ID: 922672057

View in Genome Browser
Species Human (GRCh38)
Location 1:227517636-227517658
Sequence GGGCAGTATTTTTAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922672054_922672057 -10 Left 922672054 1:227517623-227517645 CCTCGGGTCCAATGGGCAGTATT No data
Right 922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG No data
922672048_922672057 22 Left 922672048 1:227517591-227517613 CCTTTGAAAGGCATGTTAGAAAA No data
Right 922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG No data
922672051_922672057 -2 Left 922672051 1:227517615-227517637 CCAAGATTCCTCGGGTCCAATGG No data
Right 922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922672057 Original CRISPR GGGCAGTATTTTTAGTTGGT AGG Intergenic
No off target data available for this crispr