ID: 922642132

View in Genome Browser
Species Human (GRCh38)
Location 1:227245035-227245057
Sequence CACTGCAGGCTGAAGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 3, 1: 25, 2: 70, 3: 191, 4: 765}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922642129_922642132 -9 Left 922642129 1:227245021-227245043 CCAGCAAGCATCACCACTGCAGG 0: 1
1: 2
2: 12
3: 65
4: 311
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765
922642124_922642132 19 Left 922642124 1:227244993-227245015 CCCATCCCAGCAAGTCAGAACGA 0: 1
1: 0
2: 1
3: 5
4: 109
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765
922642127_922642132 13 Left 922642127 1:227244999-227245021 CCAGCAAGTCAGAACGAGTTTCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765
922642126_922642132 14 Left 922642126 1:227244998-227245020 CCCAGCAAGTCAGAACGAGTTTC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765
922642128_922642132 -8 Left 922642128 1:227245020-227245042 CCCAGCAAGCATCACCACTGCAG 0: 1
1: 0
2: 3
3: 14
4: 155
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765
922642125_922642132 18 Left 922642125 1:227244994-227245016 CCATCCCAGCAAGTCAGAACGAG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG 0: 3
1: 25
2: 70
3: 191
4: 765

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922642132 Original CRISPR CACTGCAGGCTGAAGTGCTC TGG Intronic
900250554 1:1666568-1666590 GAGAGCAGGCTGAAGTACTCAGG - Intronic
900648772 1:3720919-3720941 CACTGCAGCCGCAAGTGCCCTGG - Intronic
901015299 1:6225928-6225950 CACTGCAGCCTTAACTGCTTGGG + Intronic
901106565 1:6760869-6760891 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
901128365 1:6945386-6945408 CACTCCAGGCTGGAGTGCAGTGG + Intronic
902120413 1:14160193-14160215 TATTGCAGGCTAAAGTGCTGTGG - Intergenic
902225946 1:14996549-14996571 CACTGCAGGCAGGTGTGGTCAGG - Intronic
902738116 1:18414592-18414614 CACTGCATTCTGATGTGGTCTGG + Intergenic
902880035 1:19365924-19365946 GAATGCCGGCTGAAGAGCTCAGG + Intronic
903397474 1:23012938-23012960 CACTGCAGCCTCAACTTCTCGGG + Intronic
903411530 1:23147399-23147421 CACCCCAGGCTGAAGTGCAGTGG - Intronic
903471337 1:23589625-23589647 CACTGCAGGCTTGACTGCCCAGG + Intronic
903787887 1:25873644-25873666 CACTGCAGCCTCAACTGCCCAGG + Intergenic
904119702 1:28189703-28189725 CACTCCAGGCTGGAGTGCAGTGG + Intronic
904202695 1:28831618-28831640 CACTGCAGGCTCAACTGCCCAGG + Intronic
904444254 1:30555124-30555146 AACTCCAGGCTGAATTGCCCTGG + Intergenic
904475542 1:30762390-30762412 CACTGCAGGCTGAAGGCTCCAGG + Intergenic
904692518 1:32304436-32304458 CCCTGCAGGCTGGAGTGCAGTGG + Intronic
905185020 1:36190077-36190099 CACTGCAGCCTGAACTTCCCAGG + Intergenic
905435238 1:37951231-37951253 CACTGCAGCCTGCAGGGGTCTGG + Intergenic
905680427 1:39866949-39866971 CACTTCAGGCTGGAGTGCAGTGG - Intronic
905739838 1:40360866-40360888 CACCCCAGGCCAAAGTGCTCTGG + Intronic
905892066 1:41523894-41523916 CACTGCAGACTGAAGCGCCTTGG - Intronic
906118287 1:43369762-43369784 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
906343157 1:44998409-44998431 CTCTGCAGGCTGGAGTGCAGTGG - Intergenic
906353085 1:45080255-45080277 CTCTGTGGGCTAAAGTGCTCTGG - Intronic
906482790 1:46210848-46210870 CACTGCAGCCTGTACTTCTCTGG + Intronic
907490193 1:54804366-54804388 CAGGGCTGGCTGAAGTGCACAGG + Intergenic
908194940 1:61739230-61739252 CATTCCAGGCTGGAGTGCTATGG - Intergenic
908251063 1:62266232-62266254 CACTTCAGGCAGCAGTGCTTGGG + Intronic
908363249 1:63390624-63390646 CACTGTAGGCTAAAGCACTCTGG - Intronic
908397675 1:63741058-63741080 CACCACAGGCTAAAATGCTCTGG - Intergenic
910191552 1:84600943-84600965 CACTGAAGGCTGAAGATGTCTGG + Intergenic
910229783 1:84974163-84974185 CACTGCAGGCTAAAGTGCTCTGG + Intronic
910254517 1:85234542-85234564 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
910349405 1:86278131-86278153 CACTGTAAGCTAAAGTGCCCTGG - Intergenic
910470502 1:87547569-87547591 CACTGAGGGCTAAAGTGCTCTGG - Intergenic
910547240 1:88432472-88432494 CACTACAGGCTAAACTGCTCTGG + Intergenic
910639855 1:89447471-89447493 CACTGTGGGCTAAAGGGCTCTGG - Intergenic
910733040 1:90420287-90420309 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
910879601 1:91911065-91911087 CACTGCAGCCTCAACTTCTCTGG + Intergenic
910992814 1:93073462-93073484 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
911942826 1:104069324-104069346 CACTGCAGGCTGAAGGGTTCTGG - Intergenic
912316335 1:108670442-108670464 CACTGCAAGTCAAAGTGCTCTGG + Intergenic
912378205 1:109230063-109230085 CACTGCAGGCTGGGGTGTGCAGG + Intronic
912635352 1:111286881-111286903 CTCTGAATGCTGAAATGCTCAGG - Intergenic
912643840 1:111372420-111372442 CACCACAGGCTGAAGTGCTCTGG + Intergenic
912714733 1:111974992-111975014 CTCTGCAGCCTGAAGCCCTCTGG + Intronic
912899340 1:113630947-113630969 CACTGGGGGCTGGAGTGCTCTGG - Intronic
912900389 1:113641241-113641263 GAATGCAGGCTGAGGTGATCAGG + Intronic
914821679 1:151109396-151109418 CACTCCAGGCTGGAGTGCAGTGG + Intronic
915693735 1:157716957-157716979 CACTGTGGGCTAAAGTGTTCTGG - Intergenic
916445036 1:164864271-164864293 CACTGGAGGCTGAAGGGCTAGGG - Intronic
916992117 1:170255473-170255495 CACTGCAGCCTCAAATGCCCGGG + Intergenic
917246332 1:173004970-173004992 CATTGTGAGCTGAAGTGCTCTGG - Intergenic
917306152 1:173627644-173627666 CACTACAGGCTAAAGTGCTATGG + Intronic
917377534 1:174365456-174365478 CACTGCGGGCTGAAATGCTCTGG - Intronic
917387365 1:174491707-174491729 CACTGCAGGATGGAGTGCTCTGG - Intronic
917879661 1:179321955-179321977 CACTGCAGGCTCAAATTCTTGGG + Intronic
917916944 1:179711280-179711302 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
918270231 1:182891318-182891340 CACTGCAGACCAAAGTGCTCTGG + Intergenic
918357917 1:183723681-183723703 CACCACAGGCTAAAGTGCTCTGG + Intronic
918990031 1:191685783-191685805 CACTGCAAGAAAAAGTGCTCTGG - Intergenic
919067693 1:192714070-192714092 CACTGCGGGCTAAAGTGCTCTGG + Intergenic
919147308 1:193651758-193651780 CACTGCAGACTGAAGTGTTCTGG - Intergenic
919169727 1:193938712-193938734 CACCGTGGGCTAAAGTGCTCTGG + Intergenic
919257498 1:195142643-195142665 CAATGTGGGCTGAAGTGCTTTGG - Intergenic
919336524 1:196243712-196243734 CACTGTGGGCTAAAGTGCTCTGG + Intronic
919363010 1:196619080-196619102 CTCTTCAGGCTGGAGTGATCTGG - Intergenic
919856376 1:201709072-201709094 CACTGCAGGCTCAACTTCCCTGG - Intronic
920549488 1:206846559-206846581 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
920738316 1:208555724-208555746 CACTGAAGGGTAAAGTGATCTGG + Intergenic
921774647 1:219082609-219082631 CACTGCAGGCTAACGCTCTCTGG - Intergenic
921812419 1:219529867-219529889 CACTGCAGCCTCAAGTTCCCGGG - Intergenic
922495435 1:226053681-226053703 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
922720493 1:227897580-227897602 CCCTCCAGGCTGAATGGCTCTGG + Intergenic
922999372 1:229994106-229994128 CACGCCAGGCTGATGTGTTCAGG - Intergenic
923163977 1:231341944-231341966 CACCCCAGGCTGTAGTGCTGTGG - Intronic
923196987 1:231677935-231677957 CACTCCAGGCTGGAGTGCAATGG - Intronic
923241754 1:232092350-232092372 GGCTGGAGGCTGAAGTTCTCTGG - Intergenic
924481558 1:244439776-244439798 CAGCACAGGCTAAAGTGCTCTGG - Intronic
924494005 1:244568711-244568733 CACAGCAGTCTGAAGTGACCTGG - Intronic
1063285536 10:4683749-4683771 CACTGCAGGCTCAACTTCTTGGG + Intergenic
1063754033 10:8985511-8985533 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1064111136 10:12539953-12539975 CACTGTAGGCTGGAGTGCAATGG + Intronic
1064696889 10:17975793-17975815 CACCTCAGGCTAAAGTGCTCTGG - Intronic
1065381637 10:25096667-25096689 CACCATAGGCTAAAGTGCTCTGG - Intergenic
1065426977 10:25616010-25616032 CATCACAGGCTGATGTGCTCTGG - Intergenic
1065857714 10:29843677-29843699 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1066461407 10:35615633-35615655 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1066682246 10:37945524-37945546 CACCCCAGGCTGAAGTGCAGTGG + Intergenic
1067080160 10:43208269-43208291 CACTGCAGGCTGCTCTGGTCAGG + Intronic
1067312994 10:45132771-45132793 CACTGCAGCCTCAATTGCCCGGG - Intergenic
1067667682 10:48292057-48292079 CACTGCAGCCTCAAGCTCTCAGG + Intergenic
1068226086 10:54108508-54108530 CACCACAGGCTAAAGGGCTCTGG + Intronic
1068411462 10:56660868-56660890 CACCACAGGCTAAAGTGCTCTGG - Intergenic
1068740618 10:60465179-60465201 CACTGCAGCCTCAAATTCTCAGG - Intronic
1068941978 10:62689443-62689465 CACACTAGGCTGGAGTGCTCTGG - Intergenic
1069153551 10:64997186-64997208 CACTGCAGGCTGGAATTCTTGGG - Intergenic
1069450271 10:68511766-68511788 CACTGCAGACTCAAATGCTTGGG + Intronic
1070520886 10:77252402-77252424 GACTGCAGGCTGAAGGGCATTGG + Intronic
1071191804 10:83109494-83109516 CACTGCATTATGAAGTGCTTTGG + Intergenic
1071209064 10:83317185-83317207 CACCACAGGCTAAAGTTCTCTGG + Intergenic
1071935612 10:90526884-90526906 TACTGTAGGCTTAAGGGCTCTGG - Intergenic
1071962573 10:90821506-90821528 CACTGCAGGCTAAGGTGCTCTGG + Intronic
1072853730 10:98924840-98924862 CACTTAGGGCTAAAGTGCTCTGG - Intronic
1072907731 10:99470345-99470367 CACTTTAGGCTGAAGTCTTCAGG + Intergenic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1073481327 10:103787843-103787865 CAGTGCTGGCTGAGGGGCTCGGG - Intronic
1073823489 10:107292023-107292045 AACTGCAGGCTAAAGTACTGTGG - Intergenic
1073851977 10:107632157-107632179 CACTGCAGCCTCAAGCTCTCGGG - Intergenic
1074670071 10:115780330-115780352 CACCACAGGCTAAAGTGCTCTGG + Intronic
1074803412 10:117025413-117025435 CACTGTGGGCTAAAGTGCTCTGG + Intronic
1074807540 10:117068348-117068370 CAGTGCAGGCTGGAGTGCAGTGG - Intronic
1075496291 10:122922343-122922365 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
1075771228 10:124938399-124938421 CACTGCAGCCTCAAGTCCCCTGG + Intergenic
1075870683 10:125770952-125770974 CACTGCAGCCTCAACTTCTCAGG - Intronic
1075928363 10:126271688-126271710 CACTGCAGCCTTGACTGCTCTGG - Intronic
1076776665 10:132701649-132701671 CACCTCAGGCTGGGGTGCTCAGG + Intronic
1077070498 11:668744-668766 CACTGCAGCCTCAAGTTCCCAGG - Intronic
1077358233 11:2128363-2128385 CACTGAAGGCTGCAGGGCCCTGG + Intergenic
1077427358 11:2489420-2489442 CACCACGGGCTAAAGTGCTCTGG + Intronic
1077709576 11:4522725-4522747 CACTAAGGGCTAAAGTGCTCTGG + Intergenic
1077998112 11:7471408-7471430 CACTTCAGGCTGGAGTGCAGTGG + Intergenic
1078281067 11:9901682-9901704 CTCTGGAGGCTGGAGTGCTGTGG + Intronic
1078369010 11:10729775-10729797 CACTGCAGCCTCAATTTCTCAGG + Intergenic
1079069346 11:17329413-17329435 CCATGCGGGCTGAAGTGCTCTGG - Intronic
1079242595 11:18731087-18731109 CTCTGCCAGCTGATGTGCTCAGG - Intronic
1079416273 11:20239005-20239027 CAATATGGGCTGAAGTGCTCTGG - Intergenic
1079530637 11:21447863-21447885 CACTGCAGGCTACAGTGCTCTGG - Intronic
1079562912 11:21844921-21844943 CAGGGCAGGCTGGAATGCTCTGG - Intergenic
1079845876 11:25466913-25466935 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1080006941 11:27418908-27418930 CACTGCAGCCTCAACTGCCCAGG + Intronic
1080010053 11:27449504-27449526 CACTGCAGGCTCAAGCTCTTAGG - Intronic
1080096899 11:28418935-28418957 CACTGTGGGCTAAAGTGTTCTGG + Intergenic
1080128487 11:28766082-28766104 CTCTGCAGGCTAAAGTGCTCTGG + Intergenic
1080398386 11:31911207-31911229 CACTGCAGCCTCAACTGCCCAGG - Intronic
1081049091 11:38315379-38315401 CACTATGGGCTAAAGTGCTCTGG + Intergenic
1081341411 11:41932603-41932625 AAGGGCAGGCTGAAGTTCTCAGG - Intergenic
1082131139 11:48490796-48490818 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1082245669 11:49919326-49919348 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1082564635 11:54661660-54661682 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1083458270 11:62793599-62793621 CACTGCAGCCTCAACTGCTAGGG - Intronic
1083538953 11:63498302-63498324 CACCACAGGGTGAAGTGCTCTGG - Intergenic
1083614408 11:64019179-64019201 CACTGCAGGCCGAGGTGGCCCGG + Intronic
1084666595 11:70579651-70579673 CACAGCAGGCTGACCTGCACAGG - Intronic
1085194832 11:74662805-74662827 CACTGTGGGCTAAAGTGTTCTGG - Intronic
1085245811 11:75099542-75099564 CACTGCAGCCTGAACTTCCCAGG - Intergenic
1085614414 11:77984834-77984856 CACTCCAGGCTGGAGTGCAGTGG - Intronic
1085847776 11:80085383-80085405 CACAGCAGGCTGGAGGGCTGGGG + Intergenic
1086261596 11:84946842-84946864 CATTGCATGCTAAAGGGCTCTGG - Intronic
1086838309 11:91653373-91653395 TACTGCAGGCTAGAGTGCTGTGG - Intergenic
1086847893 11:91774238-91774260 CACCACAGGCTGAAGTGCTCTGG - Intergenic
1087178730 11:95120792-95120814 CACTGTAGGCTAAAGTGCTATGG - Intronic
1087598459 11:100283559-100283581 CACCACAGGCTCAAGTGCTCTGG - Intronic
1087691129 11:101321405-101321427 CACCACAGGCTAAAGTGCTCTGG - Intergenic
1087876860 11:103369330-103369352 CAAAGCAGGCGGAAGTACTCTGG + Intronic
1087901325 11:103645033-103645055 CACTGCTGGCTCAAATGCCCTGG + Intergenic
1087945794 11:104158790-104158812 CAATGAAGGCTGAAGTGCTGTGG - Intronic
1088009738 11:104985860-104985882 CACTGCTAGCCAAAGTGCTCTGG + Intergenic
1088181733 11:107120934-107120956 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1088375883 11:109141104-109141126 AACTTAAGGCTAAAGTGCTCTGG - Intergenic
1088810534 11:113388572-113388594 CAGTGCAGGCTGAGGAGGTCAGG + Intronic
1089199344 11:116714430-116714452 CTCTGGAGGCTGGAGGGCTCAGG - Intergenic
1089417725 11:118306453-118306475 CACTCCAGGCTGGAGTGCAGTGG - Intronic
1089553028 11:119295922-119295944 CAATGCATGCTGAAGTTCTGAGG - Intronic
1089844198 11:121445637-121445659 CAGAGAAGGCTAAAGTGCTCTGG - Intergenic
1090034523 11:123237255-123237277 CACTCCAGGCTGGAGTGCAATGG + Intergenic
1090221025 11:125026193-125026215 CACCACAGGCGAAAGTGCTCTGG - Intronic
1090240930 11:125181359-125181381 CACTGCAGGCTGGAGTAGTCTGG + Intronic
1090317624 11:125808010-125808032 CACTGCAAGCCAAAGTGCTTTGG + Intergenic
1090579794 11:128147535-128147557 CACTTCAGGCTGAACTGAGCAGG + Intergenic
1090677005 11:129007846-129007868 CACTGCAAGCTAAAGTGCTCTGG - Intronic
1091275939 11:134350245-134350267 CACCATGGGCTGAAGTGCTCTGG - Intronic
1091462363 12:654117-654139 CACTGCAGCCTGAAATGCCTTGG - Intronic
1091576558 12:1742130-1742152 ATCTGCAGGCTGAAGTGCAGTGG + Intronic
1092009132 12:5094942-5094964 CACTGTAGGCTGAGGCTCTCGGG + Intergenic
1092105160 12:5916199-5916221 CACTGCAGGCTCAACTCCCCAGG - Intronic
1092224738 12:6740545-6740567 CACTGCAGCCTTAACTTCTCAGG - Intergenic
1092670778 12:10858498-10858520 CACTGTAGGCTAAAGTAGTCTGG + Intronic
1093122924 12:15294764-15294786 CACCACAGGCTAAAGTGCTCTGG + Intronic
1093460918 12:19406004-19406026 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1093538117 12:20247446-20247468 CACTGTGGGATAAAGTGCTCTGG + Intergenic
1093655392 12:21688252-21688274 CAGGACGGGCTGAAGTGCTCTGG - Intronic
1093947180 12:25122379-25122401 CACTGCAGCCTCAACTGCCCAGG - Intronic
1093991002 12:25590419-25590441 CACTGCAGGCTAAAGTGCTCTGG + Intronic
1094116936 12:26926468-26926490 CGAAGCAGGCTGAAGTGTTCAGG - Intronic
1094192349 12:27710546-27710568 CACTGAAGGCGGGCGTGCTCTGG - Intergenic
1094223449 12:28019945-28019967 CACTGCAGTCTCAAATTCTCTGG + Intergenic
1094351956 12:29536727-29536749 CACTGCAGGCTGAGCTCCTAGGG + Intronic
1094419704 12:30257652-30257674 CACTCTAAGCTGAAGTACTCTGG + Intergenic
1094603101 12:31927439-31927461 CACTGCAGCCTTAACTGCTCAGG + Intergenic
1094757470 12:33489298-33489320 CACCACCGGCTAAAGTGCTCTGG + Intergenic
1094767860 12:33618573-33618595 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1095169615 12:39019267-39019289 CCCTGCAGGCTAAAGTGCTCTGG + Intergenic
1095181803 12:39154645-39154667 CACCACAGGCTAAAGTGCTCCGG - Intergenic
1095625019 12:44304340-44304362 AACTGCAGGCTAAAGTGCTTTGG + Intronic
1096212750 12:49778995-49779017 CACTGCAGCCTGAACTGCCCAGG + Intergenic
1096344045 12:50829327-50829349 CACCGCGGGCTGTAGTGCTCTGG - Intergenic
1096760718 12:53839789-53839811 CACTGCAAGCAGCAGAGCTCTGG + Intergenic
1097088314 12:56486161-56486183 CACTGGAGAGTGATGTGCTCTGG - Intronic
1097466192 12:59928087-59928109 CACCTAAGGCTAAAGTGCTCTGG + Intergenic
1097508540 12:60507115-60507137 TATTGAGGGCTGAAGTGCTCTGG + Intergenic
1097714930 12:62955750-62955772 CATCACAGGCTGAAGTGCTCTGG - Intergenic
1097899366 12:64857718-64857740 CAGTGCAGGCCAAAGTGCTCTGG - Intronic
1098582844 12:72121343-72121365 CACTATGAGCTGAAGTGCTCTGG - Intronic
1099024416 12:77447773-77447795 CACTGTGGGCTAAAGGGCTCTGG + Intergenic
1100007760 12:89914048-89914070 CACCCCAGGCTGAAGTGCAGTGG - Intergenic
1100485908 12:95027128-95027150 CACTGCAGCCTCAAATTCTCGGG + Intronic
1100784315 12:98063057-98063079 CACTGCAGAGGGCAGTGCTCTGG - Intergenic
1100879019 12:98995804-98995826 AACTGCAGGCTGCAGGGGTCAGG - Intronic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1101226574 12:102693908-102693930 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1101611069 12:106292481-106292503 CACTGCAGGCTCCAATGCACAGG + Intronic
1102077385 12:110070488-110070510 CACTGCAGCCTCAACTTCTCAGG - Intronic
1102098868 12:110261953-110261975 CACCTCAGGCTGGAGTGCTGTGG - Intergenic
1102491438 12:113291733-113291755 CGCTGCAGGCTGAAGAGCAGGGG - Intronic
1102855464 12:116289445-116289467 CACTGCAGCCTCAACTGCCCAGG - Intergenic
1103461205 12:121106653-121106675 CACTGCGAGCTGGAGTGCTCTGG + Intergenic
1103765217 12:123274985-123275007 CTCTGGAGGCTGAGGTGCTGAGG + Intergenic
1104825459 12:131705153-131705175 CACTGCAGCCTCAACTTCTCAGG - Intergenic
1105441759 13:20421123-20421145 CACTGGGGCCTGAAGTACTCTGG - Intronic
1106699139 13:32210351-32210373 CACTGCAGCTTGCAGGGCTCAGG + Intronic
1107428557 13:40317882-40317904 CACTGTAGGATAATGTGCTCAGG - Intergenic
1108098879 13:46934424-46934446 CACTGTGGGCTAAAGTGCTGTGG + Intergenic
1108259722 13:48644456-48644478 CCCTGCAAGCACAAGTGCTCAGG + Intergenic
1108288187 13:48929447-48929469 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1108324655 13:49318389-49318411 CACTGCAGCCTCAACTTCTCGGG - Intronic
1108358180 13:49645993-49646015 CACTGCAGCCTCAAGTGCCTGGG + Intergenic
1108629157 13:52264031-52264053 CACCGCAGGCTGGAGTGCAGTGG - Intergenic
1108656899 13:52542445-52542467 CACCGCAGGCTGGAGTGCAGTGG + Intergenic
1108857954 13:54819451-54819473 CACCACAGGCTAAAGTGCTGTGG + Intergenic
1108879131 13:55087456-55087478 CAGTGCAGGCTAATGTTCTCTGG - Intergenic
1109336761 13:61004093-61004115 AACTGCAGGCTAAAGTGCTCTGG - Intergenic
1110448857 13:75618435-75618457 CAGTGCAGGCTCAACTGCTCTGG - Intergenic
1110809538 13:79796334-79796356 AACTGCTCTCTGAAGTGCTCTGG - Intergenic
1110852329 13:80260034-80260056 CACTGCAGCCTCAACCGCTCAGG + Intergenic
1110989647 13:82023177-82023199 CACTGCAGCCTCAAGTGCCTGGG - Intergenic
1111365317 13:87235172-87235194 CACTGCAAGCTAAAGAGCTCTGG - Intergenic
1111611058 13:90607256-90607278 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1111639218 13:90946802-90946824 CAGTGTGGGCTAAAGTGCTCTGG + Intergenic
1112527482 13:100165711-100165733 AACTGCATGCTGAAGTGTACAGG - Intronic
1113068633 13:106396214-106396236 CACTTCAGGCTGGAGTGCAGTGG - Intergenic
1113397880 13:109965567-109965589 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1113565028 13:111314599-111314621 CACTCCAGGCTGGAGTGCAATGG + Intergenic
1113926960 13:113947015-113947037 CACTGCAGGCCAAGATGCTCTGG + Intergenic
1114181818 14:20374128-20374150 CACTGGAGGCTGGAGTGCAGTGG + Intronic
1114244978 14:20904677-20904699 CAAAGCAGGCTAAAGTGCTCTGG + Intergenic
1114247986 14:20932849-20932871 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1114250819 14:20958948-20958970 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1114432101 14:22670596-22670618 TACTGCCGGCTAAAGTGCTCTGG + Intergenic
1114783827 14:25570775-25570797 GACTACAAGCTGAAGTGCTCTGG - Intergenic
1115224189 14:31086451-31086473 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1115328941 14:32172529-32172551 CACCCCAGGCTGGAGTGCTGTGG - Intergenic
1115660907 14:35493778-35493800 CATTGTGGGCTAAAGTGCTCTGG + Intergenic
1115942827 14:38628033-38628055 CACTGCAGTATGAAATGCTTTGG + Intergenic
1115948558 14:38694062-38694084 CACTGCAAGCAAAAGTGCTCTGG + Intergenic
1116021722 14:39469447-39469469 CACGGCGGGCTGGAGTGCTCTGG - Intergenic
1116024519 14:39498599-39498621 CACTGCAGTCTCAACTGCCCAGG - Intergenic
1116045634 14:39739874-39739896 CACTGCGGGCTAAAGTGCTCTGG + Intergenic
1116106374 14:40513469-40513491 CACAGAAGGATAAAGTGCTCTGG + Intergenic
1116149178 14:41116662-41116684 CAATGCAAGCTTAAGTGCTACGG + Intergenic
1116240878 14:42340745-42340767 CACTGCAGCCTCAAGCTCTCTGG - Intergenic
1116249692 14:42465203-42465225 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1116354719 14:43914186-43914208 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1117125062 14:52614158-52614180 CACCGCAGGCTGGAGTGCAGTGG + Intronic
1117161589 14:52995165-52995187 CGCAGCAGGCTAATGTGCTCTGG - Intergenic
1117233893 14:53751758-53751780 CACCGCAGGCCAAAGTGCCCTGG + Intergenic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1117410399 14:55445680-55445702 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1117442535 14:55773521-55773543 CACTGCAGGGAAAACTGCTCTGG + Intergenic
1117634731 14:57729831-57729853 CACTGTGGCCTGAAGTGCTCTGG - Intronic
1117787316 14:59299850-59299872 CAGTGCAGGCTGACTTTCTCTGG - Intronic
1117795519 14:59389193-59389215 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1118034263 14:61849446-61849468 CACCACAAGCTAAAGTGCTCTGG - Intergenic
1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG + Intergenic
1118234960 14:63994086-63994108 CCCTGCAGGCTGAAGTCCCAGGG + Intronic
1118236350 14:64008693-64008715 CCCTACAGGCTGAACTGCCCAGG + Intronic
1118431251 14:65720740-65720762 CACTATAGGCTGAAGTGTCCTGG - Intronic
1118580052 14:67286779-67286801 CACTGCAGCCTCAACTTCTCAGG - Intronic
1118590217 14:67395399-67395421 CACTGCAGGCTGATGTGCGGGGG + Exonic
1118647616 14:67854923-67854945 CACCCCAGGCTGAAGTGCAGTGG - Intronic
1118847786 14:69560901-69560923 CACTGCAGCCTAAACTTCTCCGG - Intergenic
1119080776 14:71691515-71691537 CACTGCAGCCTCAAATGCCCAGG - Intronic
1119548713 14:75492633-75492655 CACTGCAGCCTCAAGTTCCCGGG - Intergenic
1119827391 14:77668824-77668846 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1120275625 14:82369783-82369805 CACTGTAGTCTAAAGAGCTCTGG + Intergenic
1120467920 14:84885033-84885055 CACTGAGGGCTAAAGTACTCTGG + Intergenic
1120819279 14:88896974-88896996 CACTCCAGGCTGGAGTGCAATGG - Intergenic
1121131076 14:91447841-91447863 CACTGCAGGCTCAATTTCTCTGG - Intergenic
1121328514 14:93035491-93035513 CAGTGCAGACTGATGTGCTATGG + Intronic
1122070827 14:99204393-99204415 CACTGCAGATGGAAGAGCTCGGG - Intronic
1122745132 14:103893145-103893167 CACTCCAGGCTGGAGTGCGATGG + Intergenic
1122828960 14:104386422-104386444 CACTGCGGGCAGAAGGGCCCAGG - Intergenic
1123708393 15:22967307-22967329 CCCTGCTGGCTGAGGGGCTCAGG + Intronic
1124081471 15:26501929-26501951 CACTGTGAGCTAAAGTGCTCTGG - Intergenic
1124708174 15:31982818-31982840 AACTGGAGCCTGGAGTGCTCAGG - Intergenic
1125495218 15:40186944-40186966 CCCAGCAGGCTGAAGTGCAGTGG + Intronic
1126440451 15:48683022-48683044 CACCACAGGCTAAAGTGCTATGG + Intergenic
1126621699 15:50646356-50646378 CACTGCAGCCTCAACTTCTCAGG + Intronic
1127146422 15:56029049-56029071 CACTGCAGCCTCAAATGCTTGGG - Intergenic
1127155855 15:56123694-56123716 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1127178117 15:56383014-56383036 CACTACTGGCCAAAGTGCTCTGG - Intronic
1127482237 15:59388279-59388301 CACTGCAGCCTGGAATGCCCAGG + Intronic
1127820286 15:62648883-62648905 CACTGGAGGCTGGAGTGCAGTGG + Intronic
1127971624 15:63966556-63966578 CACTGCAGACTAAAGTGCTCTGG - Intronic
1128697450 15:69779285-69779307 CACTGAGGGCTGGAGTGGTCAGG - Intergenic
1128730330 15:70016400-70016422 CCCTGCAGGCTGAAGTCTCCAGG - Intergenic
1128748849 15:70134126-70134148 CACTGCAGCCTCAAATGCCCAGG - Intergenic
1128818317 15:70630130-70630152 CTCTGCAGGGTGCTGTGCTCTGG - Intergenic
1128837821 15:70825511-70825533 AGCAGCAGGCTGAAGTGCTTTGG - Intergenic
1129201219 15:74001926-74001948 CACTGCAGGCTCAAATTCTTAGG - Intronic
1129363730 15:75041554-75041576 CACTGCAGCCTCAACTGCCCTGG - Intronic
1129500959 15:76037570-76037592 CATTGTGGGCTGAAGTGCTCTGG + Intronic
1129642296 15:77393142-77393164 CACCATGGGCTGAAGTGCTCTGG + Intronic
1131310968 15:91289621-91289643 CATTGCAGCCTGGAATGCTCTGG + Exonic
1131959526 15:97773774-97773796 CATCGCAGGCTAAAGTGCTCTGG - Intergenic
1132875767 16:2136199-2136221 CGCTGCAGGCTAAAGTGCGTGGG + Intergenic
1133164463 16:3936844-3936866 CACTGCAGCCTCAACTGCCCAGG + Intergenic
1133536068 16:6703629-6703651 CACTGCAGCCTCAACTTCTCAGG - Intronic
1134519218 16:14911154-14911176 CTCTGCAGGCTAAAGTGCGTGGG - Intronic
1134554707 16:15155072-15155094 CACTGCAGGCTAAAGTGCGTGGG + Intergenic
1134706888 16:16309809-16309831 CTCTGCAGGCTAAAGTGCGTGGG - Intergenic
1134960652 16:18402315-18402337 CTCTGCAGGCTAAAGTGCGTGGG + Intergenic
1135258145 16:20958146-20958168 CACTGCAGGCTCGACTTCTCAGG + Intronic
1135466600 16:22691763-22691785 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1135731655 16:24899777-24899799 CACTGCAGCCTGGAGCTCTCAGG + Intronic
1135911213 16:26562686-26562708 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1136139441 16:28279165-28279187 CCCAGCAGGCTGAAGTGCAATGG - Intergenic
1136348389 16:29691609-29691631 CACTGCAGCCTCAACTGCCCAGG - Intronic
1136349957 16:29700314-29700336 CACTGCAGCCTCAACTGCCCAGG - Intergenic
1136389269 16:29952103-29952125 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1137271616 16:46906111-46906133 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1137306311 16:47203920-47203942 GTCTGCAAGGTGAAGTGCTCTGG + Intronic
1138031857 16:53565451-53565473 CACTGCAGGCAGCAATGCTGGGG + Intergenic
1138245178 16:55462196-55462218 CACCGCAGGCTGGAGTGCCCTGG - Intronic
1138646499 16:58429371-58429393 GACTGAAGACTGAAGCGCTCAGG - Intergenic
1138890820 16:61142297-61142319 CACTGTGGGCTAAAGGGCTCCGG - Intergenic
1139198824 16:64951404-64951426 CTATGCAGGCAGAAGTGCGCTGG - Intronic
1139286142 16:65816175-65816197 CACTGCAGCCTCAACTTCTCTGG + Intergenic
1139402117 16:66691075-66691097 CACTGCAGGCTGGAATGCAGTGG - Intronic
1139621481 16:68148053-68148075 CACTCCAGGCTGGAGTGCAATGG + Intronic
1139748973 16:69097074-69097096 CACTGCAGCCTCAACTTCTCGGG - Intergenic
1139972650 16:70785914-70785936 CACTGCAGGCTGCAGGGCCTGGG - Intronic
1140233590 16:73138761-73138783 CACTGCAGCCTGGACTGCCCAGG + Intronic
1140416997 16:74782108-74782130 CACTGCAGCCTCAACTTCTCAGG - Intergenic
1140793575 16:78414525-78414547 CATTGCAGGCTGGAGTGCAGTGG - Intronic
1141450335 16:84095618-84095640 CACTGCAGGCAGATGTGCTCTGG - Exonic
1142192554 16:88724652-88724674 CACTGCAGGCTGGAGTGCAGTGG - Intronic
1142273653 16:89104409-89104431 CACTGGTGGCTGCTGTGCTCTGG - Intronic
1142315865 16:89344614-89344636 CACTCCAGGCTGAGGGGCCCAGG + Intronic
1142762105 17:2048865-2048887 GACTGCTGGGTGTAGTGCTCTGG - Intergenic
1142919160 17:3169510-3169532 CACCACAGGCTAAAGTACTCTGG + Intergenic
1143039573 17:4023754-4023776 CACTGCAGCCTCAAATGCTTTGG - Intronic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1145200986 17:20944569-20944591 CACTGCAGGCTAAAGTGCTTTGG - Intergenic
1145232154 17:21181160-21181182 CACTGCAGCCTGAAAATCTCAGG + Intronic
1145280105 17:21461836-21461858 CACTGGGAGCTGAAGTGTTCTGG - Intergenic
1145837094 17:27962775-27962797 CACTGCAGCCTGAACTTCCCCGG + Intergenic
1146098935 17:29959957-29959979 CACTGAGGGCTAAAGTGCTCTGG - Intronic
1146216708 17:30982243-30982265 CACTGTGGGCTGAAGTGCTCTGG - Intronic
1147491016 17:40866219-40866241 CAATGCTGGCTGAAATGATCTGG + Exonic
1147986380 17:44309600-44309622 CACTGCAGGTTGAAGTGAACAGG - Intronic
1148484861 17:47984157-47984179 CACTGCAGGCTGCAGTGCAAAGG - Intergenic
1149092894 17:52805032-52805054 CGCTGTGGGCTAAAGTGCTCTGG - Intergenic
1149231205 17:54536583-54536605 CAAGGCTGGCTAAAGTGCTCTGG + Intergenic
1149274338 17:55016938-55016960 CACTACAGGCTGAATGCCTCTGG + Intronic
1149949054 17:60965259-60965281 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1150220492 17:63493318-63493340 CCCTGCATGCTGCAGTGCTGGGG + Intronic
1150252032 17:63711424-63711446 CACTGCAGCCTGAACTTCCCAGG + Intronic
1150531724 17:65990652-65990674 CACCACAAGCTGGAGTGCTCTGG + Intronic
1152224800 17:79087730-79087752 CACTGCAGGGTGAAATGATGTGG - Intronic
1152329245 17:79662160-79662182 CACTCCAGGCTGGAGTGCGGTGG + Intergenic
1153088532 18:1317841-1317863 CAATGCATGCTAAAGTGCTCTGG + Intergenic
1153319111 18:3754074-3754096 CACTGCAGCCTTAACTTCTCAGG + Intronic
1153356686 18:4144234-4144256 CACTGTGGGCTAAAGTGCTCTGG - Intronic
1153429376 18:4999322-4999344 CACCACAGACTGAAGTGTTCTGG + Intergenic
1153879778 18:9411336-9411358 CACTGCAGCCTCAACTGCCCAGG - Intergenic
1153955597 18:10093093-10093115 CACTGCAGGCTGAAGAGGTGAGG + Intergenic
