ID: 922673433

View in Genome Browser
Species Human (GRCh38)
Location 1:227532560-227532582
Sequence GACTCAGGGCTGTTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922673433_922673440 -7 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673440 1:227532576-227532598 CTGAGTCTGTTTCCAGGTGGAGG 0: 16
1: 30
2: 120
3: 235
4: 735
922673433_922673446 22 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673446 1:227532605-227532627 GGGGCTTGAAAATTTGCCCAAGG No data
922673433_922673443 2 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673443 1:227532585-227532607 TTTCCAGGTGGAGGGTTAGAGGG No data
922673433_922673444 3 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673444 1:227532586-227532608 TTCCAGGTGGAGGGTTAGAGGGG No data
922673433_922673442 1 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673442 1:227532584-227532606 GTTTCCAGGTGGAGGGTTAGAGG No data
922673433_922673441 -6 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673441 1:227532577-227532599 TGAGTCTGTTTCCAGGTGGAGGG 0: 11
1: 28
2: 63
3: 147
4: 420
922673433_922673437 -10 Left 922673433 1:227532560-227532582 CCTGCCACCAACAGCCCTGAGTC No data
Right 922673437 1:227532573-227532595 GCCCTGAGTCTGTTTCCAGGTGG 0: 21
1: 28
2: 55
3: 74
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922673433 Original CRISPR GACTCAGGGCTGTTGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr