ID: 922660660

View in Genome Browser
Species Human (GRCh38)
Location 1:227427691-227427713
Sequence ATGAAGTAGGTGGAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922660660_922660666 9 Left 922660660 1:227427691-227427713 CCTTCTTCTTCCACCTACTTCAT No data
Right 922660666 1:227427723-227427745 AACAGCTCAGAGTTGGTGGGAGG No data
922660660_922660665 6 Left 922660660 1:227427691-227427713 CCTTCTTCTTCCACCTACTTCAT No data
Right 922660665 1:227427720-227427742 AGAAACAGCTCAGAGTTGGTGGG No data
922660660_922660663 2 Left 922660660 1:227427691-227427713 CCTTCTTCTTCCACCTACTTCAT No data
Right 922660663 1:227427716-227427738 TTGAAGAAACAGCTCAGAGTTGG No data
922660660_922660664 5 Left 922660660 1:227427691-227427713 CCTTCTTCTTCCACCTACTTCAT No data
Right 922660664 1:227427719-227427741 AAGAAACAGCTCAGAGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922660660 Original CRISPR ATGAAGTAGGTGGAAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr