 1:223734578-223734600 CCTCCCTCCTCACTGACCCCCGG + Intronic
922495342 1:226052995-226053017 TCTCTTTCATCACTGACTCCTGG + Intergenic
922641740 1:227239250-227239272 TCTCCCTCACCACTGACCCCTGG - Intronic
923654171 1:235901012-235901034 TCTTCATTACCACTGACCCAGGG - Intergenic
1063534854 10:6873403-6873425 TCTCCCTCCCACCTGACCCGTGG + Intergenic
1063564195 10:7158045-7158067 TCTCCCTCAACTCTGTCCCTAGG + Intergenic
1063613907 10:7586024-7586046 TCTCCATGACCTCCGACCCCAGG - Exonic
1063701235 10:8387258-8387280 GCTCTCTCACCACTGCACCCAGG - Intergenic
1064922140 10:20531127-20531149 GGTCCCTGACCCCTGACCCCAGG - Intergenic
1065129890 10:22609933-22609955 TCTCCCTCACCACTGCCGTCCGG - Intronic
1066676963 10:37897665-37897687 GGTCCCTGACCCCTGACCCCCGG + Intergenic
1066761396 10:38756935-38756957 TCAACCTCACCACTAACCCTTGG - Intergenic
1066960186 10:42215489-42215511 TCAACCTCACCACTAACCCTTGG + Intergenic
1067203110 10:44191948-44191970 CCTCCCTCCCCACTAATCCCTGG - Intergenic
1067455386 10:46415528-46415550 TCTCCACCTCCACTGACCTCTGG + Intergenic
1067631817 10:47969107-47969129 TCTCCACCTCCACTGACCTCTGG - Intergenic
1067850429 10:49750773-49750795 TCTCTCCCACCTCTGTCCCCTGG + Intronic
1068085167 10:52365624-52365646 GGTCCCTGACCCCTGACCCCAGG - Intergenic
1068903404 10:62296062-62296084 TCTCCCTCAACCCCAACCCCTGG - Intergenic
1068928446 10:62564183-62564205 TGTCCTTCACCTCTGACCACGGG + Intronic
1069213949 10:65796503-65796525 TCTCCCTCACCACCTACCCGTGG - Intergenic
1069288728 10:66749372-66749394 TCTCCCTCTTCACTATCCCCTGG + Intronic
1069669795 10:70192576-70192598 AATCACTCACCACTGAGCCCAGG - Intergenic
1069789913 10:71012993-71013015 TCTCCCTCTCCCCAGACTCCAGG + Intergenic
1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG + Intronic
1070964994 10:80524432-80524454 TGTCCCCCAGCACTGCCCCCAGG - Exonic
1072081478 10:92037116-92037138 TCTCCCTCACCACCAATCCATGG + Intergenic
1072294920 10:93999705-93999727 CCTCGCTCACCACAGACCGCTGG + Intronic
1072803226 10:98407713-98407735 TCTCCATCCCTGCTGACCCCTGG - Intronic
1072803234 10:98407742-98407764 TCTCCATCCCTGCTGACCCCTGG - Intronic
1072803242 10:98407771-98407793 TCTCCATCCCTGCTGACCCCGGG - Intronic
1072803251 10:98407800-98407822 TCTCCATCCCTGCTGACCCCGGG - Intronic
1072803260 10:98407829-98407851 TCTCCATCCCTGCTGACCCCGGG - Intronic
1075016310 10:118912326-118912348 TCTCCCTCCCCACTCACCCCTGG + Intergenic
1075160470 10:120020324-120020346 TCTTCCTCACCAGTGAAACCAGG - Intergenic
1075932904 10:126314291-126314313 TCTCCCTCACCAGGGACACCTGG - Intronic
1076465303 10:130676956-130676978 TCTCCCTTGCCAGTGAGCCCTGG - Intergenic
1076624849 10:131815550-131815572 CCTCCCTCTCCTCTCACCCCCGG - Intergenic
1076831364 10:132996075-132996097 TGTCCCTCACCTCTGACCCCTGG + Intergenic
1077037634 11:502992-503014 TCTGCCTGACCACTTTCCCCAGG - Exonic
1077109450 11:855622-855644 GTTCCCTCACCCCTGACCCTAGG - Intronic
1077389877 11:2295580-2295602 CCTCCCTCCCCACTGACTCCTGG - Intergenic
1078263483 11:9734197-9734219 TTTCCCTCATCCCTAACCCCTGG + Intronic
1079470259 11:20771146-20771168 TGTCCCTCACCACTGACCTCTGG + Intronic
1079730019 11:23928846-23928868 TCTCCCTCCCCGCACACCCCTGG + Intergenic
1080565140 11:33501955-33501977 TCTCCCTCACCACTGGCTTCTGG - Intergenic
1080831115 11:35894162-35894184 TCTCACTCATCTCTGACCCAAGG - Intergenic
1081014196 11:37855820-37855842 TCTCCTTTACCACTGACTCCTGG + Intergenic
1084305896 11:68283106-68283128 TCTCCCTCAGCACCCACCCAGGG - Intergenic
1084321826 11:68377549-68377571 TTTGCCCCACCACTTACCCCTGG + Intronic
1084481795 11:69425818-69425840 CCTCCCTCCCCGCTAACCCCTGG - Intergenic
1084482174 11:69428349-69428371 TCCCCCTCACCCCTGACTACTGG - Intergenic
1087561594 11:99796917-99796939 CTGCCCTCACAACTGACCCCTGG - Intronic
1088498094 11:110452913-110452935 TCTACCTCATCCCTAACCCCTGG - Intronic
1088788669 11:113204849-113204871 TCCCCCACCCCACTGAGCCCTGG - Intronic
1089608695 11:119657240-119657262 TCTTCCTCATGACTGACACCTGG + Intronic
1089932326 11:122325964-122325986 CCTCCCTCCCCGCTAACCCCTGG - Intergenic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1091209531 11:133844463-133844485 TCTCCCTCACCGCTACTCCCAGG + Intronic
1092820651 12:12350427-12350449 TCAGCCACACCGCTGACCCCGGG + Exonic
1093631916 12:21419901-21419923 GGTCCCTGACCCCTGACCCCCGG + Intergenic
1093642841 12:21547604-21547626 CCTCCCTCACCCCTGACGCCTGG - Intronic
1094144544 12:27214689-27214711 TCTCATTCACTTCTGACCCCAGG - Intergenic
1094149233 12:27264009-27264031 TCAACCTCACCACTAACCCTTGG - Intronic
1096159971 12:49367758-49367780 TCACCCGCCCCACAGACCCCAGG - Intronic
1096257358 12:50071623-50071645 TCTCACTCCCCACTGCCTCCTGG - Intronic
1096869280 12:54583355-54583377 TGTCCCTCACATCTGCCCCCAGG + Intronic
1097432922 12:59530550-59530572 TCACCCTCTCCCCCGACCCCCGG - Intergenic
1097513594 12:60574252-60574274 TCTCCCTCCCCACTAACTTCTGG - Intergenic
1098041258 12:66355954-66355976 TCCCCCTCACCCCTCACCCAAGG + Intronic
1099241975 12:80149378-80149400 GGTCCCTGACCCCTGACCCCTGG - Intergenic
1099656215 12:85495289-85495311 TCTCCATGACCTCTGACTCCAGG - Intergenic
1101553513 12:105785317-105785339 TGTACCTCAGCACAGACCCCTGG - Intergenic
1101635533 12:106537632-106537654 TCTTCCACACAACTGATCCCTGG + Intronic
1101649459 12:106661723-106661745 TCTCCCTGTCCCCTAACCCCTGG + Intronic
1101771599 12:107756815-107756837 TCTCCCTTACCACTCACCTGGGG + Exonic
1102433354 12:112900801-112900823 GCTGCCCCACCCCTGACCCCTGG + Intergenic
1102599857 12:114021536-114021558 TCTCCCTCCCCCCTCATCCCTGG + Intergenic
1102812496 12:115836580-115836602 TCTTCCTCACCACTTAACACTGG + Intergenic
1102951866 12:117036582-117036604 GCTCCCACACCCCTGCCCCCTGG - Intergenic
1102956552 12:117062855-117062877 TCTGCCTCACCTCAGAGCCCAGG + Intronic
1103415952 12:120741560-120741582 ACCCCCTCCCCACTGTCCCCGGG - Intergenic
1103922808 12:124407901-124407923 TCTGCCTCGGCTCTGACCCCTGG - Intronic
1104470740 12:129027636-129027658 TTTCCCTCACCCCTGACTCTTGG - Intergenic
1104757807 12:131279701-131279723 CCTGCCTCACCCCCGACCCCAGG - Intergenic
1105052936 12:133070944-133070966 TCACTCCCATCACTGACCCCAGG + Intergenic
1106127347 13:26911295-26911317 TCTCCCTCACCACTCGCTGCAGG - Intergenic
1106939284 13:34759379-34759401 CCTCCCTCCCCTCTAACCCCTGG + Intergenic
1107635150 13:42384804-42384826 TCTCCCTCATCTCTGAGGCCTGG - Intergenic
1110328126 13:74241254-74241276 GGTCCCTGACCCCTGACCCCCGG - Intergenic
1111233073 13:85370340-85370362 CCTCCCTCAACTCTCACCCCAGG + Intergenic
1112453721 13:99538119-99538141 TCTCCCTCCCCACTGACACGTGG - Intronic
1113434091 13:110275891-110275913 ACCCCCTTACCTCTGACCCCTGG - Intronic
1113886612 13:113664107-113664129 TCTCACTCAGCACTGTTCCCAGG - Intergenic
1113904278 13:113812039-113812061 CCTCCCTCACCAGTGTGCCCAGG - Exonic
1114295521 14:21325748-21325770 TCTTCCTCACCACAGATCCTAGG + Intronic
1115858751 14:37660374-37660396 TCTCCCCCACACCTCACCCCTGG + Intronic
1115914909 14:38301573-38301595 TCACTCTCACCACAGACCTCTGG + Intergenic
1116906551 14:50409180-50409202 TGTCCCCCATCCCTGACCCCTGG + Intronic
1117434673 14:55704481-55704503 TCTCCCTCCCTCCTGGCCCCAGG + Intergenic
1117657511 14:57971726-57971748 TGTCCCTCACCCCTTAGCCCTGG - Intronic
1118316255 14:64727910-64727932 TCTCCCGCACCACTCGGCCCAGG - Exonic
1118358381 14:65035187-65035209 CCGCCCTGACCCCTGACCCCTGG + Intronic
1118535193 14:66756056-66756078 TCTCCTTTACCTCTAACCCCAGG + Intronic
1118740544 14:68736699-68736721 CCTCCCTCACCGCTGGGCCCTGG + Intergenic
1118808490 14:69257720-69257742 GCATCCTCACCACTGAGCCCTGG + Intergenic
1118844327 14:69535364-69535386 TCTCCCTCCCCACTGTGGCCTGG + Intergenic
1119524460 14:75311054-75311076 TCTCCCAGCCCACTGCCCCCCGG - Intergenic
1119567673 14:75642247-75642269 CCTCCCCAGCCACTGACCCCAGG - Intronic
1119640030 14:76308014-76308036 TCTTCCTGACCTCTGACCTCTGG + Intergenic
1121994333 14:98590420-98590442 TCTCCCCCATCACTAAACCCTGG - Intergenic
1122348503 14:101074685-101074707 TCTCCCTCTCCACTCATCCCAGG - Intergenic
1122800775 14:104228517-104228539 CCTCCCTCACCACTGCCACCTGG + Intergenic
1122952126 14:105050832-105050854 CCTCCGTGACCACTGGCCCCAGG - Exonic
1123011590 14:105352492-105352514 ACACCCTCATCACTGTCCCCTGG + Intronic
1123011601 14:105352524-105352546 CCCCCCTCATCACTGTCCCCTGG + Intronic
1123011614 14:105352556-105352578 CCCCCCTCATCACTGTCCCCTGG + Intronic
1123011747 14:105352902-105352924 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123011783 14:105352997-105353019 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123011833 14:105353124-105353146 ACCCCCTCATCACTGTCCCCTGG + Intronic
1123011871 14:105353220-105353242 ACCCCCTCATCACTGTCCCCTGG + Intronic
1123011921 14:105353344-105353366 GCGCCCTCATCACTGTCCCCTGG + Intronic
1123011932 14:105353376-105353398 CCCCCCTCATCACTGTCCCCTGG + Intronic
1123011945 14:105353408-105353430 CCCCCCTCATCACTGTCCCCTGG + Intronic
1123011957 14:105353439-105353461 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123082365 14:105701623-105701645 TGTTCCTGACCACTGAGCCCTGG - Intergenic
1202932107 14_KI270725v1_random:47217-47239 TCCACCTCACCACTAACCCTTGG - Intergenic
1125477959 15:40060366-40060388 TCCCCCTCACCCCTGCTCCCTGG + Intergenic
1126885044 15:53140758-53140780 GGTCCCTGACCCCTGACCCCCGG - Intergenic
1126967131 15:54066893-54066915 TCCCCTTCAGCACTGATCCCTGG - Intronic
1127067129 15:55252210-55252232 TATCCCTCACCACCCTCCCCCGG - Intronic
1127136006 15:55924331-55924353 TCTCACTCGCCCATGACCCCTGG - Intronic
1128546139 15:68569294-68569316 CATCCCTCCCCACTAACCCCTGG + Intergenic
1129256635 15:74337560-74337582 TCTGCCTCACCCCTTGCCCCAGG + Intergenic
1130051803 15:80490100-80490122 TCTCTCTCACCACTTTCTCCTGG - Intronic
1130094026 15:80842903-80842925 TCTTCCCATCCACTGACCCCTGG - Intronic
1130971413 15:88736540-88736562 TCCCACTCAGGACTGACCCCAGG - Intergenic
1131121005 15:89823463-89823485 GCTCCCTCCCCAGTGCCCCCTGG + Intergenic
1131359447 15:91777035-91777057 CTTCCATCACCACTGGCCCCAGG - Intergenic
1132119592 15:99165557-99165579 TCTGCCTCACTGCAGACCCCAGG - Intronic
1132260261 15:100417762-100417784 GGTCCCTGACCCCTGACCCCTGG + Intronic
1132557467 16:578952-578974 TCCCCCTCCCCACCGCCCCCTGG + Intronic
1132712826 16:1276908-1276930 TGGCCCCCACCCCTGACCCCGGG - Intergenic
1132747577 16:1443374-1443396 GCTCCGGCACCACTGGCCCCTGG + Intronic
1134006702 16:10822814-10822836 TCTTTCTCTCCAGTGACCCCAGG + Intergenic
1134192674 16:12134679-12134701 TTTCCCTCAACACTGAACCAAGG - Intronic
1135220126 16:20607197-20607219 TCACCATCAGCACTGACCACAGG - Intergenic
1135277400 16:21125439-21125461 TCTGCCTCATCACTGAGCTCAGG - Intronic
1135433649 16:22409259-22409281 CTTCCCTCCACACTGACCCCTGG + Intronic
1136458331 16:30395071-30395093 TCTCCCCCACCCCTTTCCCCGGG + Intronic
1136508485 16:30721485-30721507 AGTCCCTCACCACAGAGCCCTGG - Intronic
1136608912 16:31354652-31354674 TCTGCCTCTCCACTGACCCCAGG + Intergenic
1137481029 16:48852220-48852242 TGTCCCCCACCAGTGCCCCCAGG + Intergenic
1137564871 16:49526621-49526643 CCATCCCCACCACTGACCCCTGG - Intronic
1137677113 16:50309203-50309225 TCTCCCTCACCTCTCTGCCCCGG + Intronic
1137903289 16:52292373-52292395 ACTCCCTCATGACTGACACCTGG - Intergenic
1139356754 16:66371386-66371408 TGCCCCTCATCCCTGACCCCAGG + Intronic
1140266797 16:73428210-73428232 TCCCCTTCCCCAGTGACCCCAGG + Intergenic
1140522500 16:75593929-75593951 TCTACCTCCTCACTGACCCTGGG - Intergenic
1140875406 16:79147256-79147278 CCTGCCTCATCCCTGACCCCTGG + Intronic
1141765931 16:86060128-86060150 CCTCCCTGACCCCTGACCCCTGG + Intergenic
1142190174 16:88713801-88713823 CCTCTCTCACCATTGACACCGGG + Intronic
1142383870 16:89749967-89749989 TCTCCCTGACCCCTGACGTCTGG - Intronic
1203105523 16_KI270728v1_random:1352241-1352263 TCTGCCTCACCACAGAACTCTGG - Intergenic
1203127991 16_KI270728v1_random:1610127-1610149 TCTGCCTCACCACAGAACTCTGG + Intergenic
1143136006 17:4712597-4712619 TCTGCCTCAGCAGTGATCCCTGG - Intronic
1143465329 17:7132691-7132713 GGTCCCTGACCCCTGACCCCTGG + Intergenic
1143665879 17:8359792-8359814 TCTCGCTCAACACAGAACCCAGG - Intergenic
1143776675 17:9204089-9204111 TCTCCCTCATCACCGATCCTAGG - Intronic
1143826916 17:9616680-9616702 GGTCCCTGACCCCTGACCCCCGG + Intronic
1144338223 17:14291134-14291156 CCTCCCTCTCTACTAACCCCTGG - Intergenic
1144669544 17:17125227-17125249 CCTGCCTCAACACTGACCCTGGG - Intronic
1144746246 17:17616833-17616855 CCTCCCTCTCCCCTAACCCCTGG + Intergenic
1145286136 17:21507109-21507131 TCCCCCTGACCTCTGACCCTGGG - Intergenic
1145391465 17:22459183-22459205 TCCCCCTGACCTCTGACCCTGGG + Intergenic
1145790776 17:27625284-27625306 CCTCCCTGACCCCTGACACCAGG + Exonic
1146492867 17:33294469-33294491 TTTCCCTCCCCACTGACCTGAGG + Intronic
1146524295 17:33552952-33552974 TCTCCCTCCCAACTGAACCCTGG + Intronic
1146643257 17:34556914-34556936 TTTCCCTCCTCACTGACTCCTGG + Intergenic
1146789440 17:35743168-35743190 TCTCCTGCACCCCTGCCCCCTGG + Exonic
1147214174 17:38889904-38889926 TCTCTCTCACCACTTCCTCCAGG + Intronic
1147314227 17:39611945-39611967 CCCCCCTCACCCCTGCCCCCAGG - Intergenic
1147442149 17:40453848-40453870 TCTCACTTAGCTCTGACCCCAGG + Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1149563973 17:57628711-57628733 GCTCCCCCACCAGTGTCCCCTGG + Intronic
1150223708 17:63511280-63511302 TACACCTCATCACTGACCCCTGG + Intronic
1150708376 17:67508756-67508778 TTTCCCTCCCCTCTGGCCCCTGG - Intronic
1151799612 17:76370339-76370361 TCCCCTTCCCCACTGACCCATGG + Intronic
1152288169 17:79424309-79424331 TCTCCCTCGGCACTGACCAGGGG + Intronic
1152300514 17:79492853-79492875 TCTCTCCCACCACTGCCTCCTGG - Intronic
1152641436 17:81450937-81450959 CCTCCCTCTGCACTGACCACTGG + Intronic
1154110632 18:11565815-11565837 CCTCCTTCACCAATGTCCCCAGG - Intergenic
1154358606 18:13641618-13641640 TCTCCCTCACCCCAGTCCTCGGG - Intronic
1154399914 18:14026380-14026402 ACTCCCTCCCCACTTTCCCCTGG - Intergenic
1155736230 18:29225826-29225848 ACTCCATATCCACTGACCCCAGG - Intergenic
1157180037 18:45488861-45488883 GCTGGCTCACCACTGACCCGAGG - Intronic
1158085925 18:53651958-53651980 TCTACCTCCTGACTGACCCCAGG - Intergenic
1158783561 18:60680810-60680832 TCTCCTTCCCCACTGATACCTGG - Intergenic
1159948980 18:74465590-74465612 TCACCCTCCCCACTAACTCCTGG + Intergenic
1160246376 18:77163473-77163495 TCTCCGTAGCCACTGACCCACGG - Intergenic
1160889396 19:1369308-1369330 TCTCCCTCATCACCGACTACAGG + Exonic
1160923468 19:1531689-1531711 TATGCCTGACCCCTGACCCCTGG + Intronic
1161273998 19:3405145-3405167 TCTCCCTCTCCCCTGCCGCCGGG - Intronic
1161421496 19:4178356-4178378 TCTTCCTCACCCCTCACCCCTGG + Intronic
1162770079 19:12944130-12944152 TCTCCTTCAGCCCTCACCCCTGG + Exonic
1162834566 19:13307944-13307966 TCTCCATCATCTCTGTCCCCAGG + Intronic
1163266992 19:16227526-16227548 CTACCCTCACCCCTGACCCCAGG + Exonic
1163370673 19:16899609-16899631 TCCCACTGACCACTGCCCCCAGG - Intronic
1163613452 19:18312460-18312482 TGTCCCTCCTGACTGACCCCTGG + Intronic
1163998198 19:21072278-21072300 TCTCCCCCACCACCAGCCCCAGG + Intergenic
1164063377 19:21694144-21694166 TCTCCCTCTCCCTTGGCCCCCGG - Intergenic
1164388719 19:27798247-27798269 ACTCCCTCACCCCTGCCACCAGG + Intergenic
1164933531 19:32193966-32193988 TCTCCACCTCCACTGCCCCCTGG - Intergenic
1165092236 19:33393298-33393320 TCTCCCCCACGCCAGACCCCGGG - Intronic
1165127295 19:33607942-33607964 CCTCCCTCCCCACAAACCCCTGG - Intergenic
1165164047 19:33838965-33838987 CCTCCCTCAACCCTAACCCCTGG - Intergenic
1165225667 19:34352940-34352962 TCTGCCCCAGTACTGACCCCAGG + Exonic
1165860512 19:38906960-38906982 GCTCCCTGTCCACAGACCCCAGG + Intronic
1166013330 19:39960224-39960246 TATCCCTCCCCACCAACCCCTGG + Intergenic
1166276252 19:41756331-41756353 GCTCCCTCCCCACTGGCCTCAGG - Intronic
1166423338 19:42654905-42654927 GCTCCCTCCCCACTGCCCTCAGG - Intronic
1167051487 19:47081668-47081690 CCTCCCCCACCACAGACCCAAGG + Intronic
1168185010 19:54695017-54695039 TCTCCCCCACTAATGAGCCCTGG + Intronic
925123616 2:1438184-1438206 TCTCCAACGCCACTGTCCCCCGG - Intronic
925266939 2:2572076-2572098 TCTCCCCCTCCACTGCCTCCCGG + Intergenic
927257607 2:21053868-21053890 TCTCCACCACTGCTGACCCCTGG + Intergenic
927523149 2:23713572-23713594 TCTCCCCAACCCCTAACCCCGGG + Intergenic
928293591 2:30061501-30061523 CCTCCCCCACCACAGACCCATGG - Intergenic
928319693 2:30273207-30273229 TCTCCCTCACCCCCAACACCTGG - Intronic
928373126 2:30755534-30755556 TCTTCCTCACCAGAGACCCAAGG - Intronic
928893102 2:36228716-36228738 TCTCCCTCTCCCTTAACCCCTGG - Intergenic
929456960 2:42072951-42072973 CCTCCCCCACCCCTGAGCCCAGG + Intergenic
929467692 2:42160008-42160030 CCTCCCTCCCCACTTACCTCTGG + Intergenic
929934717 2:46286354-46286376 TCTGCCTCACCCTTAACCCCTGG - Intergenic
930614882 2:53583325-53583347 TCTGCCTACCCTCTGACCCCTGG + Intronic
930920079 2:56742357-56742379 GCTCCCTCACCCCAGAACCCAGG - Intergenic
931489290 2:62726286-62726308 CCACTCTCACCACTGACCTCTGG - Intronic
932212768 2:69945878-69945900 TCTTCCTCACCTCTGCCCCCAGG - Intergenic
932833973 2:75017911-75017933 TTTCCCTCACTCCTGGCCCCTGG - Intergenic
933359659 2:81264821-81264843 TCTCCCTCTCCCCTAACCCCTGG + Intergenic
933802469 2:85973840-85973862 TCTCCCTCACACCTCGCCCCTGG - Intergenic
934324709 2:92001609-92001631 TCAACCTCACCACTAACCCTTGG - Intergenic
935156586 2:100488658-100488680 TCTGCCTCCCAACTGACCCTAGG + Intergenic
937130054 2:119503617-119503639 TCTCCCTCCCTATTGTCCCCTGG - Intronic
937757895 2:125562964-125562986 TCTTCCTCACAACAGCCCCCTGG - Intergenic
938727491 2:134120772-134120794 CCTTCCTCCCCACTGGCCCCTGG - Intronic
940394568 2:153173263-153173285 TCTGCCTCACAACTCACCTCAGG - Intergenic
940619167 2:156089193-156089215 CCTCCCTCCCCACTAACCCCTGG + Intergenic
940810684 2:158239305-158239327 TCTCCCTCCCCACCCACCCCTGG + Intronic
941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG + Intronic
941333323 2:164207729-164207751 TTTCCCTCACCACTTACCTTTGG - Intergenic
942450622 2:176106224-176106246 TCTCCTTCAGCACTGAAGCCAGG - Intronic
944397923 2:199290312-199290334 TCTGCCTCTCCACTGATCTCTGG + Intronic
944517704 2:200528777-200528799 TCTCCCTAACCTCTTACCACTGG - Intronic
944661056 2:201921989-201922011 GCTCCCTGACCCCTGACCCTAGG + Intergenic
944709261 2:202321050-202321072 TCTCCCTCACCACCATCCCACGG + Intergenic
945306487 2:208264046-208264068 TCTCCGCCACCCCTTACCCCTGG - Intronic
946015805 2:216603040-216603062 TTTCCCTCACAATTGACCCCAGG + Intergenic
946135186 2:217640250-217640272 TTCCCCTCACCACCGGCCCCTGG - Intronic
947055117 2:226091612-226091634 TCACTCTCACCACAGACCTCTGG + Intergenic
948030537 2:234814097-234814119 TCTCCCTCACTCCTGCCTCCTGG - Intergenic
948205984 2:236163251-236163273 CCTCCCTAACCCCTGAGCCCCGG - Intergenic
948460533 2:238128002-238128024 TCTCCCTGACCTCTGAGCTCAGG + Intronic
1169287374 20:4320877-4320899 TCTCCCTCACCAAGGTCCCTAGG - Intergenic
1169446140 20:5672456-5672478 TCTCCCTCTCCCCACACCCCCGG - Intergenic
1169721330 20:8680031-8680053 TGTCCCTGACCAGTGACCACTGG + Intronic
1170870564 20:20202163-20202185 TGCCCCTCACCCCTGAGCCCTGG + Intronic
1171173936 20:23037175-23037197 CTTCCCTCCCCACTCACCCCCGG + Intergenic
1172063729 20:32205326-32205348 TTTCCCTCACAACTAACCCTCGG + Intronic
1172194357 20:33082155-33082177 TCTCCCTCAACACCCATCCCAGG + Intronic
1172510567 20:35498013-35498035 TCTCCCCCACCACTCAGCTCAGG - Exonic
1173735750 20:45360168-45360190 TCTCCCTAATCCCTCACCCCAGG + Intergenic
1174917694 20:54670406-54670428 TCTCGCTCTCCTCTGTCCCCAGG - Intergenic
1175542230 20:59755041-59755063 TCCCCCTCACCACACACCCTAGG - Intronic
1176594135 21:8675355-8675377 TCCACCTCACCACTAACCCTTGG - Intergenic
1178980981 21:37265116-37265138 TCCCCCTCCCTCCTGACCCCTGG - Intronic
1179309862 21:40185849-40185871 TGTGCCTCACCCCTGAGCCCAGG + Intronic
1180276989 22:10652485-10652507 TCCACCTCACCACTAACCCTTGG - Intergenic
1180584212 22:16871394-16871416 TCAACCTCACCACTAACCCTTGG - Intergenic
1180655031 22:17413110-17413132 CCAGCCTCACCACTGACTCCAGG - Intronic
1180710851 22:17838430-17838452 TCTCCCTCACCACAGGGCCAGGG - Intronic
1181569931 22:23763051-23763073 TCTTCCTCCCCACTGAGCCCTGG - Exonic
1182544786 22:31068696-31068718 TCTCGCTCAACACGGTCCCCAGG - Intronic
1183302324 22:37064412-37064434 CCTCCATCACAACTGCCCCCAGG + Intergenic
1183335120 22:37241937-37241959 TGTCCCACATCACTGGCCCCTGG - Intronic
1183343621 22:37295115-37295137 CCCCACTCACCACTAACCCCGGG + Intronic
1183994228 22:41620954-41620976 TCTCCCCCACCCCTCAGCCCGGG - Exonic
1184382915 22:44157352-44157374 TGTCCCCCACTCCTGACCCCAGG - Intronic
1185017593 22:48353725-48353747 TCTCCATCCCCACTGCCTCCTGG + Intergenic
1185059413 22:48598391-48598413 AGCCCCTCACCACTGCCCCCTGG - Intronic
1185067088 22:48637954-48637976 ACTCCCTCTGCAGTGACCCCCGG - Intronic
1185095840 22:48805722-48805744 TCTCCCTCACCAACCAGCCCGGG + Intronic
1185279437 22:49963685-49963707 CCTGCCTCCCCACTGTCCCCTGG - Exonic
1185294436 22:50046310-50046332 TGTCCCACACCTCAGACCCCAGG + Intronic
949514592 3:4795655-4795677 CCTGCCTCCCCTCTGACCCCTGG - Intronic
950172230 3:10846850-10846872 CCTGCCTCAACACTGACCCCAGG + Intronic
950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG + Intergenic
951459057 3:22929406-22929428 CCTCCCTCACCCCTAACCCAAGG - Intergenic
951950724 3:28197432-28197454 TGTCCCTCACCCCTGAACCTGGG - Intergenic
951974717 3:28492884-28492906 TCTGCCTCACCACTCAACACGGG - Intronic
952975870 3:38695605-38695627 TCTCTCGTACCACTGAACCCGGG - Intergenic
953548562 3:43883222-43883244 ACTCCCTCACCCCTGACCAGTGG + Intergenic
954109173 3:48424669-48424691 TATCCCTTACCAGTGGCCCCAGG - Intronic
954372500 3:50176177-50176199 TGTCCCTCAGCACAGCCCCCAGG - Intronic
954470526 3:50690567-50690589 TCCCCCTCACCCCCAACCCCTGG + Intronic
955406970 3:58631644-58631666 ACTCCCTTACCAGTGTCCCCAGG - Intergenic
955897228 3:63713279-63713301 TCTCCCACTCCACCAACCCCTGG - Intergenic
956912046 3:73828172-73828194 TTTCCCTCTCCCCTCACCCCTGG - Intergenic
961552427 3:127676945-127676967 TCATCCTCCCCACTGCCCCCAGG + Exonic
962394320 3:135001576-135001598 CTTCCCTCACCACTAACCCCAGG + Intronic
962421120 3:135229983-135230005 TTTGCCACACCAGTGACCCCTGG - Intronic
963015096 3:140816492-140816514 TCTCCCCTACTTCTGACCCCTGG - Intergenic
