ID: 922675861

View in Genome Browser
Species Human (GRCh38)
Location 1:227548737-227548759
Sequence CCCAACAAAAGTTTTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922675861_922675866 15 Left 922675861 1:227548737-227548759 CCTTTCCCAAAACTTTTGTTGGG No data
Right 922675866 1:227548775-227548797 TCTAGATTTTTAGAAATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922675861 Original CRISPR CCCAACAAAAGTTTTGGGAA AGG (reversed) Intergenic