ID: 922670660

View in Genome Browser
Species Human (GRCh38)
Location 1:227506711-227506733
Sequence GTGCTTGTGGATGTGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922670649_922670660 9 Left 922670649 1:227506679-227506701 CCCCGTCAGGTGGCAGGTACGTG No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670648_922670660 10 Left 922670648 1:227506678-227506700 CCCCCGTCAGGTGGCAGGTACGT No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670651_922670660 7 Left 922670651 1:227506681-227506703 CCGTCAGGTGGCAGGTACGTGCC No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670646_922670660 14 Left 922670646 1:227506674-227506696 CCCGCCCCCGTCAGGTGGCAGGT No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670643_922670660 18 Left 922670643 1:227506670-227506692 CCCTCCCGCCCCCGTCAGGTGGC No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670640_922670660 29 Left 922670640 1:227506659-227506681 CCTCGCTGATGCCCTCCCGCCCC No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670647_922670660 13 Left 922670647 1:227506675-227506697 CCGCCCCCGTCAGGTGGCAGGTA No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670644_922670660 17 Left 922670644 1:227506671-227506693 CCTCCCGCCCCCGTCAGGTGGCA No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data
922670650_922670660 8 Left 922670650 1:227506680-227506702 CCCGTCAGGTGGCAGGTACGTGC No data
Right 922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922670660 Original CRISPR GTGCTTGTGGATGTGGAGCC GGG Intergenic
No off target data available for this crispr