ID: 922668938

View in Genome Browser
Species Human (GRCh38)
Location 1:227494591-227494613
Sequence GTGCTTGTGGATGTGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922668938_922668949 9 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668949 1:227494623-227494645 CACGTACCTGCCACCTGACGGGG No data
922668938_922668952 14 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668952 1:227494628-227494650 ACCTGCCACCTGACGGGGGCGGG No data
922668938_922668947 7 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668947 1:227494621-227494643 GGCACGTACCTGCCACCTGACGG No data
922668938_922668951 13 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668951 1:227494627-227494649 TACCTGCCACCTGACGGGGGCGG No data
922668938_922668954 17 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668954 1:227494631-227494653 TGCCACCTGACGGGGGCGGGAGG No data
922668938_922668948 8 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668948 1:227494622-227494644 GCACGTACCTGCCACCTGACGGG No data
922668938_922668957 29 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668957 1:227494643-227494665 GGGGCGGGAGGACATCAGCGAGG No data
922668938_922668950 10 Left 922668938 1:227494591-227494613 CCCGGCTCCACATCCACAAGCAC No data
Right 922668950 1:227494624-227494646 ACGTACCTGCCACCTGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922668938 Original CRISPR GTGCTTGTGGATGTGGAGCC GGG (reversed) Intergenic
No off target data available for this crispr