ID: 922661098

View in Genome Browser
Species Human (GRCh38)
Location 1:227430921-227430943
Sequence AGCCAGTGGTCTTGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 9, 3: 19, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922661098_922661104 10 Left 922661098 1:227430921-227430943 CCAGCACAGCAAGACCACTGGCT 0: 1
1: 1
2: 9
3: 19
4: 166
Right 922661104 1:227430954-227430976 TACTACGGGTGTGTCCAAGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50
922661098_922661106 24 Left 922661098 1:227430921-227430943 CCAGCACAGCAAGACCACTGGCT 0: 1
1: 1
2: 9
3: 19
4: 166
Right 922661106 1:227430968-227430990 CCAAGAAGGAATAAGTCTGTAGG 0: 1
1: 6
2: 4
3: 20
4: 164
922661098_922661102 -4 Left 922661098 1:227430921-227430943 CCAGCACAGCAAGACCACTGGCT 0: 1
1: 1
2: 9
3: 19
4: 166
Right 922661102 1:227430940-227430962 GGCTGCCATGGCTGTACTACGGG 0: 1
1: 0
2: 0
3: 6
4: 90
922661098_922661101 -5 Left 922661098 1:227430921-227430943 CCAGCACAGCAAGACCACTGGCT 0: 1
1: 1
2: 9
3: 19
4: 166
Right 922661101 1:227430939-227430961 TGGCTGCCATGGCTGTACTACGG 0: 1
1: 0
2: 2
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922661098 Original CRISPR AGCCAGTGGTCTTGCTGTGC TGG (reversed) Intergenic
902395096 1:16128251-16128273 AGCCTGTGGCCCTGCTGGGCTGG + Intronic
902416979 1:16245631-16245653 AGCCAGGGTTCTTGCTTTTCTGG - Intergenic
903437297 1:23360263-23360285 AGCCAGTGGTCTCTCTGGGTGGG - Exonic
905230760 1:36513754-36513776 AGGCAGTGGACATTCTGTGCAGG + Intergenic
906166709 1:43691795-43691817 AACTAGTGGTCTTCCTGTGGAGG + Intronic
906816417 1:48884807-48884829 AGCCAGTGTTCTTTCTCTGTAGG - Intronic
916303842 1:163306511-163306533 AGCCAGAGGCCTTCCTGGGCAGG - Intronic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
920254009 1:204642095-204642117 AGCCAGTGCTCTTGCTCTCCTGG + Intronic
922600234 1:226845639-226845661 AGATAGGGGTCTTGCTGTCCAGG - Intergenic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
924947426 1:248855837-248855859 CTCCAGTCCTCTTGCTGTGCCGG - Exonic
1065818102 10:29500297-29500319 AAACAGGGGTCTTGCGGTGCAGG - Intronic
1065954818 10:30684208-30684230 AGACAGGGGTCTTGTGGTGCAGG + Intergenic
1066007975 10:31165616-31165638 AGGCACTGGGATTGCTGTGCAGG + Intergenic
1066296847 10:34061288-34061310 AGGAAGTGGGCCTGCTGTGCAGG + Intergenic
1066993508 10:42539658-42539680 AGCCAGTGGCCTGGCTCGGCAGG - Intergenic
1068368725 10:56086478-56086500 AGCCAGTGGTTTTAATGTGGAGG + Intergenic
1069989181 10:72304001-72304023 AGCCAGTGGGCACGCAGTGCTGG - Intergenic
1070274833 10:74995919-74995941 AGCCAGGGTTCTGGCTCTGCAGG - Intronic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1074356135 10:112785141-112785163 TGCCAGTGGTGTAGCTGAGCAGG + Intronic
1074783083 10:116816158-116816180 AGCCAGTGGTCTTTGCGTGAGGG - Intergenic
1077111447 11:863915-863937 AGCCTGTGGTCTTGCTGGAGGGG + Intronic
1077436298 11:2540776-2540798 AGCCTGGGGACTTGCTGTGAGGG + Intronic
1078743441 11:14090098-14090120 ACCAAGTGGTCTTGCTCAGCCGG - Intronic
1081578622 11:44335532-44335554 AGGCAGTGTTTTCGCTGTGCTGG + Intergenic
1087582229 11:100072254-100072276 AGCCTGGAGTCTTGCTTTGCAGG - Intronic
1088039713 11:105363934-105363956 ACCCAGTGGTCTTTCTGCACAGG + Intergenic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1090470925 11:126980441-126980463 AGCCAGTGGGCTTGCTGAGAAGG + Intronic
1090629912 11:128637030-128637052 ACCCAGCAGTCTGGCTGTGCAGG + Intergenic
1093053329 12:14530145-14530167 AGCCAGGGGTCTTGCCATGAAGG + Intronic
1093805062 12:23422002-23422024 ACCCTGAGGTCTTGCTGTACTGG + Intergenic
1102556652 12:113731176-113731198 AGCCAGTGGTTTCCCAGTGCTGG + Intergenic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1103178737 12:118889194-118889216 AGGCATTGGTATAGCTGTGCTGG + Intergenic
1103462804 12:121118416-121118438 AGCCAATAGTCTTGCTCTCCTGG + Intergenic
1103610633 12:122122126-122122148 AGCCAGTGGTCTTGCAGAAATGG + Intronic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104226759 12:126842395-126842417 AGTAACTGGCCTTGCTGTGCTGG + Intergenic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1104923168 12:132301582-132301604 AGGCAGTCCTCCTGCTGTGCCGG - Intronic
1106268536 13:28132019-28132041 AGATGGTGGTCTTGCTGTGTTGG + Intergenic
1106920764 13:34561080-34561102 AGCCAGTGTACTTGCTGGGGAGG + Intergenic
1112053892 13:95671803-95671825 GGCAAGTCCTCTTGCTGTGCTGG - Intergenic
1112444689 13:99453480-99453502 AGCCAGTGGTGTGGCTCTGCTGG - Intergenic
1112943827 13:104899606-104899628 AGACATTTGTCTTTCTGTGCTGG - Intergenic
1113492131 13:110700408-110700430 AGCCAGTGACCTTGCTCTGAAGG + Intronic
1114907841 14:27152277-27152299 ACCCAGTCGTGTGGCTGTGCAGG - Intergenic
1119408300 14:74412205-74412227 AGGCAGAGGCCTTGCTGGGCTGG + Intronic
1121015433 14:90546166-90546188 GGCCAGTCCTCTAGCTGTGCTGG - Intronic
1121019536 14:90570805-90570827 GCCCGGTGGTGTTGCTGTGCGGG - Intronic
1121842833 14:97149176-97149198 AGCCTGTGCTCCTGCCGTGCTGG - Intergenic
1122261563 14:100526250-100526272 ACCCTGTGGGGTTGCTGTGCTGG - Intronic
1122689644 14:103526098-103526120 AGACAGGGATCTTGCTGTGTTGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1126435830 15:48636621-48636643 AGCCACTTGTCTGGCTCTGCTGG - Intronic
1128606495 15:69040079-69040101 GGCCAGGGGTCCTGCTGGGCTGG - Intronic
1131394914 15:92078496-92078518 AGTCAGTGGTGTGGCTGTGTAGG - Intronic
1132516110 16:366766-366788 AGGCTGTGGTCTGGCTCTGCAGG - Intergenic
1132561681 16:597673-597695 AGACAGAGGTTTTGCTGTGTTGG + Intronic
1139526266 16:67518630-67518652 AGCCAGTGGCCAGGCTGGGCTGG - Intronic
1139646535 16:68335298-68335320 AGTCAGCGGTCCTGCTGTCCTGG + Intronic
1139672630 16:68502132-68502154 AGCAAGTGGCCTTGCTGGGCTGG + Intergenic
1142212907 16:88816808-88816830 AGCCTGGGCTCCTGCTGTGCGGG - Intronic
1142297274 16:89232673-89232695 ATCCTGGGGTCTTGCTGTGGGGG + Exonic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144632430 17:16881017-16881039 TCCCAGTGGGCTTGCTGGGCAGG + Intergenic
1145728363 17:27154326-27154348 AGGTAGTGGTCTTGTTGTGGGGG - Intergenic
1146530672 17:33605206-33605228 AGCCAGGGCTCTTGCCATGCCGG - Intronic
1146631875 17:34475976-34475998 AGTCAGTGGCCCTGCTGAGCGGG + Intergenic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1152496019 17:80672312-80672334 AGCCCGAGGCCTTGCTATGCTGG - Intronic
1152770571 17:82165729-82165751 TGTCAGAGGTTTTGCTGTGCTGG - Intronic
1155406209 18:25490677-25490699 AGGATGTGGTGTTGCTGTGCTGG - Intergenic
1156026076 18:32656194-32656216 AGCCAGTGGACTTGCGGGGAAGG - Intergenic
1156084548 18:33382860-33382882 AGCCAGCAGTCTTGCTTGGCAGG + Intronic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165337635 19:35182869-35182891 AGGCAGTGGTGTGGCTTTGCTGG - Intergenic
1165382239 19:35489621-35489643 AGCCAGTGGTGTCACTGAGCTGG - Intronic
1166357405 19:42235344-42235366 AGCCAGTGGTTTTGGTGAGGGGG - Intronic
1168057967 19:53874009-53874031 AGCCAGTGATCTCGCCGGGCCGG - Exonic
927195839 2:20546149-20546171 AGCCAGTGGCCATGTTGTGAGGG + Intergenic
928088501 2:28360176-28360198 AGACACTGGTCTTGATGGGCTGG + Intergenic
928178628 2:29052045-29052067 TGCCAGTTGTCTTGCTGTCAGGG - Exonic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
932492535 2:72131370-72131392 AGCCTGTGTTCTAGCTGTCCTGG - Exonic
936449108 2:112620148-112620170 AGCCAATGGGCTGGCAGTGCGGG - Intergenic
937307363 2:120880610-120880632 AGCCTGTGGTTTTTCTGTCCAGG + Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938391798 2:130912473-130912495 AGCCAGTGCTCTTAAGGTGCAGG - Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
944530123 2:200659431-200659453 ACCCAGTGGTTCTCCTGTGCTGG + Intronic
947010254 2:225558084-225558106 AGGGAGTGGTCTGGCTGTGGAGG + Intronic
947943132 2:234076107-234076129 AGTCTGGGGTCTTGCTGTGCTGG + Intronic
948031828 2:234824327-234824349 GGCCAGTGCTCCTGCTGTGTGGG - Intergenic
949076060 2:242058619-242058641 AGCCAGTGGTCATCCTGGTCAGG + Intergenic
1169388918 20:5173736-5173758 AGCCCGTGGTCTTGCAGAGCAGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173965845 20:47112118-47112140 AGACAGCGGTCTTGCTCTGTTGG - Intronic
1174005907 20:47410526-47410548 TTCCATTGGTGTTGCTGTGCTGG + Intergenic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1176071797 20:63230787-63230809 TCCCAGGGTTCTTGCTGTGCCGG + Intergenic
1176366432 21:6035694-6035716 AGCCCTGGGGCTTGCTGTGCTGG + Intergenic
1176998235 21:15580744-15580766 AGCCAGTGGTTTGGCTGGTCAGG + Intergenic
1178041224 21:28642853-28642875 AGCCACTTGTGTTGCTCTGCCGG + Intergenic
1179757085 21:43502851-43502873 AGCCCTGGGGCTTGCTGTGCTGG - Intergenic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1180913497 22:19469689-19469711 AGCCAGTGCTTTTTCTGGGCTGG - Intronic
1181801519 22:25350766-25350788 AGCCAGTGGCGCAGCTGTGCGGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1182900024 22:33890043-33890065 AGCCAGTGGGCCAGCTGGGCTGG - Intronic
1182996168 22:34814497-34814519 AGGCAGTGAGCTTGCTGTGAAGG + Intergenic
1183359866 22:37377860-37377882 AGCCAGTGGCCGTGCTGGACGGG - Intronic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
953205004 3:40818576-40818598 AGCCAGTGGTGTTTCTCTGGTGG - Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
955935601 3:64099698-64099720 AGCCAATGGGGTTGCTGAGCTGG + Exonic
956254763 3:67272084-67272106 AGGCACTGATCTTGCTTTGCAGG + Intergenic
958071624 3:88621335-88621357 AGCCACTGTTCTTGCTCTCCAGG - Intergenic
958430930 3:94039916-94039938 AACCAGTGGTCTGGCTGAGTTGG + Exonic
958520015 3:95172317-95172339 AGCCAGTAGTTTCACTGTGCTGG - Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
961609883 3:128128172-128128194 AGACAGGGGTCTTGCTGTGTTGG + Intronic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
972726963 4:41753020-41753042 AGACAGTAGGCTAGCTGTGCTGG - Intergenic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
978186076 4:105858361-105858383 GCCGAGTGGTCTTGCTGAGCGGG - Intronic
980154927 4:129093154-129093176 AGACAGAGAGCTTGCTGTGCGGG + Exonic
982091950 4:151887965-151887987 AGTCAGTGGTGTTGGTGTGTTGG + Intergenic
987013514 5:13793412-13793434 ACCCAGTGCTCTTTCTGTGTGGG + Intronic
989120160 5:37997150-37997172 AGGCAGAGTTCTTGCAGTGCGGG + Intergenic
994112215 5:96019427-96019449 AGCCATTGGACTTGCTCTGGGGG + Intergenic
999527872 5:152427756-152427778 ATTCAATGGCCTTGCTGTGCTGG + Intronic
1001205516 5:169759036-169759058 AGCAAGTGGTGTTGCTATGCAGG + Intronic
1002485814 5:179535434-179535456 ATCCACTGGGCTTGCTGAGCTGG - Intergenic
1002893469 6:1357729-1357751 AGGGATTGGTCTTGCTGTCCTGG - Intergenic
1003071445 6:2948330-2948352 TCCCGTTGGTCTTGCTGTGCTGG + Exonic
1005482887 6:26271486-26271508 AGCCAATGGTTTTGTTGCGCGGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007995789 6:46306340-46306362 AGCCATTGGTCTAGAAGTGCTGG - Intronic
1008056263 6:46948977-46948999 AGACAGTGGCTTTGCTATGCTGG + Intronic
1009287446 6:61838709-61838731 AGCAAGTTGGCTTGCTGTGGTGG - Intronic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1012113308 6:95262459-95262481 TGCCAGACATCTTGCTGTGCAGG + Intergenic
1012171367 6:96020759-96020781 AACCAGTGATCTTGCACTGCTGG + Intronic
1014352690 6:120363717-120363739 AGCCAGTGGTTTGGCTTGGCTGG - Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1022062615 7:26813585-26813607 AGCCAGCGGCATTGCTGAGCTGG - Intronic
1022750446 7:33219150-33219172 CGCCAGTGGTCTGGCACTGCTGG - Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024301658 7:47891640-47891662 AGGCAGTGCTCCTGCTGAGCAGG - Intronic
1024410271 7:49032437-49032459 AGCCAGTGTACTTGATATGCTGG - Intergenic
1024662783 7:51514826-51514848 AGCCAGTGGCATGGCTTTGCTGG + Intergenic
1024984078 7:55180833-55180855 AGCCAGCGTTCCTGATGTGCAGG + Intronic
1026008294 7:66616765-66616787 AGACAGGGGTCTTGCTATGTTGG + Intergenic
1027630387 7:80597068-80597090 AGCCTGTTGTTTTGTTGTGCTGG + Intronic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1032259438 7:130323050-130323072 AGCCAGTGACCTTGCTCTGGTGG + Exonic
1034716565 7:153248292-153248314 AACCCGTGCTTTTGCTGTGCAGG - Intergenic
1038949414 8:32398309-32398331 AGCCAGTGGGGTTGCTGTGAGGG - Intronic
1039431576 8:37529158-37529180 TGCCAGGGTTCTGGCTGTGCCGG - Intergenic
1039930098 8:41978989-41979011 AGTCAGTGGACTTCCAGTGCAGG - Intronic
1041157855 8:55006219-55006241 AGCCAGTGGTTTTCCTTTTCTGG + Intergenic
1041656735 8:60359760-60359782 AGACAGTGATCTGGCTGTGATGG - Intergenic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1042821814 8:72937547-72937569 TGGCAGTGGCCTGGCTGTGCTGG - Exonic
1047078135 8:121427841-121427863 ATCCTGTGGTGTTGCTGTGGTGG - Intergenic
1048037282 8:130689295-130689317 AGCCAGTGCTCTTGCCCTGTGGG + Intergenic
1048955807 8:139535001-139535023 AGCCAGGTGTCTTGGAGTGCAGG + Intergenic
1056778119 9:89528902-89528924 AGTCTGTGGGCTTGCTGTCCTGG - Intergenic
1057270554 9:93648242-93648264 TCCCAGTGGTGTTGCTGAGCAGG + Intronic
1060083416 9:120674754-120674776 AGACAGGGGTCTTGCTATGTTGG + Intronic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1061583714 9:131553698-131553720 AGCCAGGGGTCTGGCTTTGGAGG - Intergenic
1062095638 9:134701820-134701842 AGCCAGGGGCCTTGCTTTCCCGG + Intronic
1185682882 X:1902964-1902986 ACCCAGAGGTCTTTCTTTGCGGG + Intergenic
1188716516 X:33465208-33465230 GCCCAGTTCTCTTGCTGTGCTGG - Intergenic
1191044058 X:56117087-56117109 AGATAGGGGTCTTGCTGTGTTGG - Intergenic
1191799935 X:65067091-65067113 GTCAAGTGGTCTTGCTGAGCAGG - Intergenic
1194545133 X:95225155-95225177 ACCAAGTGGTCTTGCTCAGCGGG + Intergenic
1196042030 X:111215137-111215159 AGACAGTGTTCTTGCTTTGAAGG - Intronic
1196047296 X:111269778-111269800 AGCCAGTGGTCTTCCTGCCCTGG - Intronic
1197857474 X:130931657-130931679 TGCAACTGTTCTTGCTGTGCAGG + Intergenic
1198327315 X:135586594-135586616 AGCCAGGGGTCCTGGGGTGCCGG - Intergenic