1154209163 18:12364739-12364761 CACTGCAGCCTCAACTTCTCTGG + Intronic
1154253325 18:12762559-12762581 GACTGCAGGCTGGAGTGCAGTGG + Intergenic
1154254781 18:12773072-12773094 CACTGCAGTCTCAACTTCTCAGG + Intergenic
1155597192 18:27501998-27502020 CAGTGTAGGCTAAAGTGCTCTGG + Intergenic
1156026097 18:32656307-32656329 CACTGCAGGCTAAAGGGCTCCGG - Intergenic
1156155742 18:34300201-34300223 CACCACAGGCTAAACTGCTCTGG + Intergenic
1156912467 18:42426666-42426688 AACTGCAGGCTAAAGTGCTCTGG - Intergenic
1157022718 18:43805899-43805921 CACTGCGGGCCAAAGGGCTCTGG - Intergenic
1157805623 18:50655538-50655560 CACTGCAGCCTGCACTCCTCTGG + Intronic
1157936890 18:51883412-51883434 CACTACAGGCTGAAGGGCTCTGG + Intergenic
1158030896 18:52963515-52963537 CACAGGAGTCTGAAGTGGTCAGG + Intronic
1158431186 18:57389087-57389109 CACCACAGGCTAAAGTGCTATGG + Intergenic
1158949147 18:62475640-62475662 CACTGCAGACTAATGTGCTCTGG - Intergenic
1159080545 18:63730959-63730981 CACCACAGGCTGAAGTGCTTTGG + Intergenic
1159260142 18:66003752-66003774 CACCGTAGGCCAAAGTGCTCTGG + Intergenic
1159285019 18:66337379-66337401 CACTGTGGGCTAAAGTGTTCCGG - Intergenic
1159446218 18:68544709-68544731 CACCACAGGCTAACGTGCTCTGG + Intergenic
1159647979 18:70942633-70942655 AACTGCAGGCCACAGTGCTCTGG + Intergenic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1162480549 19:10924587-10924609 AACTGGAGCCTGCAGTGCTCAGG - Intronic
1162646129 19:12051865-12051887 CGCCCCAGGCTGAAGTGCTGTGG - Intronic
1163231171 19:16003206-16003228 CCCTCCGGGCTGAAGTTCTCTGG + Intergenic
1163818616 19:19483243-19483265 CAGTGCTGGCTAAAGAGCTCAGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165117937 19:33540288-33540310 CTCTGGAGGCTGAAGTGCAGTGG + Intergenic
1165314761 19:35047912-35047934 CACTGCAGTCTCAAGCGCTCAGG - Intronic
1165375754 19:35440510-35440532 CACTTCAGGCTGGAGTGCAGTGG - Intergenic
1165775087 19:38399481-38399503 CAGTGCAGGCTGAAGTGGTGGGG + Intergenic
1166408428 19:42540239-42540261 CACGGTGGGCTGATGTGCTCTGG - Intronic
1166757694 19:45203590-45203612 CACTGCGGGCCAAAGTGCTCTGG - Intronic
1167198086 19:48044483-48044505 CACTGCAGCCTGGAGTGCAATGG - Intergenic
1167582282 19:50352271-50352293 CACTGTTGGCTAAAGTGCTCTGG - Intronic
1167699980 19:51037377-51037399 GAGTGCAGGCTGGAGTGCCCAGG - Intergenic
1167938866 19:52930224-52930246 CACTCCAGGCTGGAGTGCAATGG + Intronic
1168006196 19:53489560-53489582 CACAACAGGCTGGAGTGCTATGG - Intronic
1168122609 19:54260568-54260590 GACCTCAGGCTAAAGTGCTCTGG - Intronic
1168394675 19:56038017-56038039 CTCTGCAGGCTGGATTGCTGTGG + Exonic
1168675165 19:58272478-58272500 CACTGCAGCCTCAACTTCTCAGG - Intronic
925269337 2:2591211-2591233 AACTGCAGGCTGAAGTGCTCTGG + Intergenic
926175699 2:10590144-10590166 CACTCCAGGCTGGAGTGCAGTGG + Intronic
926635535 2:15175005-15175027 CACTGCAGGCTGGAGTGCAGTGG + Intronic
926896089 2:17690552-17690574 CTCTGCAGGCTGGAGTGCAGTGG - Intronic
927185912 2:20482396-20482418 CCCTTCAGGTTGAAGTGTTCGGG - Intergenic
927687455 2:25181533-25181555 CATTCCAGGCTGAAGTGCAATGG + Intergenic
927773962 2:25887722-25887744 CACAGGAGTCTGAAGTGCTCAGG - Intergenic
928170097 2:28998036-28998058 CCCTGCGGGGTGGAGTGCTCAGG + Intronic
928472115 2:31585172-31585194 CACTGAGGGCTGAAGTGCTCTGG + Intergenic
929184661 2:39081121-39081143 CACTCCAGGCTGGAGTGCAGTGG - Intronic
929441207 2:41966937-41966959 CACTGCAGGATGATCTGCTCAGG + Intergenic
929496337 2:42447589-42447611 CACTGCAGCCTCAAATGCCCAGG + Intronic
929529326 2:42737254-42737276 CACTGTGGGTTAAAGTGCTCTGG - Intronic
929558217 2:42938547-42938569 CACTGCAGGCTGGACTGCAGTGG - Intergenic
929610707 2:43268838-43268860 CAGTGCTGGCTGGGGTGCTCAGG + Intronic
930062648 2:47303063-47303085 GTCTCCAGGCTGGAGTGCTCTGG - Intergenic
930640252 2:53847268-53847290 CACTGCAGGCTGGATTGCACTGG + Intergenic
930727249 2:54694410-54694432 CACCCCAGGCTAAAGTGCTCTGG + Intergenic
930778179 2:55196206-55196228 CACCACAGGCTCAAGTGCTTTGG + Intronic
930878382 2:56245196-56245218 CACTGCAGGCTAAAGTACTGTGG - Intronic
930930469 2:56875595-56875617 CACTGCCTGCTGAAGTGCTCTGG + Intergenic
930971372 2:57398622-57398644 CACTGCAGGCTAAAGGGCTCTGG - Intergenic
931012269 2:57930190-57930212 CATAGCAGGCTAAAGTACTCTGG - Intronic
931125926 2:59276007-59276029 CACTGCAGGCTGGAGTGCAGTGG - Intergenic
931380051 2:61744376-61744398 CACTGCAGGCTGGAATTCCCAGG - Intergenic
931637165 2:64351305-64351327 CACTGTGGACTAAAGTGCTCTGG + Intergenic
931650359 2:64462920-64462942 CATTGCAGGCTGGAGTGCAGTGG - Intergenic
932081745 2:68722040-68722062 CACTGCATGCTGAGGTGCTGAGG - Intronic
932359725 2:71094129-71094151 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
932589646 2:73057212-73057234 CACTGCAGCCTCAACTTCTCAGG + Intronic
932714712 2:74092894-74092916 CTCTGCAGGAAGAAGTGCTCCGG + Exonic
932775365 2:74525246-74525268 GACTTCAGTCAGAAGTGCTCAGG + Intronic
933316951 2:80726987-80727009 CACTGAGGGCTAAAGTGCTCTGG + Intergenic
933446536 2:82387195-82387217 CATGGCAGGCTCAAGTGTTCTGG + Intergenic
933462029 2:82600521-82600543 TACTGCAGGCTGAGGTCCTTAGG - Intergenic
933785059 2:85832428-85832450 CACTGCAGGCTCGAATGCTTGGG - Intergenic
933892853 2:86787456-86787478 GGCTGCAGGCTGAAGTGTTAAGG - Intronic
934870529 2:97861145-97861167 CACCTCAGGCTAAAGTGTTCTGG + Intronic
934928890 2:98404217-98404239 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
935356682 2:102207863-102207885 CACCACAAGCTAAAGTGCTCTGG - Intronic
935727260 2:106034463-106034485 CACTCCAGGCTGGAGTGCAATGG - Intergenic
936901433 2:117485614-117485636 CACTGCAGGCTAACGTGCTCTGG - Intergenic
936970180 2:118169485-118169507 CACTGCAGGCTGTGGAGCTCAGG + Intergenic
937061874 2:118986442-118986464 CACTGCAGGCTCAAATTCTTTGG - Intronic
937159003 2:119742444-119742466 CACTGCAGCCTCAAATCCTCAGG + Intergenic
937196724 2:120163910-120163932 CTGTCCAGGCTGAAGTGCACTGG - Intronic
937512417 2:122611278-122611300 CATAGGAGGCTAAAGTGCTCTGG + Intergenic
937591142 2:123614666-123614688 CACTGCAGGCCAAAGTGCTCTGG + Intergenic
937739393 2:125332792-125332814 TACCACAGGCTAAAGTGCTCTGG + Intergenic
938216906 2:129525887-129525909 CACCTCAGGCTGGAGTGCTCTGG + Intergenic
938743169 2:134252130-134252152 CACTGCAGGCTGGAGCCCTGGGG + Intronic
939144443 2:138395870-138395892 CACCACAGGCTAAAGTGCTCTGG + Intergenic
939273513 2:139970499-139970521 CATTGCAGGCTGAAATGCTCTGG + Intergenic
939295795 2:140262997-140263019 CACTGCAGCCTCAACTTCTCCGG + Intronic
940053045 2:149484321-149484343 AACTGCAAGCTGCAGTCCTCTGG - Intergenic
940947642 2:159636562-159636584 CACTGTGGGCTGAAGTGCTCTGG + Intergenic
941962785 2:171270018-171270040 CAGAGCAGGATGAAGTGCTGGGG + Intergenic
941979866 2:171442838-171442860 CACTCCAGGCTGGAGTGCAATGG - Intronic
942164509 2:173229059-173229081 TGGTGCAGGCTGAAGTCCTCTGG + Intronic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
942749972 2:179276460-179276482 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
943117586 2:183692265-183692287 CACCGTGGGCTAAAGTGCTCTGG - Intergenic
943166273 2:184330157-184330179 CACTGCAGGCTGAAATTCTTGGG + Intergenic
943339651 2:186664601-186664623 CACTGCAGGCTGATTTCATCGGG + Exonic
943485519 2:188474362-188474384 CACTGTGGGCTAAAGTGTTCTGG - Intronic
943933515 2:193885485-193885507 CACTGTGGACTGAGGTGCTCTGG + Intergenic
944096027 2:195968749-195968771 CACTGTGGGCTAAAGTGCTCTGG - Intronic
944651695 2:201837210-201837232 CACTGCAGCCTCAATTTCTCAGG - Intronic
944855181 2:203760337-203760359 CACTTCAGGCTAAAGTACTCTGG - Intergenic
944954971 2:204798407-204798429 CACAGCAGGCTAAAGCACTCCGG + Intronic
944990617 2:205230758-205230780 CACTGCAGGCTAAAGCGCTCTGG - Intronic
945575580 2:211525068-211525090 CACTGCAAGCTGAAGTGTTCTGG + Intronic
945771180 2:214044909-214044931 CACTGTGGGCGGAAGTGCTCTGG + Intronic
946697230 2:222372077-222372099 CACCACAGGCTAAAGGGCTCTGG + Intergenic
946700539 2:222408458-222408480 CACTGCAGGCCTATGTGCACAGG + Intergenic
946939526 2:224756458-224756480 CACTCCAGGCTGGAGTGCAATGG - Intergenic
946976310 2:225156283-225156305 CACTGCAGCCTCAACTGCCCTGG + Intergenic
947312437 2:228818816-228818838 CACCTCAGGCTAAAGTGCTTTGG - Intergenic
947653402 2:231806475-231806497 CACTGCAGCCTCAACTGCCCAGG - Intronic
947826619 2:233109958-233109980 CACTGCAGTCTGCATTTCTCAGG + Intronic
948475594 2:238216956-238216978 CACTGCGGGCTGAAGTGCTATGG - Intergenic
948603876 2:239122674-239122696 CTCTGCAGGCTGCAGGCCTCGGG + Intronic
948625344 2:239265011-239265033 CAATGCGGGCTGAAGTGGACAGG + Intronic
1168850907 20:976357-976379 CTCTGGATGGTGAAGTGCTCAGG + Intronic
1168917386 20:1501222-1501244 CACTGTGGGCTAAAGTACTCTGG - Intergenic
1168998709 20:2151091-2151113 CACTGCAGGCTGAGGGGCTGTGG - Intronic
1169597206 20:7214047-7214069 CCCTGCAGGCTAAAGTGCTCTGG + Intergenic
1169618054 20:7471957-7471979 CACTACAGACTAAAGTGCTGTGG - Intergenic
1170430090 20:16267738-16267760 CACTGCAGGAGGAAGAGCTGGGG + Intergenic
1170625320 20:18025869-18025891 CAAGGCAGGCAGAAGTGCTGGGG - Intronic
1170668292 20:18406068-18406090 CACTGGTGGCCGAGGTGCTCTGG + Intronic
1170864196 20:20138348-20138370 CACCACAGGCAAAAGTGCTCTGG - Intronic
1171287215 20:23951219-23951241 CACTGGAGGCTGCATTGCTCAGG + Intergenic
1171335923 20:24385374-24385396 CACTGTATGCTGTTGTGCTCTGG - Intergenic
1171376469 20:24697335-24697357 CACTGCAAGCTGCTGTGTTCTGG + Intergenic
1171408530 20:24930104-24930126 CTCTCTAGGCTGAAGTGCCCTGG - Intergenic
1171427325 20:25057308-25057330 CACTGCGGGCTGCGGTGCCCGGG - Intronic
1171509796 20:25672685-25672707 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1171937905 20:31293449-31293471 CACTGAGGGCTAAAGTGCTCTGG + Intergenic
