ID: 922668487

View in Genome Browser
Species Human (GRCh38)
Location 1:227491973-227491995
Sequence TGAGCCACAGCCTCTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922668487_922668490 -5 Left 922668487 1:227491973-227491995 CCTGGGAAAGAGGCTGTGGCTCA No data
Right 922668490 1:227491991-227492013 GCTCAAGGGCCTGACCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922668487 Original CRISPR TGAGCCACAGCCTCTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr