ID: 922663032

View in Genome Browser
Species Human (GRCh38)
Location 1:227446962-227446984
Sequence AAGAGCAAACAGAAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922663032_922663038 6 Left 922663032 1:227446962-227446984 CCCCCAGCCTTCTGTTTGCTCTT No data
Right 922663038 1:227446991-227447013 CTCAGAGAGCTGTATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922663032 Original CRISPR AAGAGCAAACAGAAGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr