ID: 922647296

View in Genome Browser
Species Human (GRCh38)
Location 1:227301821-227301843
Sequence CTGTAACCATATTGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922647296 Original CRISPR CTGTAACCATATTGGGAGGA TGG (reversed) Intronic
900893792 1:5468934-5468956 CTGTAAGCAGATTGAGGGGATGG + Intergenic
902529775 1:17083425-17083447 CTGTATCCATATTGAGAGACTGG + Intronic
903866569 1:26402972-26402994 ATTTAACTACATTGGGAGGAAGG + Intergenic
904968791 1:34402625-34402647 ATGTAACAGTATTGGGAGGTGGG - Intergenic
906513676 1:46425542-46425564 CTGAAACCACAATGGGAGGCTGG - Intergenic
910324092 1:85984433-85984455 TTGTAACCTTATCTGGAGGAGGG + Intronic
911348557 1:96724664-96724686 TTGTATCCATAATGGGGGGAGGG + Intronic
911567474 1:99480138-99480160 CTGTAGCCATGTTCAGAGGAAGG + Intergenic
912381139 1:109248914-109248936 CTGTCACCAGATTCGGAGGCCGG - Intergenic
913414690 1:118591998-118592020 ATGTAAAAATATTGGGATGAAGG + Intergenic
914886186 1:151586297-151586319 CTGGAATCCTAGTGGGAGGAAGG - Intergenic
915874319 1:159596122-159596144 CTATAAACATATTTGGAGTAGGG - Intergenic
916627096 1:166570171-166570193 GTGGAACCATCTTGGGAGGGTGG + Intergenic
917152787 1:171962724-171962746 ATGTAATCATATTGGGAGGAGGG - Intronic
917165804 1:172111638-172111660 CTGTAATCTTATTGGGAAAATGG + Intronic
920868382 1:209772404-209772426 ATGTGACCATATTTGGAGAAAGG - Intronic
921476583 1:215617493-215617515 CTGTGACCAAATGGGGTGGAGGG - Intronic
921558763 1:216631306-216631328 CTGTAACCATGTTAGTAGCAAGG + Intronic
921756018 1:218856468-218856490 CTGTAACAGTATTATGAGGAGGG + Intergenic
921892515 1:220367328-220367350 CTGTAATGATATCTGGAGGAGGG - Intergenic
922040870 1:221895344-221895366 CTCTCACCACATTGGCAGGAAGG + Intergenic
922647296 1:227301821-227301843 CTGTAACCATATTGGGAGGATGG - Intronic
922798394 1:228352869-228352891 CTGTGGCCATGTTGGGAGCACGG - Intronic
923004910 1:230040711-230040733 CTGAAACTATACTGGGACGATGG + Intergenic
924021071 1:239783801-239783823 CTGTCACCAGAGTGTGAGGACGG + Intronic
1064053170 10:12075625-12075647 CTGTAATCACTTTGGGAGGCTGG - Intronic
1066290237 10:34007832-34007854 ATGGAAGCATATAGGGAGGAAGG - Intergenic
1066360645 10:34727129-34727151 CTTTAAACATATTGGAAGGATGG - Intronic
1067357291 10:45541728-45541750 ATATAACCAAATTGGGAGGATGG + Intronic
1068549604 10:58391679-58391701 TTTTAACTATATTGGGAGGTAGG - Intronic
1069774145 10:70917128-70917150 CTGCAGCCATGTTGGCAGGAGGG + Intergenic
1071731020 10:88248709-88248731 CTGTAAACATCTTGGTGGGAGGG - Intergenic
1074098491 10:110334316-110334338 GTGGAACCATGTTGGGTGGACGG - Intergenic
1074141187 10:110674172-110674194 CTGCAAACATATTGGAAGGAAGG + Intronic
1074660480 10:115650235-115650257 CTTTGAACATATTGGGAAGAAGG - Intronic
1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG + Intronic
1077364410 11:2155749-2155771 CAGAAACAATAGTGGGAGGAAGG + Intronic
1081181958 11:39994727-39994749 CTCTGGCAATATTGGGAGGAAGG + Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081882678 11:46467298-46467320 ATGTAACTATTTTGGAAGGATGG - Intronic
1083116625 11:60466116-60466138 CTGTAACAGTATTGGGTAGATGG - Exonic
1083938731 11:65883692-65883714 CTGTATTGAGATTGGGAGGATGG - Exonic
1084166591 11:67377671-67377693 ATGTCACCATGTGGGGAGGAAGG - Intronic
1084409630 11:68999149-68999171 ATGTAACCATATTTGGAGAAAGG + Intergenic
1084757508 11:71249143-71249165 CTGTAAGCATATTGAGTGCAGGG - Intronic
1087134360 11:94700531-94700553 CTGTAAACATCTTGGGACCATGG + Intergenic
1087931304 11:103981069-103981091 ATGTAACAATATTGAGAGGTGGG + Intronic
1089481614 11:118809981-118810003 GTGTACTCATGTTGGGAGGATGG + Intergenic
1089995684 11:122904969-122904991 CTGTATACATATTGGGCGGTCGG + Intronic
1090046782 11:123342721-123342743 CTGTAACAGTATTAAGAGGATGG + Intergenic
1090641653 11:128734480-128734502 CTGAAACCACGGTGGGAGGAAGG + Intronic
1090849326 11:130558207-130558229 ATGTAACCATATTGAGAAGTGGG + Intergenic
1093131269 12:15394121-15394143 ATGTAACAGTATTGGGAGGTGGG - Intronic
1093751672 12:22807289-22807311 CTGTAACCCTATTTGGAATAAGG + Intergenic
1094052176 12:26232398-26232420 CTGTATCCATATTTTAAGGAAGG + Exonic
1095401311 12:41817698-41817720 ATGTGACCATATTGGGAGATAGG + Intergenic
1097312877 12:58140483-58140505 CTTTAATTATATAGGGAGGAAGG - Intergenic
1098535091 12:71585057-71585079 ATGTAATCATTTTGGGAGGAGGG + Exonic
1098871164 12:75818750-75818772 CTGTACCAATATTAGGATGATGG - Intergenic
1099427194 12:82537888-82537910 GTGTAACAATATTGAGAGGTGGG + Intergenic
1101451723 12:104785869-104785891 ATGCAACCATGTTGGGAGGTGGG - Intergenic
1101484093 12:105133511-105133533 ATGTAAGCATCATGGGAGGAGGG + Intronic
1103206680 12:119135085-119135107 ATGTAACAAAATTGGGAGAAAGG + Intronic
1107043217 13:35970460-35970482 ATGTATCAATATTGGGAGGTGGG + Intronic
1107716278 13:43202584-43202606 CTTTAAGGATCTTGGGAGGAGGG - Intergenic
1109029382 13:57173775-57173797 CTGTCAGCATCCTGGGAGGAGGG - Intergenic
1109117505 13:58407222-58407244 CTTTTATCATATTGGAAGGAAGG - Intergenic
1109122601 13:58476849-58476871 CGTTAATTATATTGGGAGGAGGG - Intergenic
1112266828 13:97932063-97932085 CTGTAACCATATTAAGAGGGTGG - Intergenic
1112606716 13:100913586-100913608 CTGTGACTATATTTGGAGGCAGG + Intergenic
1112839409 13:103558025-103558047 CTGTCACCATAGTGGGAGCATGG + Intergenic
1114630503 14:24156582-24156604 GTTTCACCATATTGGGAGGCTGG - Intronic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1115500452 14:34044860-34044882 CTATAACCATATCTGGAGCAAGG + Intronic
1116030253 14:39562518-39562540 ATGTAACCTTATTTGGAGGTAGG + Intergenic
1116402086 14:44520306-44520328 CTCAAACCATATAGGCAGGAGGG - Intergenic
1117575779 14:57095750-57095772 CTGTGACAGTATTGGGAGGTGGG - Intergenic
1118614687 14:67567223-67567245 CAGTAACCATCTGGGGAGGGCGG + Intronic
1120106433 14:80500792-80500814 ATGTAACTATATTGGGAGTATGG - Intronic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1123967861 15:25477157-25477179 CTGTAACCCACTTGAGAGGATGG + Intergenic
1124135047 15:27027979-27028001 CTGTAACCATATATCCAGGAAGG - Intronic
1124529793 15:30495638-30495660 CTGTTACTACATTGGGAGGTGGG - Intergenic
1124768866 15:32512050-32512072 CTGTTACTACATTGGGAGGTGGG + Intergenic
1129523419 15:76199765-76199787 CTGTGACCAGAATGGGAGGGAGG - Intronic
1130893529 15:88152800-88152822 CTGGAACCTGATTGGGAGGCTGG - Intronic
1133672904 16:8041446-8041468 CTTTCACCATGTTGGAAGGATGG - Intergenic
1134828993 16:17308194-17308216 CTGGCACCATCTTGGGAGGTTGG - Intronic
1135256911 16:20948416-20948438 CTGTAGCCATATAGAGATGACGG + Intronic
1136636158 16:31524549-31524571 CTGTGAACATTTTGGGAGGGAGG - Intergenic
1137402671 16:48165920-48165942 CTGTAACCACATGTGGAGGGTGG + Intergenic
1140866687 16:79068296-79068318 CTGTAACCATCTTGGGGGTGAGG + Intronic
1141699122 16:85634417-85634439 CTGTGACTTGATTGGGAGGAGGG + Intronic
1144048338 17:11473579-11473601 TTGTAACAATATTAGGAGGTGGG - Intronic
1146111922 17:30097625-30097647 ATATAACTACATTGGGAGGATGG - Intronic
1147761120 17:42798158-42798180 GTGTAACCATCTGGGGAGGTAGG + Exonic
1148088833 17:45010424-45010446 CAGTAAGAATATTGGGAGGAGGG + Intergenic
1149134048 17:53343430-53343452 CTTTCACCATGTTGGCAGGATGG - Intergenic
1149172417 17:53825982-53826004 ATCTAATCATATTGGGAGGCTGG + Intergenic
1150647680 17:66989798-66989820 CAGTACCCACATTGGGAGGTTGG - Intronic
1151208364 17:72525215-72525237 TTCTCACCATATTGGGAAGAAGG - Intergenic
1151235604 17:72717692-72717714 CTGTAACCTTATTTGGCGGTAGG - Intronic
1151687095 17:75654043-75654065 TTGTAAACATATTGGGAAGTTGG - Intronic
1153326998 18:3830789-3830811 CTGTAAGCAACTTGAGAGGAGGG + Intronic
1155399956 18:25427174-25427196 TTGTAACTATATTGAGAGGTGGG + Intergenic
1155935707 18:31751438-31751460 CTTTATCCATTTTGGGAGTAGGG - Intergenic
1156174025 18:34521164-34521186 CTGGAAACATACTGGGATGAGGG - Intronic
1156834013 18:41530703-41530725 TTGTAACCATATTTGGAGATAGG + Intergenic
1158409312 18:57190799-57190821 ATGTAACTCTACTGGGAGGATGG - Intergenic
1158582435 18:58695815-58695837 ATGTAACAATGTTGGGAGGTAGG - Intronic
1161948970 19:7456793-7456815 CTGTGACCTTGTTGGGAGGTTGG + Intronic
1162278598 19:9677537-9677559 CTGTAAACATATTGTTAAGAAGG + Intergenic
1162605588 19:11705003-11705025 CTGCAACACTATTGGGAGGAGGG - Intergenic
1163680136 19:18676432-18676454 CTGTAACCTTATCGTAAGGAGGG + Intergenic
1163847098 19:19643875-19643897 CTGCAACCATTCAGGGAGGAGGG - Intergenic
1164514550 19:28922696-28922718 CTGTAACCATGCTGAGAGGCAGG + Intergenic
1165551564 19:36591102-36591124 GTTTCACCATGTTGGGAGGATGG - Intronic
925849071 2:8062820-8062842 ATGTAACTATATTGGGAAGATGG - Intergenic
926064758 2:9829638-9829660 TTATAACTATATTGGGGGGATGG - Intergenic
926523099 2:13942411-13942433 CTGTCACCATATAGGTGGGAGGG + Intergenic
927246197 2:20958810-20958832 CTGAAACCTGAATGGGAGGAAGG - Intergenic
927516755 2:23676157-23676179 CTGTAAGAATTTTTGGAGGATGG + Intronic
928446394 2:31337243-31337265 CTGTATGAATATTGGGGGGATGG - Intronic
929648473 2:43653952-43653974 ATATAAACATATTGGGAGAATGG + Intronic
931098185 2:58965876-58965898 CTGTAAGAATATTGTCAGGAGGG - Intergenic
931278589 2:60766782-60766804 CTGTAACCATGTTGGTTGGTTGG + Intronic
932294830 2:70615667-70615689 GTGTAATGATATTGGGAGGTGGG - Intronic
