ID: 922671797

View in Genome Browser
Species Human (GRCh38)
Location 1:227514180-227514202
Sequence AAACCCTGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922671794_922671797 20 Left 922671794 1:227514137-227514159 CCAATCTACTCTGTAACCTTGTT No data
Right 922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG No data
922671796_922671797 4 Left 922671796 1:227514153-227514175 CCTTGTTTTGGTTGCTGTCACTG No data
Right 922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922671797 Original CRISPR AAACCCTGCTTCACAAAGAC AGG Intergenic