963469559 3:145723132-145723154 TCTCACTCTCCTCTGCCCCCTGG + Intergenic
963909633 3:150805095-150805117 TCTCCCTCATCACTAACGCTTGG - Intergenic
964085949 3:152818415-152818437 CCTCCCTCCCCACTAACCCCTGG + Intergenic
964800173 3:160547720-160547742 TCTCCCTCACCCTCAACCCCTGG + Intronic
966562360 3:181337145-181337167 TCTCCATCCTCACTAACCCCTGG - Intergenic
967210394 3:187163113-187163135 TCTCTCTCAACTCTGACTCCAGG - Intronic
967872571 3:194244202-194244224 CCTCCCTCCCCACTAACTCCTGG - Intergenic
967948973 3:194825626-194825648 CCTCCCTCAACACTGCCTCCTGG + Intergenic
968451865 4:679697-679719 TCTCCCTCAGCACTTAGTCCTGG + Intronic
968662537 4:1804742-1804764 TCTGGCCCAGCACTGACCCCCGG + Intronic
969972863 4:11066227-11066249 GATCCCTGACCCCTGACCCCCGG - Intergenic
970032164 4:11688409-11688431 TCCCTCTCTCCCCTGACCCCTGG - Intergenic
970161402 4:13193013-13193035 TCTTCCTCCCCAGTGCCCCCAGG + Intergenic
971473764 4:27053519-27053541 TCTCCCTCACCACTGAAATGTGG + Intergenic
972912712 4:43837982-43838004 TCTCCCTCTCCACTGACCTCTGG + Intergenic
974071753 4:57130358-57130380 TTTCCTTCCCCACTAACCCCTGG + Intergenic
974228487 4:59079539-59079561 GGTCCCTGACCCCTGACCCCCGG + Intergenic
974357928 4:60836581-60836603 GGTCCCTGACCCCTGACCCCCGG - Intergenic
974359296 4:60855669-60855691 TTTCCCTCACCATTGTTCCCAGG + Intergenic
975535678 4:75447847-75447869 GGTCCCTGACCCCTGACCCCCGG - Intergenic
976425697 4:84900666-84900688 TCTCTCTCACCTCTAACCCCTGG - Intronic
976672227 4:87666158-87666180 TCCCCCTCACCCCTCATCCCTGG - Intergenic
977136836 4:93315398-93315420 TTTCCCTACCCACTGTCCCCTGG + Intronic
977401716 4:96541107-96541129 CCTTCCTCACCACTAACCTCTGG + Intergenic
977566605 4:98587031-98587053 TCTCCCTCAGCCCTCACCCTTGG - Intronic
980134674 4:128847913-128847935 TCTTCCTAATCACAGACCCCAGG - Intronic
980212231 4:129804272-129804294 TTTCCCTCACTACTTAACCCAGG - Intergenic
980886540 4:138768616-138768638 TCTCCCTCAACCCCCACCCCTGG + Intergenic
981349462 4:143711982-143712004 TTTCACTCAACTCTGACCCCAGG - Intergenic
981701135 4:147608686-147608708 TCTCCCCGTCCACAGACCCCTGG + Intergenic
983074604 4:163310628-163310650 TCTACCTCACCACAAACTCCTGG + Intergenic
984919899 4:184754435-184754457 TCTCCCTTAGCACTGAACACAGG - Intergenic
985260643 4:188111956-188111978 TCACCTTCACCACTCGCCCCAGG + Intergenic
985283620 4:188311934-188311956 TCAGCCTCACCTCAGACCCCAGG - Intergenic
985352790 4:189084063-189084085 ACTCCCAAACCACTGACCCCAGG + Intergenic
985535886 5:465549-465571 TCGCCCTCACCCCAGACCCCTGG + Intronic
985767765 5:1789087-1789109 TCTCCCTCACCAGCCAACCCTGG - Intergenic
986006225 5:3671420-3671442 TCTCCCTCCCCACTGGCCCATGG - Intergenic
986028656 5:3874582-3874604 TCCCCCTCACCCCTAACTCCTGG - Intergenic
986572870 5:9183119-9183141 TTTCCCTCACCACACAGCCCTGG - Intronic
986778601 5:11043966-11043988 TCTCCCTCACTAGGGAGCCCAGG + Intronic
986917124 5:12634617-12634639 ACTCTCTCACCATTTACCCCAGG + Intergenic
987243606 5:16026361-16026383 TCTCCCTCACCACTCATGCTGGG - Intergenic
987398398 5:17448139-17448161 TCTCCCAAACCACTGCCCACTGG + Intergenic
987454736 5:18129564-18129586 CCTCCCTCACCACTAAACTCAGG + Intergenic
988032746 5:25784973-25784995 TCTCCCTCACCTCTTAGTCCTGG - Intergenic
988617481 5:32789375-32789397 TCTCCCTCAAGACTGACCACAGG + Exonic
989167453 5:38445776-38445798 GCTCCCACACCACTCACCCCGGG - Intronic
989460055 5:41686912-41686934 CCTCCCTCTCCACTAACCTCTGG - Intergenic
989824566 5:45838131-45838153 GGTCCCTGACCCCTGACCCCCGG - Intergenic
990340844 5:54821494-54821516 TCTCCCTAACCCCAGAGCCCAGG - Intergenic
991503666 5:67302683-67302705 TCTCCCAGAACACTGACTCCTGG - Intergenic
994249436 5:97519227-97519249 GGTCCCTGACCCCTGACCCCTGG - Intergenic
995481576 5:112598667-112598689 TCTCCCTCCCCACTTGCCCTGGG + Intergenic
996034126 5:118739225-118739247 CCTCCAGAACCACTGACCCCTGG - Intergenic
996830887 5:127739240-127739262 GGTCCCTGACCCCTGACCCCCGG - Intergenic
997583507 5:135031457-135031479 CCTCCCGCACCACTGTCCTCGGG + Exonic
998334363 5:141357470-141357492 TCTCCCTCACCGCGGACTCGCGG + Exonic
998335386 5:141366600-141366622 TCTCCCTCACCGCGGACTCGAGG + Exonic
998337429 5:141385169-141385191 TCTCCCTCACCGCGGACTCTCGG + Exonic
998338497 5:141395083-141395105 TCTCCCTCACCGCCGACTCGCGG + Exonic
998339608 5:141405222-141405244 TCTCCCTCACCGCTGACTCAAGG + Exonic
998342862 5:141433029-141433051 TTTCCCTCACCACGGACTCGCGG + Exonic