1172006601 20:31822660-31822682 GCCTCCAGGCTGAAGTGCCCTGG + Intronic
1172075547 20:32293568-32293590 CACTCCAGGCTGGAGTGCAGTGG - Intronic
1172374077 20:34421938-34421960 CACTGCAGCCTCAACTTCTCAGG - Intronic
1172386626 20:34538359-34538381 CACTGCAGCCTCAACTGCCCAGG - Intronic
1172664514 20:36589992-36590014 CTCTCCAGGCTGGAGTGCACTGG + Intronic
1172995243 20:39065539-39065561 CACTCCAGGCTGGAGTGCAATGG - Intergenic
1173004276 20:39127539-39127561 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1173098837 20:40064874-40064896 CACTGCAGGCTAAGGTGCTATGG + Intergenic
1173604583 20:44322563-44322585 CACTGCAGCCTCAACTGCCCAGG - Intergenic
1173709675 20:45143626-45143648 CACTGCAGGCTAAAGTGCTATGG - Intergenic
1173981376 20:47226733-47226755 CACTGCAGCCTTAACTTCTCAGG + Intronic
1174007331 20:47420939-47420961 CACTGCAGCCTCAATTTCTCAGG - Intergenic
1174025615 20:47571765-47571787 GTCTGCAGGCTGCAGTGCTGTGG + Intronic
1174463381 20:50698870-50698892 CACTGCAGGCTCCACTCCTCAGG - Intergenic
1174489332 20:50881152-50881174 CACTGCAGCCTCAAGTTCCCTGG - Intronic
1174651596 20:52130287-52130309 CACTGCAGCCTCAAGTGCCCAGG + Intronic
1174724182 20:52844038-52844060 CACTGTAGGCTAAACTGCTTTGG - Intergenic
1175445429 20:59016441-59016463 CACTGCAGGTTGAAGTGCTCTGG + Intergenic
1175727402 20:61328744-61328766 CACTTCAGGCTGGAGTGCGGTGG - Intronic
1175728015 20:61332605-61332627 CACTGCAGGGTGAAGTTAACTGG - Intronic
1176375981 21:6087107-6087129 CACAGCATGCTGAGGAGCTCGGG - Intergenic
1176417827 21:6488824-6488846 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1176976390 21:15326725-15326747 CACTGCAGTCTGAACTCCTGGGG + Intergenic
1177424808 21:20908637-20908659 CACTCCAGGCTGGAGTGCACGGG - Intergenic
1177539758 21:22477285-22477307 CACTGCAGGCTAAAGGGCTGTGG + Intergenic
1177849754 21:26332642-26332664 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1179076817 21:38129971-38129993 CTCTTCAGGCTAAGGTGCTCAGG - Intronic
1179652405 21:42820218-42820240 CACCACAGGCTAAAGTTCTCTGG + Intergenic
1179693321 21:43097155-43097177 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1179747494 21:43451137-43451159 CACAGCATGCTGAGGAGCTCGGG + Intergenic
1179919822 21:44501687-44501709 CATTGCAGGCTGAAATTCCCAGG - Intronic
1181573851 22:23781891-23781913 CCCTGCAGGCTGGACTGCCCTGG - Intronic
1181644238 22:24222231-24222253 CCCTGCAGGGTGAGGTTCTCGGG - Intronic
1181989034 22:26822641-26822663 TTCTGCAGGCTGCAGGGCTCTGG - Intergenic
1182587388 22:31352489-31352511 CACTGCAGTCTGGAATGCTTTGG + Intergenic
1183732794 22:39628020-39628042 CCCTGCAGGGAGAAGTGCTTGGG + Intronic
1183939557 22:41285740-41285762 AGCTGCAGGCTGAGCTGCTCTGG + Intronic
1184556813 22:45237774-45237796 CAGTGGACGCAGAAGTGCTCCGG + Intronic
949096860 3:96652-96674 CACTGCAGGCTCAAGTTCCCAGG - Intergenic
949235790 3:1806705-1806727 CACTGCAGGCTAAAGTGCTATGG - Intergenic
949448624 3:4162437-4162459 CACTGCTGGGTAAAGGGCTCTGG - Intronic
949623073 3:5837839-5837861 CACTGTGGGCTAAAGGGCTCTGG - Intergenic
949755861 3:7410121-7410143 TACTGTAAGCTGAAGAGCTCAGG + Intronic
949957856 3:9284755-9284777 CACTGCAGCCTCAACTTCTCAGG - Intronic
950637591 3:14325762-14325784 CACTGCAGCCTCAACTGCTGGGG + Intergenic
950888069 3:16378012-16378034 CTCGGCAGGCAGCAGTGCTCCGG - Exonic
951233625 3:20209210-20209232 CACTGCAGCCTCAACTTCTCAGG + Intergenic
951297519 3:20957129-20957151 CACTGCAGCCTCAACTTCTCAGG - Intergenic
952123325 3:30270637-30270659 CACTCCAGGCTGGAGTGCAATGG + Intergenic
952912818 3:38204942-38204964 CTCTGCAGGCTAAAGTGCTCTGG - Intronic
953158795 3:40399143-40399165 CACTGCAGCCTCAACTTCTCAGG - Intronic
953217145 3:40930321-40930343 CACTGTGTGCTGGAGTGCTCTGG + Intergenic
953362487 3:42310109-42310131 TACTGTGGGCTAAAGTGCTCTGG - Intergenic
953757391 3:45658593-45658615 CATTGCAGGCTGGAGTGCAATGG + Intronic
953791771 3:45952939-45952961 CACTGCAGGCTTACATGGTCAGG + Intronic
954300812 3:49699847-49699869 CACTGAGGGCTGCAGTGCTGAGG + Intronic
954793380 3:53148887-53148909 CTCGGCAGGCTGAAGTGCAGTGG + Intergenic
954880768 3:53834404-53834426 CCCTGCAGGCTGGAGTGCAGTGG - Intronic
955001753 3:54933806-54933828 CACTGCAGGCTAGAGTGCAGTGG + Intronic
955113158 3:55969705-55969727 CACAGAAGGCTGTAGTGCTTGGG + Intronic
955565180 3:60236523-60236545 CACTGAAAACTGAAGTGCTGTGG + Intronic
957236904 3:77605087-77605109 CACTGCAGGCTCAACTTCTCAGG - Intronic
957907686 3:86578771-86578793 CACTACAGGCTGAAGTGCTCTGG - Intergenic
957965745 3:87321144-87321166 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
957976201 3:87448011-87448033 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
958268368 3:91467045-91467067 CACTGCTGGCTAAGGTGCTCAGG + Intergenic
958757933 3:98272267-98272289 CACCACAAGCTGAAGTGCTCTGG - Intergenic
958765419 3:98361333-98361355 CACCACAGGCTAAAGTGCTATGG - Intergenic
959126035 3:102291150-102291172 CACCACAGGCTAAAGTGCTCTGG - Intronic
959336001 3:105066174-105066196 GGCCTCAGGCTGAAGTGCTCTGG + Intergenic
959399699 3:105884831-105884853 CACTGCAGGCTGAGAAGCACTGG - Intergenic
959409130 3:105998238-105998260 CATCACAGGCTGAAGTGCTTTGG - Intergenic
959537023 3:107497973-107497995 CACTACAGGCTGAAGTGTTTGGG + Intergenic
960095516 3:113686115-113686137 CACTGAGGGCTAAAGTGCTCTGG - Intronic
960605694 3:119502596-119502618 CAGTGCAGGCTGGAGTGCAGCGG + Intronic
960809228 3:121612460-121612482 CACTGTAAGTTCAAGTGCTCCGG - Intronic
961398160 3:126612516-126612538 CACTCCAGGCTGGAGTGCAGTGG + Intronic
961610320 3:128132259-128132281 CACCGCAGGCTAAAGTGCTCTGG + Intronic
961952208 3:130761991-130762013 CACCACGGGCTAAAGTGCTCTGG + Intergenic
962038875 3:131683783-131683805 CACTGCAGGCTGAAGGGCTCTGG - Intronic
962870942 3:139492313-139492335 CACTGTAGGCTAAAGTGCTCTGG - Intergenic
963048614 3:141123609-141123631 CAGGGCAGGGTGAAGTCCTCAGG - Intronic
963071201 3:141306807-141306829 CACTGGCTTCTGAAGTGCTCTGG - Intergenic
963078688 3:141371426-141371448 CACTGCAGCCTCAACTTCTCAGG + Intronic
963179606 3:142339725-142339747 CACTGCAGGCTCAACCGCTTGGG - Intronic
963309993 3:143699698-143699720 CACTGTAGGCTAAATTCCTCTGG + Intronic
964992204 3:162828170-162828192 CACTACAGGTTAAAGTGCTTTGG + Intergenic
965034601 3:163422726-163422748 CACCGCAGGTTAATGTGCTCTGG + Intergenic
965175326 3:165323016-165323038 CACTAAGAGCTGAAGTGCTCTGG - Intergenic
965379162 3:167966949-167966971 CTCTGCAGACTGAAGTGCTATGG + Intergenic
965380540 3:167982799-167982821 CACTGCAGACTAAAGTACACTGG + Intergenic
965535330 3:169817993-169818015 CACTGTGGGATAAAGTGCTCTGG - Intergenic
965577436 3:170232124-170232146 CACTGCAGCCTTAACTGCCCAGG + Intronic
965821591 3:172689669-172689691 CACTCCAGGCTGGAGTGCAGTGG - Intronic
965980215 3:174681210-174681232 TACCACAGGCTAAAGTGCTCTGG + Intronic
966189626 3:177260318-177260340 CACTTCAGGCTGGAGTGCAGTGG + Intergenic
966927211 3:184652550-184652572 CACTGCAGCCTGGAGGGCTGAGG - Intronic
967363117 3:188654804-188654826 CACTGCAGGTTGGAGTCCTCTGG - Intronic
968017933 3:195356352-195356374 CACCACAGGCTAAAGTGCTCTGG + Intronic
968096099 3:195931927-195931949 CACTGCTGGCTAAAGAGCTCTGG + Intergenic
968272960 3:197418792-197418814 GAGTACAGGCTGAAGTGCCCAGG + Intergenic
968566161 4:1314285-1314307 CTGTGCAGGCTGAAGTGCAGTGG - Intronic
969034360 4:4241035-4241057 CACTCCAGGCTGGAGTGCAATGG - Intronic
969264401 4:6055566-6055588 CACTGGTGGTTGAAGGGCTCTGG + Intronic
969423389 4:7109906-7109928 CCCTGGAGGCTGAGCTGCTCTGG - Intergenic
970098052 4:12487291-12487313 CACTGTGGGCTAAAGGGCTCTGG - Intergenic
970442378 4:16092972-16092994 TACTGCAGGCTAAAGTGCTCTGG + Intergenic
970782247 4:19751917-19751939 TAGCCCAGGCTGAAGTGCTCTGG + Intergenic
970998627 4:22296852-22296874 TCATGCAGGCTGAAGTGCTGTGG + Intergenic
971427520 4:26530820-26530842 CACTGCAGCCTCAACTTCTCAGG + Intergenic
971567924 4:28168658-28168680 CACTGAAGGCTAAAGTGCTCTGG - Intergenic
972009458 4:34158639-34158661 CACTGTGGGCTGAAGTGTTTTGG + Intergenic
972207717 4:36798220-36798242 CATCACAGGCTGAAGTGCTCTGG + Intergenic
972405853 4:38746039-38746061 CACTGCAGCCTGTATTGCCCAGG - Intergenic
972588018 4:40456639-40456661 CACTGCAGCCTCAACTTCTCAGG + Intronic
972782666 4:42299750-42299772 CACTGCAGCCTCAAGTCCCCAGG - Intergenic
973039559 4:45453481-45453503 CAGTGCAGGCTGAAGCCATCAGG + Intergenic
973227367 4:47801771-47801793 CACTGCAGGCTGGAATGCTCTGG + Intronic
973348463 4:49082412-49082434 CAGGGCAGGCTAAAGTGCTCTGG + Intergenic
974290640 4:59925613-59925635 CACCACAGGCTACAGTGCTCTGG + Intergenic
974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG + Intergenic
974415053 4:61595779-61595801 CACTGAGGGCCAAAGTGCTCTGG - Intronic
975142682 4:70934491-70934513 CACTCCAGGCTGGAGTGCAGTGG + Intronic
975172885 4:71252985-71253007 CACTGCACTGTGAAGTGCTATGG - Intronic
975242792 4:72081561-72081583 CACTGCAGCCTCAATTGCCCAGG + Intronic
975365673 4:73524722-73524744 CACTTGGGGCTGAAGTGCTCTGG - Intergenic
975592877 4:76017713-76017735 CTCTGCTCGCTAAAGTGCTCTGG - Intronic
975657031 4:76651903-76651925 CATGGCAGGCTGAAGTGCAGGGG - Intronic
976030121 4:80741814-80741836 CGCCACAGGCTGAATTGCTCTGG - Intronic
976041002 4:80885236-80885258 TACTACAAGCTGAAGTGCTCTGG + Intronic
976173652 4:82330563-82330585 CACCCCAGGCTGAAGTGCACTGG - Intergenic
976451968 4:85200264-85200286 CACCACAGGCTACAGTGCTCTGG - Intergenic
976873983 4:89832004-89832026 CACTCCAGGCTGAAGTGCAGTGG - Intronic
977074307 4:92433375-92433397 CATTGCAGGCTAAAGCACTCTGG - Intronic
977099353 4:92790489-92790511 CACTGCAGGCTGAATTTCCTGGG + Intronic
977166976 4:93711521-93711543 CACCGTGGGCTGAAGTGCTCTGG - Intronic
977527916 4:98166712-98166734 CACTGTTGGCAAAAGTGCTCTGG - Intergenic
977531632 4:98207557-98207579 CACTGCAGCCTCAACTTCTCCGG + Intergenic
977990752 4:103438464-103438486 CACTGCAGCCTCAAGCTCTCAGG - Intergenic
978111941 4:104975049-104975071 CACTGTGGGCCAAAGTGCTCCGG + Intergenic
978199043 4:106003819-106003841 CTCTGCAGGCTGATTTGATCTGG - Intronic
978528450 4:109690444-109690466 CACTGCAGCCTCAATTTCTCAGG - Intronic
979396646 4:120197398-120197420 CATCGTGGGCTGAAGTGCTCTGG + Intergenic
979945749 4:126829712-126829734 CACTGTGGGCTAAAGGGCTCGGG + Intergenic
980088318 4:128415704-128415726 CACTGAAGGCTAATGTGCACTGG - Intergenic
980172488 4:129306358-129306380 CACCACAGGCTAAAGTGCTCTGG - Intergenic
980172495 4:129306400-129306422 CACCACAGGCTAAAGTGCTCTGG - Intergenic
980172502 4:129306442-129306464 CACCACACGCTAAAGTGCTCTGG - Intergenic
980692942 4:136319820-136319842 CGCCACAGGCTGAAGTGCTCTGG + Intergenic
980956803 4:139437035-139437057 CACTGCAGCCTCCAGTGCTTTGG + Intergenic
981768072 4:148274735-148274757 CACTCCAGGCTGGAGTGCAATGG + Intronic
981836534 4:149061395-149061417 CACTGCAGCCTCAACTGCTCAGG + Intergenic
981947338 4:150363053-150363075 CACTGCAGCCTCAACTGCTCAGG - Intronic
982203089 4:152976878-152976900 CACAGCAGGCTGCAGTCCACAGG - Exonic
982249820 4:153393444-153393466 CACTGCAGCCTGAAGCTCCCAGG + Intronic
982339748 4:154284766-154284788 CACTGCAGGCTAAAGAGCTCTGG + Intronic
982368014 4:154601856-154601878 CACTGCAGGCTCAATTCCCCAGG + Intergenic
982649752 4:158072944-158072966 CACTGCAGCCTCAACTTCTCAGG - Intergenic
982700399 4:158654806-158654828 CACTGCAGGCTGGAGTGCAGTGG + Intergenic
982828380 4:160028095-160028117 CACAGCAGGCTGAAGTGCTTTGG - Intergenic
983840855 4:172455479-172455501 CACAGCAGCCTGAAGTGACCTGG + Intronic
984452760 4:179924358-179924380 CACCCCAGGCTGAAGTGCAGTGG - Intergenic
984915501 4:184719522-184719544 CACTATGGGCTAAAGTGCTCTGG + Intronic
985746233 5:1649882-1649904 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
986544535 5:8880736-8880758 CACCGTGGGCTAAAGTGCTCTGG - Intergenic
987163888 5:15173889-15173911 CACTGCAGGATAAAGTGCTCTGG + Intergenic
987187172 5:15434500-15434522 CTCTGCAGGCTGGAGTGCAGTGG - Intergenic
987772885 5:22329872-22329894 CACTGTGGACTGAAGTGTTCTGG + Intronic
988064603 5:26218524-26218546 CACTGCTGGCTAAAGGGCTCTGG + Intergenic
988082644 5:26433214-26433236 CACTGTAGGCTAAATAGCTCTGG + Intergenic
988169840 5:27639294-27639316 TACCACAGGCTAAAGTGCTCTGG - Intergenic
988247019 5:28699048-28699070 CACTGCAGCCTCAACTTCTCTGG - Intergenic
988307931 5:29517888-29517910 CTCTGCAGTATGCAGTGCTCAGG - Intergenic
988931611 5:36040712-36040734 CACCGCAGGCTAAAGTGCTCTGG + Intronic
988956436 5:36324509-36324531 CACTGCAGGTTGAAGTGCTATGG - Intergenic
989235799 5:39147343-39147365 CACTGCAGGCTGGACCTCTCAGG + Intronic
989329995 5:40245818-40245840 CACCACAGGCTAAAGTGCTGTGG + Intergenic
989476863 5:41883951-41883973 CACTTCAGGCTGGAGTGCAGTGG - Intergenic
989690930 5:44143123-44143145 CACAGCTGGCTAAAGTGCTCTGG - Intergenic
989723226 5:44554130-44554152 CACTGAGGGCTAAAGTGCTCTGG - Intergenic
990050967 5:51500488-51500510 CACTGCAGCCTTAAGTTCTTGGG + Intergenic
990214368 5:53514143-53514165 CACTGCAGCCTGGAGTGCTCTGG - Intergenic
990214370 5:53514149-53514171 CACTCCAGGCTGCAGTGGTGAGG + Intergenic
990784538 5:59404617-59404639 GACTGGAGGCTGAAGTGCAGTGG - Intronic
990799922 5:59588885-59588907 CAATGTAGGCTGAAGTTTTCTGG - Intronic
990904635 5:60791050-60791072 CACTGCAGCCTCAACTGCCCAGG + Intronic
991297097 5:65093115-65093137 CACTGTAGGCTGCAGTGCCCAGG + Intergenic
991919721 5:71643309-71643331 CACTGCAGCCTCAAATTCTCAGG - Intronic
992371376 5:76147503-76147525 AACTCCATGCTGAAGTGCTCTGG - Intronic
992686011 5:79200186-79200208 CACTGCAGCCTCAACTGCTTGGG + Intronic
992905534 5:81342064-81342086 CACTGGAGGCTGAAATGCCTGGG + Intronic
993026530 5:82653598-82653620 CACTGCAGGCTAAAGGCCTCTGG - Intergenic
993030540 5:82700453-82700475 CACTCCAGGCTGGAGTGCAATGG - Intergenic
993138279 5:83998004-83998026 CACTGCAAGCTAAAGTACTCTGG + Intronic
993257000 5:85604631-85604653 CACTGTGAGCTAAAGTGCTCTGG + Intergenic
993981172 5:94545231-94545253 CACCACAGGCTGCGGTGCTCTGG + Intronic
994028494 5:95113656-95113678 CATCGCAGGCTAAAGTACTCTGG + Intronic
994170254 5:96652122-96652144 CACTGCAGGAAGATCTGCTCTGG - Intronic
994217951 5:97159744-97159766 CACCACAGGCCGAAGTGCTCTGG - Intronic
994226079 5:97253347-97253369 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
994310163 5:98259939-98259961 CACCACAGGCTGAAGTGCTCTGG - Intergenic
994974024 5:106779509-106779531 CACTGCAGGCTGAATTTCTCTGG + Intergenic
995049603 5:107687676-107687698 CACTACAGGCTAAAGTGCTCTGG + Intergenic
995096284 5:108239576-108239598 TACTGTGGGCTGAAGTGCTCTGG + Intronic
995265210 5:110152021-110152043 CACTGCAGGCTGGCATGCTCTGG + Intergenic
995494271 5:112725021-112725043 CACCCCAGGCTGAAGTGCAGTGG + Intronic
995557457 5:113344305-113344327 CACCGTGGGCTAAAGTGCTCTGG + Intronic
995573252 5:113503448-113503470 CACTGCAGGCTAAAGCTCTGGGG - Intergenic
995774784 5:115713222-115713244 CACTGCAGCCTCAACTTCTCTGG + Intergenic
996176701 5:120368390-120368412 CACTGGATGCTGATGAGCTCAGG + Intergenic
997448717 5:133964175-133964197 CACTCCAGGCTGGAGTGCAATGG - Intronic
997817502 5:137033220-137033242 CACTGCAGGCTGCAGCACACCGG - Intronic
998058061 5:139096308-139096330 CGCCACAGGCTAAAGTGCTCTGG + Intronic
998385727 5:141756198-141756220 CTCTGTAGGCTGCAGTGCTAGGG + Intergenic
999002627 5:147940377-147940399 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
999286484 5:150397236-150397258 CAGTGCTGACTCAAGTGCTCTGG - Intronic
999289973 5:150418104-150418126 CACTGCAGCCTGAACTTCCCAGG + Intergenic
999388074 5:151169522-151169544 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
999983541 5:156981233-156981255 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1000245708 5:159446981-159447003 CCCTGCAGGCAGAAGTTCTCAGG - Intergenic
1001134390 5:169090386-169090408 CTCTGCAGGCTGCAGTTCCCAGG - Intronic
1001387244 5:171349907-171349929 CACTGCAGCCTCAACTTCTCGGG + Intergenic
1002419916 5:179140093-179140115 CACTGCAGGCTGCAGAGCGCAGG - Intronic
1002445945 5:179290038-179290060 CAGTGCAGTCTGGAGTGCTACGG + Intronic
1003438047 6:6112032-6112054 CACCGTGGGCTAAAGTGCTCTGG - Intergenic
1004850318 6:19692008-19692030 GACTGCAGGGTGAGGGGCTCCGG + Intergenic
1005156861 6:22817585-22817607 CACTGTGGGATGAAGTGATCTGG + Intergenic
1005157159 6:22819855-22819877 CACTGTGGGATGAAGTGCTCTGG - Intergenic
1005854745 6:29852468-29852490 CCTTGCAGGCTCATGTGCTCTGG + Intergenic
1005942885 6:30574174-30574196 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1006015068 6:31074129-31074151 CACTGCAGCCTCAACTTCTCAGG - Intergenic
1006446262 6:34081434-34081456 CTCTTCAGGCTCAAGGGCTCTGG + Intronic
1006920771 6:37625771-37625793 CATAGCAGGCTCAAGGGCTCTGG - Intergenic
1007803048 6:44414153-44414175 CACTGCAGACTCAACTTCTCTGG + Intronic
1008192285 6:48475002-48475024 TACTGTGGGCTAAAGTGCTCTGG + Intergenic
1008599393 6:53075781-53075803 CACCCCAGGCTGGAGTGCTGTGG + Intronic
1008871815 6:56280927-56280949 CACTGCAGGCTTAACCTCTCAGG - Intronic
1008880663 6:56377598-56377620 CACAGCAGGCTAAAGCACTCTGG + Intronic
1008986836 6:57554540-57554562 CACTGCTGGCTAAGGTGCTCAGG - Intronic
1009174796 6:60447102-60447124 CACTGCTGGCTAAGGTGCTCAGG - Intergenic
1009618349 6:66039319-66039341 TACTGCAGGCTAACGTACTCTGG + Intergenic
1010254504 6:73742528-73742550 GGCTGCAGGCTGCACTGCTCTGG - Intronic
1010434544 6:75814131-75814153 CACTGCAGGCTAAATTGTTCTGG - Intronic
1010758003 6:79690025-79690047 CCATGCAGGCTGTAGTGCACTGG + Intronic
1011033120 6:82943996-82944018 TACTGTGGGCTGAAGTGCTCTGG + Intronic
1011126621 6:84014720-84014742 AACTGCAGGCTGGAGTGCAGTGG + Intergenic
1011343161 6:86339991-86340013 CACTGTGGGCTAAAGTTCTCTGG + Intergenic
1011598300 6:89037284-89037306 CACTACAGGCTGAAGTGCTCTGG + Intergenic
1011701900 6:89963367-89963389 CACTGCAGGCTCAACTTCCCAGG + Intronic
1011791940 6:90907844-90907866 AACCGCAGGCCAAAGTGCTCTGG - Intergenic
1011955232 6:93017346-93017368 CACTGAAGGCAAAAGTGCTCTGG + Intergenic
1012190694 6:96276555-96276577 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
1012224402 6:96688172-96688194 CACCATGGGCTGAAGTGCTCTGG + Intergenic
1012238811 6:96849178-96849200 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1012279859 6:97315828-97315850 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1012472452 6:99587675-99587697 CACTTCAGGGTGAAGTTGTCAGG + Intergenic
1012486354 6:99725832-99725854 CACCACAGGCTAAAGTGCCCTGG - Intergenic
1012827250 6:104162349-104162371 CACTGCAGGCTAAAGTACCCTGG + Intergenic
1013390234 6:109679227-109679249 CACCGCAGTCTGAAGTGACCTGG + Intronic
1013908476 6:115246113-115246135 CACCTCAGGCTAAAGTGATCTGG + Intergenic
1014284238 6:119478663-119478685 CCATCCAGGCTGGAGTGCTCTGG + Intergenic
1014430554 6:121365556-121365578 CATTTCAGGCTAAAGGGCTCTGG + Intergenic
1014601791 6:123421932-123421954 CTCTGTAGGCTGAAGTGCAGTGG - Intronic
1014674864 6:124351427-124351449 CACTGCAGCCTCAACTGCACTGG - Intronic
1014739443 6:125130713-125130735 CACTGCAGCCTCAAGTTCTTAGG + Intronic
1014866106 6:126532463-126532485 CACTGCAGCCTCAACTGCCCAGG + Intergenic
1014994669 6:128126560-128126582 CACTGCAGCCTCAACTGCCCGGG + Intronic
1015315893 6:131815738-131815760 TAGTGCAGGCTGAAGTGCAGTGG + Intronic
1015578909 6:134702297-134702319 CACCACAGGCTAAAGTGCTCTGG - Intergenic
1015746228 6:136512802-136512824 CACTGAAGGCTGGGGTGCTGCGG + Intronic
1016054817 6:139567340-139567362 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1016153894 6:140780327-140780349 CACTGCAGGCTAAAGTGCTCCGG + Intergenic
1016602836 6:145882018-145882040 CACTGCAGCCTCAACTTCTCAGG - Intronic
1016813300 6:148281532-148281554 CACAGGAGGCTGAAGTCATCAGG - Intronic
1016956856 6:149635199-149635221 CACTGCAGCCTTAACTCCTCAGG - Intronic
1017491578 6:154950261-154950283 CACTGCAGGCTCAAGTGCTCTGG - Intronic
1017784562 6:157744650-157744672 CAGTGAGGGCTGAAGTGCTGGGG - Intronic
1017897490 6:158693291-158693313 CACTGCAGCCTCAAGTTCTTTGG + Intronic
1017901872 6:158724973-158724995 CACTGGAGGCTGCAGTGCAGTGG - Intronic
1018067270 6:160132963-160132985 CACTGCTGGCTGCCGTGCCCTGG - Intronic
1018274898 6:162120091-162120113 CACTGCAGCCTCAACTTCTCAGG + Intronic
1018946338 6:168348878-168348900 CACTGCAGGCCCAAGTGTGCTGG - Intergenic
1019044305 6:169131482-169131504 CACTGTGGGCTGAAGTGCTCTGG + Intergenic
1020485485 7:8715070-8715092 CACCACAGACTAAAGTGCTCTGG - Intronic
1020574912 7:9913820-9913842 CACTGTAGGCTAAAGTGTTCTGG - Intergenic
1021214708 7:17901434-17901456 CACTGCTGGCTAATGTGCTCGGG - Intronic
1021327537 7:19292965-19292987 CACTGCAGCCTCAACTACTCAGG - Intergenic
1021760709 7:23900829-23900851 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1021860515 7:24901274-24901296 CACTGCAGGCTGGAGTACAGTGG - Intronic
1022077513 7:26987091-26987113 CACTGCAGCCTCAAATTCTCAGG - Intronic
1022223678 7:28340761-28340783 CACTGCAGGCTAAAGTGTTCTGG - Intronic
1023208977 7:37782620-37782642 CACTGCAGGTTAAAGTGCTCAGG - Intronic
1023646182 7:42318429-42318451 CACTGTGGGCTAAAGTGTTCTGG + Intergenic
1023646867 7:42326885-42326907 TACTCCAGGCTGAAATGATCTGG - Intergenic
1023716160 7:43046480-43046502 CACCACAGGCTAAAGTGCTGTGG + Intergenic
1024011284 7:45269079-45269101 CCCTCCAGACTGAATTGCTCTGG + Intergenic
1024041386 7:45558737-45558759 CAATGCATACTGAAGTGCTCAGG - Intergenic
1025745396 7:64238425-64238447 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1025754677 7:64326332-64326354 CAAATCTGGCTGAAGTGCTCTGG - Intronic
1025862043 7:65339319-65339341 CCCCTCAGGCTAAAGTGCTCTGG - Intergenic
1025949610 7:66133466-66133488 CACTGCAGGCTGGAGTGCAGCGG - Intronic
1026163795 7:67892274-67892296 CACTGCAGGCTGGACTTCACAGG - Intergenic
1026927626 7:74204891-74204913 CACCGCAGGCTGGAGTGCAGTGG + Intronic
1027241735 7:76334816-76334838 CACTGCAGCCTCAACTTCTCAGG + Intronic
1027419334 7:78004484-78004506 CATTGCAGGCTGCAGGGCTGAGG + Intergenic
1028028942 7:85884513-85884535 CACTGCAGCCTGGAGTTCTCTGG + Intergenic
1028284689 7:88981612-88981634 CACTGTGGGCTAAAGTTCTCTGG - Intronic
1028929637 7:96398254-96398276 CACTGTGGGCTGAAGTACTCTGG - Intergenic
1028972488 7:96874969-96874991 CACCACAAGCTAAAGTGCTCTGG + Intergenic
1028995724 7:97098114-97098136 CACTGCAGCCTCAATTTCTCTGG + Intergenic
1029018315 7:97337793-97337815 CACTGCAGCCTCAGGTTCTCGGG - Intergenic
1029342153 7:99953995-99954017 CATTGCAGGCTGGAGTGCAGTGG + Intergenic
1029398844 7:100328501-100328523 CACTGCAGTCTCAAGTTCCCGGG + Intergenic
1029513328 7:101010410-101010432 CACTGCAGGCTCAACCTCTCGGG + Intronic
1029528819 7:101111921-101111943 CACTGCAGCCTCAAGCTCTCGGG - Intergenic
1029840446 7:103357284-103357306 CACCCCAGGCTGAAGTGCAGTGG - Intronic
1030043029 7:105468975-105468997 CACTGTAGCCTCAAATGCTCAGG + Intronic
1030431700 7:109456172-109456194 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1030990247 7:116291025-116291047 CAACACAGGCTAAAGTGCTCTGG + Intronic
1031117865 7:117687768-117687790 CACTGCAGGCTCAACTTCCCGGG + Intronic
1031412569 7:121457264-121457286 CACTGCAGGCTAAAGTACTCTGG - Intergenic
1031472334 7:122182107-122182129 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1031553481 7:123143357-123143379 CACTGCGGGCTAAAGTGTTCTGG - Intronic
1031660113 7:124413364-124413386 CAATGCAGGAAGAAGTGCTCTGG - Intergenic
1031732554 7:125316541-125316563 CACTGCAGACTGAAGTGCTCTGG + Intergenic
1031862217 7:126993856-126993878 TACTGCAGGCTAAACTGCTCTGG + Intronic
1032726994 7:134599398-134599420 CACTGTGGGCTGGAGTGCTCTGG - Intergenic
1032804652 7:135341871-135341893 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1032939046 7:136767758-136767780 CACCAAAGGCTGAAGTGTTCTGG + Intergenic
1033814092 7:145051471-145051493 CACCACAGGTTAAAGTGCTCTGG - Intergenic
1033833719 7:145283443-145283465 CACTGCAGGCTAAAGGTCTCTGG - Intergenic
1034126311 7:148674992-148675014 CACTGCAGGCAAAAGTGCTCTGG + Intergenic
1034353633 7:150433729-150433751 CATTGCAGGCTGAAGAGGACTGG + Intergenic
1034586610 7:152099401-152099423 CTCTGCAGGCTGGAGTGCAGTGG + Intronic
1034631662 7:152535647-152535669 TCATGCAGGCTGAAGTGCTGTGG + Intergenic
1034847891 7:154464084-154464106 CACTGTGGGCTAAAGTGGTCTGG - Intronic
1035084637 7:156247554-156247576 CTCTGCAAGCTAAAGTGCTCTGG - Intergenic
1035255940 7:157627448-157627470 CGATGCAGGCTGAAGTGCTTAGG + Intronic
1035306761 7:157938097-157938119 CACTGCAGGGCACAGTGCTCTGG + Intronic
1035823158 8:2616656-2616678 GGCTGCAGGCTGAAGTGCAGTGG + Intergenic
1036795823 8:11755867-11755889 CTCTCCAGGCTGAAGTGCAGTGG - Intronic
1036936119 8:13004179-13004201 CACTGTAGGCTAAAGGGCTCTGG + Intronic
1037254757 8:16941316-16941338 CACTGTGGGCTGAACTGCTTTGG + Intergenic
1037274383 8:17161818-17161840 CACCCCAGGCTGAAGTGCAGTGG - Intronic
1037680965 8:21097145-21097167 CCTTGGAGGCTGAAGAGCTCTGG + Intergenic
1037939759 8:22942642-22942664 CACTCTAGGCTGAAGTGCAGTGG - Intronic
1038492979 8:27983158-27983180 TCCTGCAGGCAGAAGTGCTGAGG - Intronic
1038569231 8:28645936-28645958 CACTGCAGCCTCAACTTCTCAGG + Intronic
1039059243 8:33560411-33560433 CCCTGCAGGCTGGAGTGCAGTGG + Intronic
1039543878 8:38393605-38393627 CACTCCAGGCTGGAGTGCAGTGG - Intronic
1039555061 8:38469227-38469249 CACTGCAGGCTGGAGACTTCTGG - Intergenic
1040511604 8:48100762-48100784 CACCATAAGCTGAAGTGCTCTGG - Intergenic
1040628055 8:49175115-49175137 CAGTGTAGGATAAAGTGCTCTGG + Intergenic
1041679161 8:60569584-60569606 CACTGCAGCCTGGAGTTCCCAGG + Intronic
1042603408 8:70522559-70522581 CACTGCAGGCTCAACTTCTGGGG + Intergenic
1042898292 8:73694980-73695002 CACCACAGGCTGAAGTGCTCCGG + Intronic
1043147083 8:76672857-76672879 CACTGCAGGCAGGAGTGGGCTGG - Intergenic
1043312450 8:78877100-78877122 CACTGTGGGCTGAAGTGCTCTGG - Intergenic
1043351286 8:79363670-79363692 CACTGCAGCCTCAACTGCTTGGG + Intergenic
1043456691 8:80419032-80419054 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1043547655 8:81333542-81333564 CACTGCAGGCTTGACTGCCCAGG + Intergenic
1043741754 8:83822993-83823015 CACTGCAGCCTCAACTTCTCTGG + Intergenic
1043760684 8:84063717-84063739 CACCTCAGGCTCAAGTTCTCTGG - Intergenic
1043997916 8:86842568-86842590 CACTTCAAGCTAAAGTACTCTGG + Intergenic
1044066172 8:87703019-87703041 CACTGTGGGCAAAAGTGCTCTGG + Intergenic
1044247659 8:89968217-89968239 CACTCCAGGCTGGAGTGCAATGG - Intronic
1044293773 8:90503377-90503399 CACTGCAGTCCGCAGTCCTCCGG + Intergenic
1044405264 8:91819014-91819036 CACAGCAGTCTGAAGTGACCTGG + Intergenic
1044635526 8:94320028-94320050 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1044806429 8:96012933-96012955 CATTCCAGGCAGAGGTGCTCGGG - Intergenic
1045076064 8:98570202-98570224 CACTGCAGCCTCAACTGCCCAGG + Intronic
1045172632 8:99687463-99687485 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1045482161 8:102601160-102601182 CCCTGCAGTCTGAACAGCTCCGG - Intergenic
1045733513 8:105268098-105268120 CATCACAGGCTGAAGTGCTCTGG - Intronic
1046143022 8:110120290-110120312 TACTGCAGGCCAAAGTTCTCCGG + Intergenic
1046167206 8:110452170-110452192 GTCTGTAGGCTAAAGTGCTCTGG - Intergenic
1046384176 8:113487145-113487167 CAGTACAGGATGAAGGGCTCTGG - Intergenic
1046557214 8:115790110-115790132 CACTGTGGGCTAAAATGCTCTGG + Intronic
1046811510 8:118538383-118538405 CACTGTAAGCTAAAGGGCTCTGG - Intronic
1047169203 8:122474640-122474662 CACTGCAGCCTCAACTTCTCAGG + Intergenic
1047352518 8:124089122-124089144 CACCGCAGGCTAAAGCACTCTGG - Intronic
1048013966 8:130481446-130481468 CAGTACAGGCAGAAGTGCTGAGG + Intergenic
1048019753 8:130527430-130527452 CCCTCCAGGCTGCAGAGCTCTGG + Intergenic
1048104946 8:131397641-131397663 CTCTGCAGGCTGGAGTGCAGTGG + Intergenic
1048855652 8:138684796-138684818 CACTTCAGGCTGAAGGGCTTTGG + Intronic
1049111775 8:140650013-140650035 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1049808194 8:144550845-144550867 CACTGAGGGGTGAAGGGCTCCGG + Intronic
1049942137 9:557105-557127 CACTGCAGGCTCAACCTCTCAGG - Intronic
1049963606 9:759100-759122 CACTGCAGCCTGGACTTCTCGGG + Intergenic
1050145119 9:2559546-2559568 CATCGCAGGCTAAAGTGTTCTGG + Intergenic
1050248085 9:3713187-3713209 CACTGCAAGCCAAAGTGCTCTGG + Intergenic
1050865284 9:10489579-10489601 AGCTGCAGGCCAAAGTGCTCTGG - Intronic
1050906989 9:11016740-11016762 CACTACAGGCTAAAGGGCTCTGG - Intergenic
1051039205 9:12785489-12785511 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1051083610 9:13321478-13321500 CACTGCAGCCTCAAGCTCTCAGG - Intergenic
1051306637 9:15717354-15717376 CACTGTGGACTAAAGTGCTCAGG + Intronic
1051345562 9:16147851-16147873 CACCACAGGCGGGAGTGCTCTGG + Intergenic
1051617918 9:19024177-19024199 TCCTGCAGGCTCAAGTACTCAGG + Intronic
1051679610 9:19593954-19593976 CACTGCTGGGTGCAGTGCTGTGG - Intronic
1051712580 9:19947151-19947173 CACTGCAGGCTCAGTTGGTCTGG - Intergenic
1051966729 9:22836781-22836803 CACCACAGGCTAAAGTGCTCTGG - Intergenic
1052205002 9:25828336-25828358 CACTGTGGACTGAAGTGATCTGG - Intergenic
1052607355 9:30722456-30722478 CACTGTGGGCTGCAGTGCTCTGG + Intergenic