933019944 2:77177403-77177425 CTGTATCCAAAATGTGAGGAGGG + Intronic
933651975 2:84856877-84856899 ATGTCACCATATTTGGAGAAAGG + Intronic
934969512 2:98751529-98751551 CTGTAACCTCATTGGGAAGTTGG + Intergenic
937434752 2:121871162-121871184 CTGCATCCAGATTGGGAGCAGGG - Intergenic
937854761 2:126664250-126664272 CTGTCACCAGATGAGGAGGATGG - Intronic
937939995 2:127277791-127277813 CTATTCCCATATTGGGAGAATGG + Intronic
938769126 2:134484743-134484765 ATGTAACTATACTGGGAAGAGGG + Intronic
938993251 2:136651277-136651299 CTTTGACCATCTTGAGAGGAAGG + Intergenic
939001127 2:136736118-136736140 CTGCAACCTTAGTGGAAGGAAGG + Intergenic
939633239 2:144550826-144550848 ATGTAAGCTTTTTGGGAGGAGGG - Intergenic
939959352 2:148552627-148552649 CTGTAACGATGTTGGGAGGGTGG + Intergenic
940218901 2:151330227-151330249 ATAGAACCATATTGGGAGGATGG + Intergenic
940699046 2:157019150-157019172 ATGTAACAATATTGAGAGGTGGG + Intergenic
940793770 2:158055374-158055396 ATGTAACAATATTGAGAGGCAGG - Intronic
942211927 2:173679853-173679875 GTGCAACCATGTTGGGAGGGGGG + Intergenic
942807765 2:179953506-179953528 CTGTAACCCTCTTGAAAGGAGGG + Intronic
944358330 2:198820551-198820573 TTATAACCTTATTGGGAAGAGGG - Intergenic
945799681 2:214411856-214411878 CTGTAGCAATATGGGGAGGGGGG + Intronic
1168903118 20:1382647-1382669 TTGTTACCATATAGGGAAGAAGG - Intronic
1170530963 20:17291019-17291041 CTGTAACAATATTAAGAGGTGGG - Intronic
1172009481 20:31838030-31838052 CTGGAACCCCAGTGGGAGGATGG + Intergenic
1173859915 20:46276591-46276613 CAGCAACTATACTGGGAGGAAGG + Intronic
1178036205 21:28585886-28585908 ATATAACCATATTGAAAGGAAGG + Intergenic
1182433389 22:30314454-30314476 CTGTGACTATCCTGGGAGGATGG + Intronic
1182537811 22:31018963-31018985 CTGTAACACTATTAGGAGGTTGG - Intergenic
1182706533 22:32284576-32284598 CAGTCACCATACTGTGAGGAAGG - Intergenic
949918112 3:8980805-8980827 CTGTCACAATTTGGGGAGGAAGG + Exonic
952185872 3:30968289-30968311 ATGTAACCATATTAGGAAGATGG + Intergenic
954043841 3:47911957-47911979 CTGTACCCATAGTGGTAGGCTGG + Intronic
956340789 3:68221531-68221553 CAGAAACAATATTGGGAGAAAGG - Intronic
957997388 3:87707738-87707760 ATGTAACCATATTTGGAGATGGG - Intergenic
959011259 3:101079004-101079026 GTGTAACCATAGTTGGGGGAAGG + Intergenic
960940690 3:122931350-122931372 CTGTCATTATAATGGGAGGATGG - Intronic
961996554 3:131250991-131251013 ATGTAACTATATTGGAAAGATGG + Intronic
962704535 3:138030232-138030254 CTGTTACAATTTTGGGAGGGTGG + Intronic
963352549 3:144169836-144169858 GTATAACCATATTTGGAAGATGG + Intergenic
964203464 3:154144345-154144367 CTGTAACAATTCTGTGAGGAAGG - Intronic
965389080 3:168082372-168082394 CAGTAACAATATTTTGAGGAGGG - Intronic
965469080 3:169067711-169067733 ATGTAACTGTATTGGGAAGACGG + Intergenic
967915649 3:194576283-194576305 CGGTAACCATATTTGGGGGATGG + Intergenic
968840032 4:2996583-2996605 CTGTGACAGTATTGGGAGGTAGG - Intronic
969375946 4:6763320-6763342 GTGTAGGCATCTTGGGAGGAAGG - Intergenic
969440545 4:7214213-7214235 ATGTAACAGTATTGGGAGGTGGG + Intronic
970247186 4:14075744-14075766 CTGTAATAAAACTGGGAGGAGGG + Intergenic
971584373 4:28386471-28386493 CTGTAATTTTATTGAGAGGATGG + Intronic
971632845 4:29016904-29016926 CTGCAACCATATAGAGAAGAGGG - Intergenic
975923497 4:79421368-79421390 ATGTGACTATATTGGGAGGTAGG - Intergenic
976234820 4:82885550-82885572 CTATAACCATGTTGTGTGGATGG - Intronic
976437360 4:85033412-85033434 ATGCAACCGTATTGGGAGGCAGG - Intergenic
979071204 4:116209027-116209049 AGGTAACGATATTGGGAGGCAGG + Intergenic
979086611 4:116418797-116418819 ATGTTACCATATTGGGAGGTAGG + Intergenic
979293287 4:119002016-119002038 ATATAATTATATTGGGAGGATGG - Intronic
980186038 4:129462387-129462409 GTGAAACCCTATTGAGAGGAGGG - Intergenic
981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG + Intergenic
981305884 4:143246786-143246808 ATGTGACTATATTTGGAGGAGGG - Intergenic
983621165 4:169761996-169762018 CTGTAACCATATTTGGAAATAGG - Intergenic
984275871 4:177608514-177608536 ATGTAACAGTATTGGGAGGTGGG + Intergenic
984454470 4:179946620-179946642 TTGTAACACTATTGGGAGGTGGG - Intergenic
984597759 4:181690064-181690086 CTGTTACCATATTGGGTGCCTGG - Intergenic
988701054 5:33674888-33674910 ATGTAAAGATATTGGGAGGTAGG + Intronic
989377670 5:40781772-40781794 ATATAACTATATTAGGAGGATGG + Intronic
991706038 5:69359677-69359699 CTTTAATCATATTGGGATGCTGG + Intronic
992479060 5:77132388-77132410 CTATAACTATATTGAGAGAATGG - Intergenic
992992597 5:82299077-82299099 ATGTAACTATATTGGAGGGATGG - Intronic
993748275 5:91630122-91630144 TTGTAACAATATTGGTAGGCGGG + Intergenic
994413795 5:99442521-99442543 CAGTAGTAATATTGGGAGGATGG - Intergenic
998752190 5:145334502-145334524 CTGTAATGATATTGTAAGGATGG - Intergenic
998929329 5:147163200-147163222 CTATAATCATATTTGGAGGGAGG - Intergenic
998933390 5:147206369-147206391 ATGTAACAATGTTGGGAGGTGGG + Intergenic
999197839 5:149794841-149794863 CTGTAACCAGATTGGAATGCAGG + Intronic
1000254173 5:159521893-159521915 CTGAAACAAGAGTGGGAGGAAGG - Intergenic
1004780077 6:18898425-18898447 CTGTCACCACTCTGGGAGGAGGG - Intergenic
1005510718 6:26509355-26509377 CTGTACCAATATTTGGGGGATGG + Exonic
1007402834 6:41614147-41614169 GTGTAACCGTATTGGGAGTAGGG + Intergenic
1009720380 6:67461041-67461063 CTGGAACTAAATTGGGAAGATGG - Intergenic
1009765255 6:68065368-68065390 TTGTAGCCAAAATGGGAGGAAGG + Intergenic
1011253852 6:85401667-85401689 CTGTAACCACTTTGAGAGCAAGG - Intergenic
1015630819 6:135230234-135230256 CTGTAACCATTTTGAGAGACAGG - Intergenic
1016669274 6:146682951-146682973 ATGCAACCATATTGGGAGGTGGG + Intronic
1021496790 7:21283899-21283921 TTATAGCCATACTGGGAGGAAGG - Intergenic
1026731230 7:72913492-72913514 CTGTCACCAGTTTGGGAGCAGGG + Intronic
1027112855 7:75454577-75454599 CTGTCACCAGATTGGGAGCAGGG - Intronic
1027285099 7:76639188-76639210 CTGTCACCAGATTGGGAGCAGGG - Intergenic
1027562669 7:79751592-79751614 CTGTAAACATATTGTTAGCAAGG + Intergenic
1027833693 7:83214451-83214473 CTATAAACATTTTGGGAGGATGG + Intergenic
1028399550 7:90409829-90409851 CTATAAACACATTGGGAGCAAGG + Intronic
1029665879 7:101994713-101994735 CTGGAACATTCTTGGGAGGAAGG - Intronic
1030788183 7:113688440-113688462 GTGAAACCATTTTAGGAGGAAGG - Intergenic
1031013445 7:116547702-116547724 CAGTAACAGTATTGGGAAGATGG - Intronic
1031626015 7:123993762-123993784 ATAGAACCATATTGGGAGGATGG - Intergenic
1033342976 7:140506350-140506372 ATGTAACCATATTTGGAGATAGG - Intergenic
1037413520 8:18622476-18622498 ATGTAAGTATATTGGGAAGATGG - Intronic
1037926888 8:22850691-22850713 TTCAAACCATGTTGGGAGGAAGG - Intronic
1039070923 8:33648626-33648648 GTGTGATCATGTTGGGAGGATGG + Intergenic
1040643406 8:49368441-49368463 TTGCAGCCATATTGTGAGGAGGG - Intergenic
1041640345 8:60193014-60193036 ATATAGCCATATTTGGAGGATGG - Intronic
1042505518 8:69555460-69555482 CTTTCACCATATTGGCAGGCTGG - Intronic
1042970524 8:74403266-74403288 CTGTAATGAAATTGGTAGGATGG - Intronic
1043348056 8:79323211-79323233 TTGTAACGACATTGGGAGGCAGG - Intergenic
1044399000 8:91748087-91748109 CTGTAAACTGATTGGAAGGATGG + Intergenic
1044461213 8:92446581-92446603 ATGTAACCTTAATGTGAGGAAGG + Intergenic
1044839053 8:96322587-96322609 ATGTAATGATATTGGGAGGTGGG - Intronic
1045224953 8:100235295-100235317 ATGTAACCATATTTGGAGACAGG - Intronic
1045509830 8:102806070-102806092 CTGTCACCATCGTGGGATGATGG - Intergenic
1046283323 8:112062168-112062190 ATGTAACAGTATTGGGAGGTGGG + Intergenic
1048834893 8:138509833-138509855 CTGTAACCTCATACGGAGGAGGG + Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1050987147 9:12096622-12096644 ATGTAACTATACTGGGAGGCTGG - Intergenic
1051533240 9:18128754-18128776 CTGGAACAATATGGGGAAGAGGG - Intergenic
1052357751 9:27523204-27523226 CTTTAACCATAATCAGAGGAAGG + Intronic
1055246610 9:74252957-74252979 ATATAATCATATTGGGAGGTAGG + Intergenic
1055332325 9:75197246-75197268 GTGTGGCCATATTGGGAGGTGGG - Intergenic
1055856947 9:80700009-80700031 CTTTAACCAAATAGGAAGGATGG + Intergenic
1057705788 9:97394021-97394043 TTGTGACCATATTGGGAGATGGG + Intergenic
1059818260 9:117942744-117942766 ATATAACTATATTGGGAGGACGG + Intergenic
1060296810 9:122348548-122348570 CTGTAACCATATCCCCAGGAAGG - Intergenic
1060763069 9:126272460-126272482 ATGTAACTATGTTGGAAGGATGG - Intergenic
1188076970 X:25789686-25789708 ATGTAACCTTATTGGGAGATAGG + Intergenic
1188953707 X:36408447-36408469 ATGTGACCATATTTGGAGGTAGG - Intergenic
1190175182 X:48143040-48143062 TTGTAACAATATTGAGAGGTGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190704340 X:53013928-53013950 CTGTAACAATATTGGCATAAGGG + Intergenic
1191991643 X:67043405-67043427 ATGTAAGCTTATTGGGAGTAGGG + Intergenic
1192072190 X:67952813-67952835 GTGCAACAATATTGGGAGGTGGG - Intergenic
1192315337 X:70047139-70047161 CTATAACAATTTTGGGAGGATGG + Intronic
1192792992 X:74401887-74401909 GTGTGACTATATTTGGAGGAAGG + Intergenic
1193408620 X:81135826-81135848 TTGTAACCATGTTGAGAGGTGGG + Intronic
1193750809 X:85341041-85341063 ATTTAACTATATTGGGATGATGG + Intronic
1195872769 X:109503186-109503208 CTGTAACAGTATTGAGAGGTAGG - Intergenic
1198286884 X:135199870-135199892 ATGTAATCATATAGGGAGGTGGG - Intergenic