998518173 5:142774740-142774762 CCTCCCTCCCCACTAACCCCGGG + Intronic
999216312 5:149938516-149938538 TCTTATTCACCACTGGCCCCTGG - Intronic
999271199 5:150297338-150297360 TCTTCCTCATCACTGGCCCAGGG + Exonic
999309447 5:150542549-150542571 TCTGCCTCACCACTGCACTCTGG - Intronic
999542116 5:152585043-152585065 TCTCCCACCCCACTGCCCTCAGG - Intergenic
999732696 5:154486709-154486731 TCCCCCTCACCACTCTCCCCAGG + Intergenic
999742986 5:154570896-154570918 CCTCCCTCACACCTGACTCCTGG - Intergenic
1000148770 5:158479628-158479650 TCTCCCTCACCTCTGACCATTGG - Intergenic
1000280886 5:159780987-159781009 CCTCCCTCCCCACAAACCCCTGG + Intergenic
1001055647 5:168447808-168447830 TGTTTCTCCCCACTGACCCCTGG + Intronic
1002105736 5:176878738-176878760 TCTCCCTCCCGCCTGTCCCCAGG + Intronic
1002679798 5:180952324-180952346 CTTCCCTCACCACTAACCTCTGG + Intergenic
1006825428 6:36931257-36931279 CCTCTCTCCCCACTAACCCCTGG + Intergenic
1006840637 6:37026076-37026098 TCTCTCTGCCCACAGACCCCAGG + Intronic
1007174660 6:39887674-39887696 TCTCCCTCTCTGCTGTCCCCTGG + Intronic
1007479675 6:42142034-42142056 CCGCCCCCACCTCTGACCCCAGG - Intronic
1007619138 6:43201058-43201080 TCTCCCTCAACACTAAGCACAGG - Intronic
1007662300 6:43494417-43494439 TCTCCCTCAACACTGCCTGCAGG + Intronic
1010126201 6:72434981-72435003 TCTCCTTCACCTCTTACCCCAGG - Intergenic
1011519497 6:88189351-88189373 TCTCCCTCCTCACTAACCCCTGG + Intergenic
1013225810 6:108118715-108118737 GCTCCCTCACCACCCACCCCTGG + Intronic
1013429413 6:110042566-110042588 TCCCCCTCACTTCTGACACCAGG + Intergenic
1013868373 6:114726036-114726058 GGTCCCTGACCCCTGACCCCTGG - Intergenic
1016734786 6:147466110-147466132 TCTCCCTCCCCACTAACTCTTGG - Intergenic
1017031068 6:150222610-150222632 TCTCCTTCCCCACTCACCCCTGG + Intronic
1017480693 6:154851336-154851358 TCTCTCTCTTCACTGACACCAGG + Intronic
1017887509 6:158611187-158611209 TGTCCTTCTCCACTGACCTCTGG + Intronic
1019230261 6:170554520-170554542 TCTTCCCCACCATTGCCCCCAGG - Intronic
1019357212 7:586846-586868 CCTCCTTCACCATTGCCCCCAGG - Intronic
1019378949 7:711712-711734 CTTCCCTCCCCACAGACCCCCGG + Intronic
1019417559 7:934398-934420 TCTCCAGCACCATTGACCCTGGG - Intronic
1020566617 7:9805500-9805522 TCTCCTTCTCCCCTAACCCCAGG - Intergenic
1022548120 7:31208256-31208278 TCTCCCAGACCACTGACATCTGG + Intergenic
1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG + Intergenic
1023553476 7:41394063-41394085 TCTTCCTCTCCCCTAACCCCTGG + Intergenic
1023860371 7:44214684-44214706 TGTCCCTCACCGCTGACCCCAGG + Intergenic
1023865908 7:44238369-44238391 TGTCTCTCAGCACTGTCCCCTGG + Intronic
1023942441 7:44778342-44778364 CCTCCCTCCCCACTAACCCCTGG - Intergenic
1024185028 7:46940761-46940783 TCTCTCTCTCCAGGGACCCCAGG - Intergenic
1025609057 7:63060911-63060933 GGTCCCTGACCCCTGACCCCTGG + Intergenic
1025639103 7:63350547-63350569 ACTCCCTCACCACTGCCACCAGG - Intergenic
1025643596 7:63397545-63397567 ACTCCCTCACCACTGCCACCAGG + Intergenic
1025858201 7:65302762-65302784 TCTCAGTCTCCACTGACCCTGGG - Intergenic
1026015814 7:66669840-66669862 TCACCCTCACCACCCACACCCGG + Intronic
1027431557 7:78119142-78119164 CCTCCCTCCCCACTAACCCCTGG - Intronic
1028943239 7:96548921-96548943 TCTGCCTCACCTCTTGCCCCAGG - Intronic
1028947799 7:96600800-96600822 TCTCCCTCAGCCCTGTCTCCAGG + Intronic
1028971748 7:96867184-96867206 CCTCCCTTACCACTGACCACGGG - Intergenic
1029488974 7:100860094-100860116 TCTCCGTCCCCGCTGAGCCCTGG + Intronic
1029639509 7:101810775-101810797 TCTCACCAGCCACTGACCCCTGG - Intergenic
1031530044 7:122865069-122865091 ACTCCCTCACCACCCACCACAGG - Intronic
1031668216 7:124511867-124511889 CCTCCCTCCCCACTATCCCCTGG - Intergenic
1032311558 7:130791963-130791985 TCTCCCTGAGTACTGACCCTAGG - Intergenic
1034250905 7:149689960-149689982 TCTCCCTCCCTACAAACCCCCGG - Intergenic
1034311128 7:150089515-150089537 TCTCCCTCTCCACTCTCCCAAGG - Intergenic
1034316062 7:150134389-150134411 TCTCTTTCACCACTGACAGCTGG + Intergenic
1034433815 7:151053661-151053683 TGACCCTCACCCCTCACCCCTGG - Intergenic
1034790826 7:153966392-153966414 TCTCTTTCACCACTGACAGCTGG - Intronic
1034795725 7:154011129-154011151 TCTCCCTCTCCACTCTCCCAAGG + Intronic
1035992278 8:4505871-4505893 TCTCCCTAACCTCTGCCTCCTGG + Intronic
1036155268 8:6336269-6336291 CCTCCCTCCCCACTAAGCCCGGG + Intergenic
1036462769 8:8968332-8968354 CCTCCCTCCCCACCAACCCCTGG + Intergenic
1036630967 8:10514759-10514781 ACTCCCTCGCCACTGTCCCCAGG + Intergenic
1037776480 8:21838948-21838970 ACCCCCTCCCCACAGACCCCCGG - Intergenic
1037929579 8:22870418-22870440 CCTCCCTCACTCTTGACCCCTGG - Intronic
1038577556 8:28717781-28717803 GCTCCGTCTCCACTGGCCCCAGG - Exonic
1038673674 8:29603517-29603539 TCTCCCTCACCCCTCAATCCTGG + Intergenic
1038694312 8:29792493-29792515 CCTCCCTCCCCACTAACCTCTGG - Intergenic
1039892300 8:41693933-41693955 TCTCCCTCCCCGCTGTCCCTCGG + Exonic
1040468941 8:47720017-47720039 CCTCCCTCCCCACTGACTACTGG + Intronic
1040894900 8:52355715-52355737 TCACCATCACCACTGACCTAAGG - Intronic
1042119117 8:65465536-65465558 TCTCCTCCACCACTCACCTCAGG - Intergenic
1042995004 8:74687667-74687689 TTTCCCTCACCCCCAACCCCTGG - Intronic
1045650234 8:104335521-104335543 CCTCCCTCTTCACTAACCCCTGG - Intronic
1047629820 8:126694689-126694711 TCTCCTTCTCCCCTAACCCCTGG + Intergenic
1047729841 8:127718028-127718050 CCTCCCTCACCTCTGTCACCTGG - Intergenic
1047872366 8:129098240-129098262 TCCCCCTCACCCCTGCCCCAAGG + Intergenic
1048801251 8:138196013-138196035 TCTACTTCACCGCTGACCTCAGG + Intronic
1048831163 8:138478737-138478759 TCTTCCTCAACACTCACCCAAGG - Intronic
1049745088 8:144259865-144259887 TCCCTCTCCCCGCTGACCCCAGG - Intronic
1049748445 8:144272768-144272790 TGCCCCTCATCACTGACCCCAGG + Intronic
1050010932 9:1185295-1185317 CCTCCCTCCCCACTCACTCCTGG - Intergenic
1050019191 9:1266394-1266416 TCTACCTCTCCCCTGACCACAGG - Intergenic
1051988623 9:23122968-23122990 TCTGCCTCAGCACTAAACCCAGG - Intergenic
1052309622 9:27051581-27051603 TTTCCCTATCCCCTGACCCCTGG + Intronic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1053167453 9:35854454-35854476 TTCCCCACACCCCTGACCCCAGG - Exonic
1055223163 9:73963500-73963522 TCTCCCTCCCCTTTGGCCCCTGG - Intergenic
1055257683 9:74391359-74391381 TATCCCTTCCCTCTGACCCCTGG - Intergenic
1055465110 9:76557849-76557871 GCTGGCTCACCACTGACCCTAGG - Intergenic
1056648509 9:88436592-88436614 TCTCTCTCACCCTTAACCCCTGG + Intronic
1057327235 9:94076343-94076365 TTTCCCTCCCCACTGGCCCAAGG + Intronic
1057728351 9:97586315-97586337 GGTCCCTGACCCCTGACCCCCGG - Intronic
1057996217 9:99823337-99823359 TCTTCCTCACCACTGCCCCGAGG - Intronic
1058526028 9:105858487-105858509 TTTGCCTCACCACAGCCCCCAGG - Intergenic
1059326289 9:113505958-113505980 ACACCCTGACCACTGAGCCCTGG - Intronic
1060666138 9:125433237-125433259 CCTCCCTGACCCCTGACCTCTGG - Intergenic
1061800784 9:133112536-133112558 CCTGCCTCACCACTTACCCGAGG - Intronic
1062022173 9:134324977-134324999 TCCCCCTCTTCACTGACCCCTGG - Intronic
1062140678 9:134956242-134956264 TCACCCTCACCACTGGTCCATGG + Intergenic
1062350264 9:136135309-136135331 CCTCCCTCACCCCTGCCCCGGGG + Intergenic
1062364458 9:136202276-136202298 TCTCACTCCCCACTGGCTCCGGG + Intronic
1062525765 9:136977528-136977550 TCTCCCACACCACTGGCACCAGG + Exonic
1203624270 Un_KI270749v1:155589-155611 TCCACCTCACCACTAACCCTTGG - Intergenic
1187018508 X:15354734-15354756 TGTCACTCCCCAATGACCCCAGG + Intronic
1187685865 X:21815039-21815061 TCTCCCTCACCACTCCTCACCGG + Intergenic
1188858097 X:35222115-35222137 GGTCCCTGACCCCTGACCCCTGG + Intergenic
1188913107 X:35874965-35874987 TCTTCCTCCCCACTAACCTCTGG - Intergenic
1189658865 X:43277494-43277516 CCTGACTCACCACTGTCCCCAGG - Intergenic
1190808696 X:53863590-53863612 TCACTCTCACCACAGACCTCTGG + Intergenic
1191684667 X:63878067-63878089 GCTCCCTCCCCACTAACCCCTGG - Intergenic
1192218238 X:69178805-69178827 TCTCCCTCTCCAGTTTCCCCTGG + Intergenic
1193112488 X:77743546-77743568 TATCCCTGACCTCTGTCCCCTGG - Intronic
1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG + Intergenic
1194593161 X:95825982-95826004 CCTCCCTCACCCCTAAACCCTGG - Intergenic
1195254336 X:103078500-103078522 ATTCCCACACCACTGGCCCCAGG + Intronic
1195766135 X:108298468-108298490 GCGGCCTCACCACTGACCCTGGG + Intronic
1196240971 X:113343142-113343164 GGTCCCTGACCCCTGACCCCTGG - Intergenic
1196612715 X:117733036-117733058 GGTCCCTGACCCCTGACCCCCGG - Intergenic
1198123516 X:133619664-133619686 TGCCCCTTACCCCTGACCCCTGG - Intronic
1198698573 X:139370923-139370945 TCTCCCCCAACCCTGACCCCTGG + Intergenic
1198801953 X:140457272-140457294 CTTCCCTCACCCCAGACCCCAGG + Intergenic
1199501605 X:148513259-148513281 TCTCCCTCACCCTTGACCCTGGG + Intronic
1199689940 X:150301747-150301769 CCTCCCTCCCCACTAACCCTTGG + Intergenic
1199700192 X:150370121-150370143 TCTCCCTCCCCAGTGACATCTGG - Intronic