1052977326 9:34420902-34420924 CACTGCAGCCTCAACTTCTCAGG - Intronic
1053023889 9:34714996-34715018 CACTGCAGGCTCAAGTTCACAGG - Intergenic
1053607868 9:39679235-39679257 CACCACTGACTGAAGTGCTCAGG - Intergenic
1053865714 9:42435595-42435617 CACCACTGACTGAAGTGCTCAGG - Intergenic
1054245666 9:62663174-62663196 CACCACTGACTGAAGTGCTCAGG + Intergenic
1054559792 9:66697705-66697727 CACCACTGACTGAAGTGCTCAGG + Intergenic
1055167635 9:73216949-73216971 CACTGCAGCCTTAAATTCTCAGG + Intergenic
1055527030 9:77145355-77145377 CACTGCAGCCTCAACTTCTCTGG + Intergenic
1055726521 9:79236326-79236348 CACTGGAGCTTGAAGTCCTCAGG + Intergenic
1056186896 9:84143811-84143833 CAATGAAGGCAGAACTGCTCAGG - Intergenic
1056211543 9:84369357-84369379 CACTGAGGGCTACAGTGCTCTGG - Intergenic
1056212183 9:84375191-84375213 CACTTCAGGCTGGAGTGCAGTGG + Intergenic
1056348831 9:85727082-85727104 CACTCCAGGATGAGGTGGTCAGG + Intronic
1057289156 9:93789434-93789456 CACTGCGGGATAAAGGGCTCTGG - Intergenic
1057616478 9:96595109-96595131 CCCTCCAGGCTGAAGTGCAGTGG - Intronic
1057644356 9:96859149-96859171 TACTGCAGGATAAAGTACTCGGG + Intronic
1058930938 9:109718154-109718176 CACTGCAGCCTCAACTTCTCAGG + Intronic
1058974230 9:110111165-110111187 CACTGCAGTCTCAATGGCTCAGG + Intronic
1059373771 9:113865390-113865412 CACTGCAGCCTCAAGCTCTCGGG + Intergenic
1059636073 9:116171853-116171875 CACTGCAGGCGGATGTGTTTGGG - Intronic
1061674234 9:132206824-132206846 CAGTGGAGGCTGATGTGGTCTGG - Intronic
1062423461 9:136495113-136495135 CTGTGCAGGCTGAGGTGCTGGGG + Exonic
1186314215 X:8351076-8351098 CACTGCAGCCTCAAGTTCTTGGG - Intergenic
1186602012 X:11048424-11048446 CACATCAGGCCAAAGTGCTCTGG - Intergenic
1186602236 X:11050156-11050178 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1186932746 X:14412739-14412761 CACTGTGGGCTAAAATGCTCTGG + Intergenic
1187340071 X:18413232-18413254 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1187579403 X:20592324-20592346 CATGGTGGGCTGAAGTGCTCTGG - Intergenic
1187844832 X:23524566-23524588 CACCACAGGCTAAAGTCCTCTGG + Intergenic
1188027524 X:25226275-25226297 CACTGCAGACCAAAGTGCCCTGG + Intergenic
1188071897 X:25727512-25727534 CACTGTGGGCTTAAGTGCTCTGG - Intergenic
1188078609 X:25808386-25808408 TACTGCAGGATAAAGTGCTCTGG - Intergenic
1188743060 X:33809693-33809715 CACTGAGGGCTAAAGTGCTCTGG - Intergenic
1189471686 X:41319553-41319575 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1189658098 X:43267861-43267883 CAATGAGGGCCGAAGTGCTCTGG - Intergenic
1189812854 X:44797242-44797264 CACTGCAGGCTCAACCTCTCAGG + Intergenic
1190220839 X:48511513-48511535 CACTGTTGGCTGAAGTGCATGGG + Intronic
1190602734 X:52108957-52108979 CACTGCAGGCTAAAGTGCTATGG - Intergenic
1190717022 X:53113617-53113639 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1190758230 X:53419449-53419471 CACTGCAGCCTCAACTTCTCGGG - Intronic
1190804704 X:53824409-53824431 CACCATGGGCTGAAGTGCTCTGG + Intergenic
1190808441 X:53861492-53861514 CACTGCAGGCTAAAATGCTCTGG - Intergenic
1190898952 X:54650501-54650523 CACCACATGCTAAAGTGCTCTGG + Intergenic
1191119117 X:56884756-56884778 CACGATAGGCTGAAGTACTCTGG + Intergenic
1191853442 X:65603252-65603274 CACTATAGGCTGAAGTGCAGTGG - Intronic
1191991318 X:67039580-67039602 CACTACAGACTAAAGTGCTCTGG - Intergenic
1192046090 X:67675421-67675443 CACTGTGGGCTAAAGTGCTCTGG - Intronic
1192088071 X:68121552-68121574 CACTGCAGGCTAAAGTGCTCTGG + Intronic
1192134968 X:68588696-68588718 AACTGCAGACTGAAGTGCTCTGG + Intergenic
1192304533 X:69944801-69944823 TACTGTAGGCTAAAGTGCTTTGG - Intronic
1192374775 X:70548779-70548801 CACTGAGAGCTAAAGTGCTCTGG + Intronic
1192400144 X:70826787-70826809 CACTGTGGGCTGAAGTGCTCTGG + Intronic
1192640397 X:72856888-72856910 CACCGCAGGACAAAGTGCTCTGG + Intergenic
1192641314 X:72863888-72863910 CACCGCAGGACAAAGTGCTCTGG - Intergenic
1192679855 X:73241391-73241413 CACTGCAGGGTAAAGTACTCTGG + Intergenic
1192822555 X:74659676-74659698 TATTGCAGGCGAAAGTGCTCTGG - Intergenic
1192875336 X:75223470-75223492 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1192941168 X:75912982-75913004 CACTGCAAGCTAATGTACTCTGG - Intergenic
1193219746 X:78910305-78910327 CATTGTAGACTGCAGTGCTCTGG - Intergenic
1193252490 X:79308559-79308581 CACCACAGGCTAAAGTCCTCTGG + Intergenic
1193344481 X:80388866-80388888 CACTGTGGGGTAAAGTGCTCTGG - Intronic
1193396527 X:80990409-80990431 CACTGCAAGCTGGAGTGCTCTGG + Intergenic
1193438654 X:81512207-81512229 CACAACTGGCTGAAGTCCTCTGG + Intergenic
1193440970 X:81538825-81538847 TGCTGCAGGCTAATGTGCTCTGG + Intergenic
1193524580 X:82573385-82573407 CACTGAGGGCTACAGTGCTCTGG - Intergenic
1193580391 X:83257297-83257319 CACAATGGGCTGAAGTGCTCTGG + Intergenic
1193742265 X:85231803-85231825 CACTGTGGGCTAAAGTGCTCTGG + Intergenic
1193756860 X:85419216-85419238 TACTGCAGGCTAAACTGCTCTGG - Intergenic
1193856809 X:86612472-86612494 CCCTGTAGGCTAAATTGCTCTGG - Intronic
1193894796 X:87099989-87100011 CACTGTAGGCTGAAGTGCTCTGG + Intergenic
1193931710 X:87561523-87561545 CATTGCAGGCTAAAGTGTTATGG + Intronic
1193986895 X:88253252-88253274 CATTGCAGGTCAAAGTGCTCTGG - Intergenic
1194136552 X:90151435-90151457 CATTGTGGGCTAAAGTGCTCTGG + Intergenic
1194220012 X:91178075-91178097 CACTGTATGCTAAAGTTCTCTGG - Intergenic
1194387692 X:93277670-93277692 CACTACAGACTAAAGTGCTCTGG + Intergenic
1194388951 X:93292641-93292663 CACTGCAGGCCAAAGTACTCTGG + Intergenic
1194415396 X:93605919-93605941 CACCACAAGCTGAAGTGCTCTGG + Intergenic
1194425651 X:93734287-93734309 CACTGCAGCCTCAACTGCCCAGG + Intergenic
1194591450 X:95804887-95804909 CACTGAGGGCTACAGTGCTCTGG + Intergenic
1194626242 X:96229699-96229721 CACTACGGGCTAAAGTGCTCTGG + Intergenic
1194791713 X:98159323-98159345 CACCACAGGCTACAGTGCTCTGG + Intergenic
1194842056 X:98754639-98754661 CACTGTGGGCCGAAGTGCCCTGG - Intergenic
1194882706 X:99273639-99273661 CACCACAGGCTAAAGCGCTCTGG + Intergenic
1194990569 X:100543006-100543028 CACTGCAGGCTAAAGTACTCTGG + Intergenic
1195014755 X:100766968-100766990 CACTGTGGGCTAAAGTGCTCTGG - Intergenic
1195090212 X:101451190-101451212 CACCACAGGCTAAAGTGTTCTGG - Intronic
1195115658 X:101695882-101695904 CACTGCAGGCTAAAGTGTTCTGG + Intergenic
1195165178 X:102213050-102213072 CACTACAGGCCAAAGTGCTCTGG - Intergenic
1195193680 X:102474041-102474063 CACTACAGGCCAAAGTGCTCTGG + Intergenic
1195199260 X:102532309-102532331 CACTGCAAGCTGAAGAGCTCTGG + Intergenic
1195290129 X:103424250-103424272 CACTGTGGGCTAAAGTGCTTGGG - Intergenic
1195541534 X:106068261-106068283 CACTGCAAGCAGATGTGGTCAGG + Intergenic
1195595360 X:106682881-106682903 CACCACAGGCTGAAGTTCTCTGG + Intergenic
1195783135 X:108485934-108485956 CACTGCAGGCTAAATTGCTCTGG - Intronic
1195955409 X:110324034-110324056 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1196096853 X:111809279-111809301 CACCTCAGGCCAAAGTGCTCTGG - Intronic
1196162525 X:112501902-112501924 CACTCCAGGCTGGAGTGCAGTGG - Intergenic
1196182215 X:112704477-112704499 CACCACAGGCTGGAGTGCTCTGG - Intergenic
1196185122 X:112737556-112737578 CACCCCAGGCTGGAGTGCACTGG + Intergenic
1196234577 X:113263149-113263171 CACCACAGGCTAAAGTGCTTTGG - Intergenic
1196466103 X:115972982-115973004 CAATGCAGGCTAAAATGCCCTGG + Intergenic
1196510194 X:116500093-116500115 CACTACAGGCTAAAGTGCTCTGG - Intergenic
1196537405 X:116863371-116863393 CACTGCAGGTTAAAGTGCTCTGG - Intergenic
1196588660 X:117460225-117460247 CACCTCAGGCTAAAGTGTTCTGG + Intergenic
1197053821 X:122093636-122093658 CAGTGTGGGCTAAAGTGCTCTGG + Intergenic
1197108475 X:122743973-122743995 CACTGCAGCCTTGAGTGCTTGGG + Intergenic
1197117668 X:122852221-122852243 TACCGAAGGCTGGAGTGCTCTGG + Intergenic
1197375909 X:125681920-125681942 CACTGCTGGACAAAGTGCTCTGG + Intergenic
1197429353 X:126341905-126341927 CACCACAGGCTACAGTGCTCTGG + Intergenic
1197491925 X:127128540-127128562 CAGTGCAGGCTAAAGTGTTCGGG + Intergenic
1197544407 X:127807855-127807877 CACTGTGGGCTAAAGTGATCTGG + Intergenic
1197587334 X:128364461-128364483 CACCACAAGCTAAAGTGCTCTGG - Intergenic
1198064316 X:133081334-133081356 CACTCCAGGCTGGAGTGCAGTGG + Intronic
1198167206 X:134069701-134069723 CTATGCAGGCTGAAGTGTTTAGG + Intergenic
1198702655 X:139414386-139414408 CACTGCAGGCTAAAGTGTTCTGG - Intergenic
1198760311 X:140025698-140025720 CACTGCAGCCTCAAATTCTCAGG + Intergenic
1198773462 X:140155335-140155357 CACTGTGGGCTGAAGTGTTCTGG + Intergenic
1198809193 X:140518278-140518300 CACTGAAAGCTGAAGTGATGGGG + Intergenic
1198947654 X:142032055-142032077 CACAACAGGCTAAAGTGCTCTGG - Intergenic
1198964732 X:142215327-142215349 CACCATAGGCTAAAGTGCTCTGG - Intergenic
1199177604 X:144810287-144810309 CACGGAGGGCTAAAGTGCTCTGG + Intergenic
1199197402 X:145047666-145047688 CACTTCAGGCTGGAGTGCTATGG + Intergenic
1199223071 X:145339882-145339904 CACTGAGGGCTAAATTGCTCTGG + Intergenic
1199277543 X:145964103-145964125 TACTGCAGACTAAAGTGCTCTGG + Intergenic
1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG + Intergenic
1199415135 X:147573599-147573621 CACTACAGGCTCGAGTGCTTTGG + Intergenic
1199484996 X:148337916-148337938 CACCACGGGCTGAAGTGCTTTGG + Intergenic
1200105616 X:153710386-153710408 CTCTGCAGGCTGAAGACTTCTGG + Intronic
1200419858 Y:2953261-2953283 CACTGCAGCCTCAACTTCTCAGG - Intronic
1200482304 Y:3721385-3721407 CATTGTGGGCTAAAGTGCTCTGG + Intergenic
1200556521 Y:4641836-4641858 CACTGTATGCTAAAGTTCTCTGG - Intergenic
1201952165 Y:19577443-19577465 CACTCCAGGCTGGAGTGCAGTGG + Intergenic
1201979529 Y:19892069-19892091 CACTGTGGGCTTAACTGCTCTGG + Intergenic
1202017110 Y:20421111-20421133 CACTTTAGGCTGGAGTGCTAAGG - Intergenic